Application and method of GhDRP4 gene or encoding protein thereof in improvement of drought resistance of cotton

Abstract

The invention belongs to the field of gene engineering, and relates to research on drought resistance of cotton, in particular to application and a method of a GhDRP4 gene or an encoding protein thereof in improving the drought resistance of the cotton. According to the invention, differential expression genes of drought-tolerant (ZY007) and sensitive (ZY168) cotton under drought stress are analyzed through RNA-seq, and GhDRP4 (SEQ ID No.1) is found to be significantly down-regulated under the drought condition. Functional verification of the GhDRP4 gene (SEQ ID No.1) screened based on transcriptome data shows that the gene encodes U-box type E3 ubiquitin ligase and negatively regulates the drought resistance of cotton. GhDRP4 or CRISPR / Cas9 is silenced through a VIGS technology to knock out the gene (ghdrp4 mutant), so that the drought resistance and survival rate of the cotton are remarkably improved, and a new target is provided for drought-resistant breeding.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to the research on drought resistance of cotton. Background Art

[0002] As an important economic crop in the world, the growth and yield of cotton are extremely susceptible to drought stress. Drought can cause water deficit in cotton plants, hinder photosynthesis, and stunted growth and development, ultimately resulting in a decline in fiber quality and a sharp drop in yield. As an important economic crop, improving the drought resistance of cotton is of great significance for ensuring the sustainable development of agriculture, optimizing water resource utilization, and coping with extreme climates. In recent years, with the development of molecular biology and genetic engineering technology, research on cotton drought resistance has made significant progress. Through transcriptomics and functional genomics analysis, scientists have identified several key genes involved in cotton drought resistance response. These genes help plants adapt to drought environments by regulating mechanisms such as stomatal closure, accumulation of osmotic regulating substances, antioxidant defense, and hormone signal transduction.

[0003] Plant U-box proteins (PUBs) are key members of the E3 ubiquitin ligase family. Their structural hallmark is a conserved U-box domain, which mediates the ubiquitination of substrate proteins, thereby regulating their stability, activity, or subcellular localization (Trenner et al., 2008). PUBs are widely involved in plant physiological processes such as growth and development, immune defense, and abiotic stress responses. Under stress conditions such as drought, high salt concentration, and low temperature, PUBs selectively ubiquitinate key signaling proteins (such as receptor kinases, transcription factors, and ion channels), precisely regulating the activation or repression of stress signaling pathways. Thousands of genes encode ubiquitin ligases in Arabidopsis thaliana, and several members of the PUB family have been reported to play a role in plant responses to drought and cold stress (Wang et al., 2023; Zhao et al., 2017). However, the functions of many PUBs remain uncertain. Summary of the Invention

[0004] For newly discovered GhDRP4 What is the specific function of the gene? This application has conducted in-depth exploration and proposed a GhDRP4 The application and method of the gene or its encoded protein in improving the drought resistance of cotton GhDRP4 gene Expression inhibition can effectively improve cotton drought tolerance and provide new molecular targets and breeding schemes for genetic improvement of cotton drought resistance.

[0005] The technical solution of the present invention is achieved as follows: This application used RNA-seq to analyze the differentially expressed genes of drought-tolerant (ZY007) and sensitive (ZY168) cotton under drought stress and found that GhDRP4 (SEQ ID No. 1) was significantly downregulated under drought conditions ( Figure 1 ). Based on transcriptome data screening GhDRP4 Functional verification of the gene (SEQ ID No. 1) showed that the gene encodes a U-box type E3 ubiquitin ligase that negatively regulates cotton drought resistance.

[0006] On the one hand, requesting protection GhDRP4 Application of a gene or its encoded protein in improving drought resistance of cotton, the GhDRP4 The nucleotide sequence of the gene has more than 80% similarity to the nucleotide sequence shown in SEQ ID No. 1, for example, 85% similarity, or 90% similarity, or 95% similarity.

[0007] Preferably, the above GhDRP4 The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 2.

[0008] The above applications are suppressed or silenced GhDRP4 The function of genes can improve the drought resistance of cotton.

[0009] On the other hand, a method for improving drought resistance of cotton is also provided, comprising the steps of: using biotechnology to GhDRP4 Gene function inhibition or silencing construct gene GhDRP1 The VIGS expression vector was then injected into the back of cotton cotyledons through the Agrobacterium transformation method. After injection, the cotton was kept away from light for 12 hours and then cultured under normal light to improve the drought resistance of cotton. GhDRP4 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0010] The injection area should exceed 95% of the cotton cotyledon area.

[0011] Furthermore, the above-mentioned biotechnology is RNA interference technology or CRISPR gene editing technology.

[0012] The steps of the above RNA interference technology are: construct GhDRP4 The interference vector of the gene is then transformed into the genome of cotton to obtain highly drought-resistant cotton plants.

[0013] Alternatively, the steps of the above-mentioned CRISPR gene editing technology are: using CRISPR / Cas9 gene editing to GhDRP4 The function of the gene is lost, and the prepared recombinant vector is then transformed into the genome of cotton to obtain highly drought-resistant cotton plants.

[0014] Specifically, the target site of the CRISPR / Cas9 gene editing includes sgRNA1 with a sequence as shown in SEQ ID No. 3 and sgRNA2 with a sequence as shown in SEQ ID No. 4.

[0015] The present invention has the following beneficial effects: The present invention cloned and obtained the first GhDRP4 CRISPR / Cas9-mediated gene editing and VIGS silencing technology confirmed that this gene is involved in cotton drought resistance as a negative regulatory factor. The resulting homozygous mutant material exhibited a significantly enhanced drought resistance phenotype, providing a new target for the genetic improvement of crop drought resistance. This invention not only identified a new negative regulatory factor for cotton drought resistance, but more importantly, the mutant material showed no obvious growth inhibition under field drought conditions, showing good application prospects. These findings provide a theoretical basis and novel molecular targets for the genetic improvement of crop drought resistance, which is of great significance for ensuring food security. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0017] Figure 1 for GhDRP4 Gene expression patterns after drought treatment in two cotton varieties, ZY168 (sensitive) and ZY007 (drought-tolerant) (the green bars on the left represent normal leaves; the brown bars on the right represent drought-resistant leaves; ns: no significant difference; *: significant difference; **: extremely significant difference).

[0018] Figure 2 for GhDRP4 Gene interference efficiency detection diagram; Figure (a) is TRV:GhDRP4 Agrobacterium nucleic acid gel electrophoresis diagram; Figure (b) is the interference efficiency detection RT-PCR acid gel electrophoresis diagram; Figure (c) is the QRT-PCR interference efficiency detection result bar chart ( TRV:00 : The green bar chart on the left, TRV:GhDRP4 : brown bar graph on the right, ***: extremely significant difference).

[0019] Figure 3 Control plants TRV:00 With silent plants TRV:GhDRP4 Growth of the plant, where Figure (a) is the control plantTRV:00 With silent plants TRV:GhDRP4 In sufficient water 、 Plant phenotypes under conditions of 10 days of drought and 24 hours of rewatering; Figure (b) is the positive control, TRV:CLA Intervention plant (CLA is a key enzyme in chlorophyll synthesis) albino phenotype; Figure (c) is the control plant TRV: 00 With silent plants TRV:GhDRP4 Survival rate ( TRV:00 : Gray box plot on the left, TRV:GhDRP4 : Black box plot on the right. ***: Extremely significant difference) and plant height ( TRV:00 : Green scatter plot on the left, TRV:GhDRP4 : Brown scatter plot on the right. ns: no significant difference) statistical results.

[0020] Figure 4 Wild type (WT) and ghdrp4 Growth of mutant plants; Figure (a) shows the growth of wild type (WT) and ghdrp4 Drought phenotypes of mutant plants in sufficient water, drought for 10 days, and after 24 hours of rehydration; Figure (b) shows the wild-type plants WT and [[ID=�7]]ghdrp4 Survival rate of mutant plants (WT: green violin plot on the left, GhDRP4 Brown violin plot on the right. ***: extremely significant difference) and plant height (WT: green scatter plot on the left, GhDRP4 Brown scatter plot on the right (ns: no significant difference) Statistical results. DETAILED DESCRIPTION

[0021] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods used in the following experimental examples are conventional methods; the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0023] In this study, we used RNA-seq to analyze differentially expressed genes in drought-tolerant (ZY007) and sensitive (ZY168) cotton under drought stress and found that GhDRP4 (SEQ ID No. 1) was significantly downregulated under drought conditions. GhDRP4Functional verification of the gene (SEQ ID No. 1) showed that the gene encodes a U-box type E3 ubiquitin ligase that negatively regulates cotton drought resistance. The amino acid sequence of the gene is shown in SEQ ID No. 2. VIGS technology was used to silence GhDRP4 or CRISPR / Cas9 was used to knock out the gene ( ghdrp4 mutants), both significantly improved the drought resistance and survival rate of cotton, providing new targets for drought-resistant breeding.

[0024] The specific experiments are as follows: Example 1: Construction of TRV:GhDRP4 viral interference vector and VIGS-mediated gene silencing 1. The TRV system usually contains two vectors: pTRV1 encodes proteins related to viral replication and movement (RNA-dependent RNA polymerase, etc.). pTRV2 carries the target gene fragment (cDNA inverted repeat sequence or fragment of the target gene) to trigger silencing. GhDRP4 The gene-specific sequence is 447 bp and avoids homology with other genes.

[0025] The target gene fragment was amplified by PCR. The reaction system included 10 μL of 2× Phanta Max Buffer, 0.4 μL of 10 mM dNTPs, 30 mM each of GhDRP4-VIGS-F / R (forward primer: GhDRP4-VIGS-F (5'- TCCCCTCAATCCACCTTCC -3'); reverse primer: GhDRP4-VIGS-R (5'- TCCAGTCTCGGATGCCTC -3')), 5 μL of cDNA template, and 0.1 μL of Phanta Max Super-Fidelity DNA Polymerase (5 U / μL). The mixture was filled to 20 μL with ddH2O. Reaction program: 95°C, 5 min; 95°C, 30 s; 58°C, 15 s; 72°C, 10 s; 38 cycles; 12°C, 5 min.

[0026] 2. Use restriction enzymes Bam HI and Kpn Ⅰ. Double-digest the pTRV2 plasmid vector, linearize it and then recover it on gel.

[0027] Reaction system: 10× Cutsmart Buffer 5 μL, Bam HI 1 μL, Kpn Ⅰ 1 μL, pTRV2 plasmid 2 μg, ddH2O to make up to 50 μL; reaction procedure: 37℃ 3 h.

[0028] 3. Connect the PCR product and the digested pTRV2 plasmid fragment using a one-step cloning method: Reaction system: 5×CE II Buffer 2 μL, TRV: GhDRP4 100 ng of gene fragment, 50 ng of pTRV2 plasmid digestion product, 1 μL of Exnase II, and ddH2O were added to make up to 10 μL; reaction procedure: 37℃ 30 min.

[0029] 4. Transform the ligation product into E. coli DH5α and screen for positive clones The TRV:GhDRP4 vector was transformed into Escherichia coli DH5α (Tiangen Biochemical Technology Co., Ltd.) using the heat shock method, and the transformation product was plated onto LB plates containing antibiotics. Positive clones were screened using PCR with specific primers (GhDRP4-VIGS-F / R) and verified by sequencing before use in Agrobacterium transformation experiments. 5. GV3101 Agrobacterium Transformation: After the confirmed positive clones were expanded and the plasmid was extracted, 1–3 μL of plasmid DNA was mixed with 50 μL of Agrobacterium GV3101 competent cells (Tiangen Biochemical Technology Co., Ltd.) and transformed by electroporation. The transformation product was plated onto LB plates containing the corresponding antibiotics and incubated at 28°C for 48 hours. Single colonies were screened and verified by PCR. Positive bacterial cultures were stored at -80°C until needed.

[0030] 5.VIGS infection of cotton a. Activation and propagation of Agrobacterium: LB liquid medium (peptone 1 g / L, yeast powder 0.5 g / L, NaCl 0.5 g / L), autoclave and set aside. Inoculation: Inoculate the constructed TRV1, TRV2:GhDRP4 Agrobacterium into LB medium at a ratio of 1:10, and culture at 28°C, 180 rpm, shaking for 10-12 hours until the OD reaches 0. 600 =1.0-1.2. Bacterial collection: Centrifuge at 4,000 rpm for 10 minutes, discard the supernatant, and resuspend the cells in infection buffer (1 M MES 10 mM, 1 M MgCl2 10 mM, 0.1 M AS 200 μM, and dilute to 100 mL with sterile water). b. Bacterial solution mixing and induction: Dilute the TRV1 and TRV2:GhDRP4 bacterial solutions to OD 600 =0.8-1.0, mixed at a volume ratio of 1:1. Static induction: Stand at room temperature in the dark for 3 hours to promote VirGene activation. c. Cotton infection: Select 7-day-old cotton seedlings with fully expanded cotyledons (photoperiod 16 h / 8 h, 23°C). Use a syringe to gently inject the mixed bacterial solution onto the back of the cotyledons, ensuring that more than 95% of the leaf area is covered. After infection, culture in the dark for 12 hours, then transfer to a normal photoperiod (16 h / 8 h) and continue culturing. d. Phenotypic observation: Verify by qPCR 10-14 days after infection GhDRP4 Gene silencing effect.

[0031] Example 2: TRV:GhDRP4 interference efficiency detection Three biological replicates of TRV:00 and TRV:GhDRP4 cotton true leaves were obtained after 10-14 days of interferon treatment. Total RNA was extracted using the Tiangen Bio Polysaccharide and Polyphenol Plant Total RNA Extraction Kit (DP441). Reverse transcription was performed using the Toyobo ReverTraAce qPCR RT Kit to synthesize cDNA for subsequent RT-PCR and qRT-PCR analysis.

[0032] Genes encoding ubiquitin proteins GhUBQ7 As internal reference: TRV: GhDRP4 fluorescence quantitative primer is GhDRP4-QRT-F: (5′- GTGCCATCTCGTGGGGGT -3′); GhDRP4-QRT-R: (5'-TCCAGTCTCGGATGCCTC-3').

[0033] The PCR amplification products were detected by 1.2% gel electrophoresis ( Figure 2 a, b). qRT-PCR experiments were performed on a Roche LightCycler 96 real-time fluorescence quantitative PCR system. GhUBQ7 For each reference gene, three replicates were set up. −∆Ct The relative gene expression was calculated by Figure 2 c) By Figure 2 c It can be seen that TRV:GhDRP4 interferes with the growth of plant leaves GhDRP4 The gene expression level was only in the control TRV:00 plants GhDRP4 25% of gene expression.

[0034] Example 3: Determination of drought resistance of TRV:GhDRP4 interference materials The experimental results show that in GhDRP4After 2 weeks of gene interference, there was no significant difference in plant height between the TRV:00 control group and the TRV:GhDRP4-intervention plants (P>0.05). When the soil moisture content dropped to 80%, drought stress was applied for 10 days and it was found that the degree of leaf wilting in the TRV:GhDRP4-intervention plants was significantly less than that in the control group ( Figure 3 a). Quantitative analysis showed that after 24 hours of rehydration, the survival rate of TRV:GhDRP4-interfered plants was twice that of the control group ( Figure 3 c). These data fully prove that GhDRP4 Gene silencing can significantly enhance cotton's drought resistance, as confirmed by phenotypic and physiological levels. GhDRP4 Negative regulatory role in cotton drought resistance regulation.

[0035] Example 4: GhDRP4 Creation of genetic CRISPR / Cas9 materials First, design GhDRP4 The target sites of gene-specific sequences were cloned into gene products containing promoters and sgRNA fragments of pYLgRNA-AtU3b and pYLgRNA-AtU6-29.

[0036] The second round of PCR amplification was performed using the first round PCR product as a template: 20 μL reaction system: 2× KOD Buffer 10 μL, first round PCR mixed product 20-50 ng, primers Pps-GGL / Pgs-GG2 30 / 30 mM, Pps-GG2 / Pgs-GGR 30 / 30 mM, fill up to 20 μL with ddH2O, and mix gently.

[0037] Involved sgRNA and primer sequences: sgRNA1(SEQ ID No.3):TGAACAAGTCCAGACTGATT; sgRNA2(SEQ ID No.4):GATCCTGTCACTCTCTGTAC; GhDRP4-SgRNA1-F (SEQ ID No.5): TGAACAAGTCCAGACTGATTGTTTTAGAGCTAGAAAT; GhDRP4-SgRNA1-R (SEQ ID No. 6): AATCAGTCTGGACTTGTTCACAATCTCTTAGTCGACT; GhDRP4-SgRNA2-F (SEQ ID No.7): GATCCTGTCACTCTCTGTACGTTTTAGAGCTAGAAAT; GhDRP4-SgRNA2-R(SEQ ID No.8): GTACAGAGAGTGACAGGATCTGACCAATGTTGCTCCC; UF: CTCCGTTTTACCTGTGGAATCG; gR-R: CGGAGGAAAATTCCATCCAC.

[0038] Pps-GGL:TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG; Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC; Pps-GG2:TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG; Pgs-GGR:AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC.

[0039] PCR amplification procedure: A three-step amplification protocol was used: 42 cycles of denaturation at 98°C for 10 s, annealing / extension at 68°C for 5 s, and a final 10-min hold at 12°C to clone the complete sgRNA1 / 2 expression cassette. Second-round PCR products were gel-purified and recovered, and the size and concentration of the amplified products were verified by agarose gel electrophoresis.

[0040] Golden Gate Assembly: Reaction system (15 μL): 10× CutSmart Buffer 1.5 μL, 10 mM ATP 1.5 μL, CRISPR / Cas9-P35-N vector (100 ng), sgRNA expression cassette mixture (50 ng), Bsa Ⅰ-HF enzyme 0.5 μL (10 U), T4 DNA ligase 0.2 μL (80 U).

[0041] After mixing the above components, assemble them through Golden Gate Cas9 The gene and sgRNA1 / 2 expression cassette were inserted in tandem into a modified cotton CRISPR / Cas9 vector (kindly provided by Professor Liu Yaoguang of South China Agricultural University). Heat-shock transformation was performed into competent Escherichia coli DH5α cells. Positive clones were screened using kanamycin-resistant plates.

[0042] Colony PCR verification was performed using a vector-specific primer pair: forward primer SP-L2: GTCGTGCTCCACATGTTGACCG; reverse primer SP-R: CCGACATAGATGCAATAACTTC, and PCR-positive clones were sequenced to confirm their correctness.

[0043] The plasmid, verified to be correct by sequencing, was transformed into Agrobacterium tumefaciens LBA4404. The transformation of etiolated cotton seedling hypocotyls was carried out using Agrobacterium-mediated transformation. The key steps involved inducing cell dedifferentiation, callus redifferentiation, and plant regeneration, ultimately yielding gene-edited cotton plants.

[0044] Example 5: GhDRP4 Drought resistance test of mutant materials Drought stress experiments showed that under normal growth conditions (two leaves and one heart stage), the wild type WT and ghdrp4 There was no significant difference in plant height between the mutant plants (P>0.05). However, after 10 days of continuous drought treatment, the wild-type plants showed obvious leaf wilting, while ghdrp4 The mutant plants still maintained a good growth state, and the true leaves did not show obvious wilting ( Figure 4 a). After 24 hours of rehydration, the results were statistically analyzed. ghdrp4 The survival rate of mutant plants was about 2 times higher than that of wild type ( Figure 4 b) These experimental results confirm that ghdrp4 The loss of gene function significantly enhanced the drought resistance of cotton, further verifying that ghdrp4 It plays an important role as a negative regulatory factor in drought resistance.

[0045] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. GhDRP4 The application of a gene or its encoded protein in improving drought resistance of cotton is characterized by: described GhDRP4 The nucleotide sequence of the gene has more than 80% similarity with the nucleotide sequence shown in SEQ ID No.

1.

2. according to claim 1 GhDRP4 The application of a gene or its encoded protein in improving drought resistance of cotton is characterized by: described GhDRP4 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

3. according to claim 2 GhDRP4 The application of a gene or its encoded protein in improving drought resistance of cotton is characterized by: The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

4. according to claim 1 GhDRP4 The application of a gene or its encoded protein in improving drought resistance of cotton is characterized by: The application is suppressed or silenced GhDRP4 The function of genes can improve the drought resistance of cotton.

5. A method for improving drought resistance of cotton, characterized in that: The steps are: using biotechnology to GhDRP4 Functional inhibition or silencing of genes to improve drought resistance in cotton; GhDRP4 The nucleotide sequence of the gene is shown in SEQ ID No.

1.

6. The method for improving drought resistance of cotton according to claim 5, characterized in that: The biotechnology is RNA interference technology or CRISPR gene editing technology.

7. The method for improving drought resistance of cotton according to claim 6, characterized in that: The steps of the RNA interference technology are: constructing GhDRP4 The VIGS interference vector of the gene is then transformed into the genome of cotton to obtain highly drought-resistant cotton plants.

8. The method for improving drought resistance of cotton according to claim 7, wherein: The transformation is achieved by injecting the VIGS interference vector bacterial solution on the back of cotton cotyledons.

9. The method for improving drought resistance of cotton according to claim 6, wherein: The steps of the CRISPR gene editing technology are: using CRISPR / Cas9 gene editing to GhDRP4 The function of the gene is lost, and the prepared recombinant vector is then transformed into the genome of cotton to obtain highly drought-resistant cotton plants.

10. The method for improving drought resistance of cotton according to claim 9, wherein: The target site for CRISPR / Cas9 gene editing includes sgRNA1 with a sequence as shown in SEQ ID No. 3 and sgRNA2 with a sequence as shown in SEQ ID No. 4.

Images