MUC1-CAR-T cell for co-expressing BTLA / IL-18R chimeric receptor as well as preparation method and application of MUC1-CAR-T cell

Abstract

The invention discloses an MUC1-CAR-T cell for co-expressing a BTLA / IL-18R chimeric receptor as well as a preparation method and application of the MUC1-CAR-T cell, and belongs to the technical field of biological medicines. The MUC1-CAR-T cell comprises a BTLA / IL-18R chimeric receptor and an MUC1-CAR structure, wherein the BTLA / IL-18R chimeric receptor is a BTLA MUC1 is used as a targeting molecule for CAR-T cell therapy, an extracellular domain of BTLA is connected with a transmembrane domain and an intracellular domain of an IL-18 receptor, and the co-expression BTLA / IL-18R chimeric receptor is designed. Experimental verification shows that the BTLA / IL-18R chimeric receptor can significantly improve the tumor killing ability of MUC1-CAR-T cells, can better inhibit the growth of tumors, and provides a novel immunotherapy strategy for the treatment of pancreatic cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a MUC1-CAR-T cell co-expressing BTLA / IL-18R chimeric receptor, and a preparation method and application thereof. Background Art

[0002] Pancreatic cancer is a highly malignant and difficult-to-treat solid tumor, the fourth leading cause of cancer-related death, with a five-year survival rate of less than 12%. It lacks specific clinical symptoms and sensitive screening methods, so it is usually diagnosed in the late or metastatic stages. Currently, there are limited treatment options for pancreatic cancer, with only 15% of pancreatic cancer patients eligible for surgical resection, and most patients experience recurrence and metastasis within two years after surgery. Pancreatic cancer exhibits poor sensitivity to immunotherapy and is therefore considered an immune "cold" tumor. In addition, the heterogeneity of pancreatic cancer cells and the lack of specific genetic alterations make the clinical results of targeted therapies unsatisfactory. Therefore, it is of great significance to understand the biological characteristics and limiting factors of pancreatic cancer and develop more effective treatments.

[0003] Adoptive cell transfer-based therapy for solid tumors is an emerging field. Its personalized and targeted nature offers a low-risk approach to cancer treatment. CAR-T cells, in particular, hold great potential in cancer immunotherapy. By expressing specific antigen-recognition receptors and intracellular activation signals, they bind to and activate specific antigens on the surface of tumor cells. After injection into the patient, CAR-T cells proliferate rapidly, targeting and killing tumor cells. While CAR-T cell therapy has achieved success in hematological malignancies, its effectiveness in solid tumors remains limited. This is primarily due to the lack of specific tumor targets for CAR-T cells. Most antigens targeted by CAR-T cells for solid tumors are tumor-associated antigens, rather than tumor-specific antigens. These antigens are expressed at high levels in tumors and also to some extent in some normal healthy tissues. However, the expression of these antigens in normal tissues often leads to significant off-target toxicity and serious side effects. Therefore, further improvements to existing technologies are needed to enhance the therapeutic efficacy of CAR-T cells. Summary of the Invention

[0004] The purpose of the present invention is to provide a MUC1-CAR-T cell that co-expresses a BTLA / IL-18R chimeric receptor, and a preparation method and application thereof, to solve the problems existing in the above-mentioned prior art. The BTLA / IL-18R chimeric receptor significantly improves the tumor killing ability of MUC1-CAR-T cells, providing a new immunotherapy strategy for the treatment of pancreatic cancer.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a MUC1-CAR-T cell that co-expresses a BTLA / IL-18R chimeric receptor, wherein the MUC1-CAR-T cell comprises a BTLA / IL-18R chimeric receptor and a MUC1-CAR structure;

[0007] The BTLA / IL-18R chimeric receptor includes the BTLA extracellular region, the IL-18R transmembrane region and the IL-18R intracellular region;

[0008] The MUC1-CAR structure includes a signal peptide, a detection tag, a MUC1 antibody single-chain variable fragment, a hinge region, a transmembrane domain and a signal transduction domain.

[0009] Optionally, the BTLA / IL-18R chimeric receptor and MUC1-CAR structure are connected via a T2A sequence;

[0010] The T2A sequence is shown as SEQ ID NO.11.

[0011] Optionally, the nucleotide sequences of the BTLA extracellular region, IL-18R transmembrane region, and IL-18R intracellular region are shown as SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively;

[0012] The nucleotide sequences of the signal peptide, detection tag, single-chain variable fragment, hinge region and transmembrane domain of the MUC1 antibody are shown in SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, respectively;

[0013] The signal transduction domains are 4-1BB and CD3ζ, and the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0014] The present invention also provides an expression vector comprising a BTLA / IL-18R chimeric receptor encoding gene, a MUC1-CAR structure encoding gene, and a T2A sequence;

[0015] The BTLA / IL-18R chimeric receptor includes the BTLA extracellular region, the IL-18R transmembrane region, and the IL-18R intracellular region, and the encoding genes are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively;

[0016] The MUC1-CAR structure includes a signal peptide, a detection tag, a MUC1 antibody single-chain variable fragment, a hinge region, a transmembrane domain, and a signal transduction domain. The signal transduction domain is 4-1BB and CD3ζ, and the encoding genes are shown in SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively;

[0017] The T2A sequence is shown as SEQ ID NO.11.

[0018] Optionally, the expression vector comprises a lentiviral vector.

[0019] The present invention also provides a recombinant lentivirus, which is prepared by co-transfecting mammalian cells with the expression vector and packaging helper plasmid.

[0020] The present invention also provides a method for preparing the MUC1-CAR-T cells, comprising the step of introducing the expression vector or the recombinant lentivirus into T cells.

[0021] The present invention also provides use of the MUC1-CAR-T cell, the expression vector, or the recombinant lentivirus in preparing a tumor therapeutic drug.

[0022] Optionally, the tumor comprises pancreatic cancer.

[0023] The present invention also provides a tumor treatment drug, which contains the MUC1-CAR-T cells.

[0024] The present invention discloses the following technical effects:

[0025] This invention is the first to co-express BTLA / IL-18R chimeric receptors in MUC1-CAR-T cells to treat pancreatic cancer. Experimental studies were conducted both in vivo and in vitro. The purpose was to improve the immunosuppressive state of T cells, enhance the killing, activation, and proliferation capabilities of CAR-T cells, increase the proportion of central memory T cells, reduce the exhaustion level of T cells, enhance the toxicity of CAR-T cells in pancreatic cancer treatment, and maintain long-term immune response, thereby enhancing the effect of killing tumor cells.

[0026] Using MUC1 as a target molecule for CAR-T cell therapy, and to reverse the immunosuppressive effects of HVEM molecules on pancreatic tumors, the extracellular domain of BTLA was linked to the transmembrane and intracellular domains of the IL-18 receptor (IL-18R). This co-expressed BTLA / IL-18R chimeric receptor was designed and tested to investigate its effects on the cytotoxicity, activation, proliferation, differentiation, and exhaustion of MUC1-CAR-T cells. The anti-tumor effects of the BTLA / IL-18R chimeric receptor on MUC1-CAR-T cells were also evaluated. In vitro results showed that the BTLA / IL-18R chimeric receptor significantly enhanced the tumor-killing capacity of MUC1-CAR-T cells, significantly enhanced the activation and proliferation of CAR-T cells, increased the proportion of central memory T cells, and reduced CAR-T cell exhaustion. In vivo studies also showed that co-expression of the BTLA / IL-18R chimeric receptor significantly improved the survival rate of mice and effectively inhibited tumor growth, providing a novel immunotherapy strategy for the treatment of pancreatic cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 Schematic diagram of the structure of MUC1-CAR and BTLA / IL-18R-MUC1-CAR;

[0029] Figure 2 This is a graph showing the detection of lentivirus titer;

[0030] Figure 3 This is a graph showing the positive rate of CAR-T cells; the upper graph shows the expression level of CAR; the lower graph shows the expression level of BTLA;

[0031] Figure 4 Detection diagram of the expression levels of MUC1 (upper panel) and HVEM (lower panel) in pancreatic cancer cells;

[0032] Figure 5 The figure below shows the detection of CAR-T cell killing ability. The left figure shows the Capan-2 cell line; the right figure shows the HPAC cell line.

[0033] Figure 6 The above figure shows the expression level of CD69 protein; the lower figure shows the expression level of CD107a protein.

[0034] Figure 7The figure below shows the fluorescence intensity (MFI) of CFSE-labeled T cells.

[0035] Figure 8 This is a diagram for detecting the differentiation ability of CAR-T cells;

[0036] Figure 9 The above figure shows the detection of CAR-T cell exhaustion level; the upper figure shows the Tim-3 expression level; the lower figure shows the PD-1 expression level;

[0037] Figure 10 This is the fluorescence intensity detection diagram of mouse tumor;

[0038] Figure 11 This is a graph showing the changes in mouse tumor volume;

[0039] Figure 12 Statistical graph of mouse survival curve. DETAILED DESCRIPTION

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0042] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0043] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0044] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0045] Example 1

[0046] 1. Design of MUC1-CAR and BTLA / IL-18R-MUC1-CAR constructs

[0047] The single-chain variable fragment (scFv, SEQ ID NO.1) of the MUC1 antibody was used as the target of CAR, the signal peptide was CD8α (SEQ ID NO.2), the hinge region (SEQ ID NO.3) and the transmembrane domain (SEQ ID NO.4) were CD8α, the intracellular 4-1BB costimulatory domain (SEQ ID NO.5) was connected to the CD3ζ signal transduction domain (SEQ ID NO.6), and the Flag gene (SEQ ID NO.7) was added after the signal peptide as a detection tag to form the MUC1-CAR structure. The extracellular region of BTLA (BTLA ECD , SEQ ID NO.8) and IL-18R transmembrane region (SEQ ID NO.9) and IL-18R intracellular segment (SEQ ID NO.10) (IL-18R TM-ICD ) to form a BTLA / IL-18R chimeric receptor, which is connected to MUC1-CAR through the T2A sequence (SEQ ID NO.11) to form a BTLA / IL-18R-MUC1-CAR structure, as shown in the schematic diagram Figure 1 shown.

[0048] SEQ ID NO.1 (single-chain variable fragment of MUC1 antibody):

[0049] GAAGTGCAGCTGGTGGAGTCCGGGGGCGGCCTGGTCCAACCCGGGGGCAGCCTGAGACTGAGCTGCGCCGCCTCCGGCTTCACCTTCAGCAGCTACGCCATGGGCTGGGTGAGACAAGCCCCCGGCAAGGGCCTGGAGTGGGTGGGCATCATCGGCAGCTACGGCACCACCTACTACGCCGCCTGGGCCAAGGGCAGATTCACCATCAGCAGAGACGACAGCAAGAGCATCACCTACCTGCAGATGAACAGCCTGAGAGCCGAGGACACCGCCGTGTACTACTGCGCTAGAGGCGGCTACCCCGGCTACCTGAGCTACTTCAACATCTGGGGCCAAGGCACCCTGGTGACCGTGAGCAGCGGAGGCGGAGGATCTGGCGGCGGAGGAAGTGGCGGAGGGGGATCTGCCCAAGTGCTGACACAGAGCCCTAGCAGCCTGAGCGCTAGCGTGGGCGACAGAGTGACCATCACCTGCCAAGCTAGCCAAAGCGTGTACAACAATAATCAGCTGAGCTGGTATCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACTACGGCAGCACCCTGGCTAGCGGCGTGCCTAGCAGATTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAAGGCTACTACAGCGGCGGCATCTTCGCCTTCGGCGGGGGCACCAAGGTGGAGATCAAG;

[0050] SEQ ID NO.2 (CD8α signal peptide):

[0051] ATGGCCTTACCAGTGACCGCCTTGCTCCTGCCGCTGGCCTTGCTGCTCCACGCCGCC AGGCCG;

[0052] SEQ ID NO.3 (CD8α hinge region):

[0053] ACCACGACGCCAGCGCCGCGACCACCAACACCGGCGCCCACCATCGCGTCGCAGC CCCTGTCCCTGCGCCCAGAGGCGTGCCGGCCAGCGGCGGGGGGCGCAGTGCACACGAG GGGGCTGGACTTCGCCTGTGAT;

[0054] SEQ ID NO.4 (CD8α transmembrane region):

[0055] ATCTACATCTGGGCGCCCTTGGCCGGGACTTGTGGGGTCCTTCTCCTGTCACTGGTTATCACCCTTTACTGC;

[0056] SEQ ID NO.5 (4-1BB costimulatory domain):

[0057] AAACGGGGCAGAAAGAAACTCCTGTATATATTCAAACAACCATTTATGAGACCAGT ACAAACTACTCAAGAGGAAGATGGCTGTAGCTGCCGATTTCCAGAAGAAGAAGAAGGA GGATGTGAACTG;

[0058] SEQ ID NO.6 (CD3ζ signal transduction domain):

[0059] AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACAAGCAGGGCCAGAACCAGCTCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGC;

[0060] SEQ ID NO.7 (Flag gene):

[0061] GATTACAAGGACGACGATGACAAG;

[0062] SEQ ID NO. 8 (extracellular domain of BTLA):

[0063] ATGAAGACATTGCCTGCCATGCTTGGAACTGGGAAATTATTTTGGGTCTTCTTCTTAATCCCATATCTGGACATCTGGAACATCCATGGGAAAGAATCATGTGATGTACAGCTTTATATAAAGAGACAATCTGAACACTCCATCTTAGCAGGAGATCCCTTTGAACTAGAATGCCCTGTGAAATACTGTGCTAACAGGCCTCATGTGACTTGGTGCAAGCTCAATGGAACAACATGTGTAAAACTTGAAGATAGACAAACAAGTTGGAAGGAAGAGAAGAACATTTCATTTTTCATTCTACATTTTGAACCAATGCTTCCTAATGACAATGGGTCATACCGCTGTTCTGCAAATTTTCAGTCTAATCTCATTGAAAGCCACTCAACAACTCTTTATGTGACAGATGTAAAAGGTGCCTCAGAACGACCCTCCAAGGACGAAGTGGCAAGCAGACCCTGGCTCCTGTATAGT;

[0064] SEQ ID NO. 9 (transmembrane region of IL-18R):

[0065] GGAGTGGTGCTCCTGTACATCCTGCTTGGCACCATCGGGACCCTGGTGGCCGTGCT GGCGGCG;

[0066] SEQ ID NO. 10 (intracellular domain of IL-18R):

[0067] AGTGCCCTCCTCTACAGGCACTGGATTGAAATAGTGCTGCTGTACCGGACCTACCAGAGCAAGGATCAGACGCTTGGGGATAAAAAGGATTTTGATGCTTTCGTATCCTATGCAAAATGGAGCTCTTTTCCAAGTGAGGCCACTTCATCTCTGAGTGAAGAACACTTGGCCCTGAGCCTATTTCCTGATGTTTTAGAAAACAAATATGGATATAGCCTGTGTTTGCTTGAAAGAGATGTGGCTCCAGGAGGAGTGTATGCAGAAGACATTGTGAGCATTATTAAGAGAAGCAGAAGAGGAATATTTATCTTGAGCCCCAACTATGTCAATGGACCCAGTATCTTTGAACTACAAGCAGCAGTGAATCTTGCCTTGGATGATCAAACACTGAAACTCATTTTAATTAAGTTCTGTTACTTCCAAGAGCCAGAGTCTCTACCTCATCTCGTGAAAAAAGCTCTCAGGGTTTTGCCCACAGTTACTTGGAGAGGCTTAAAATCAGTTCCTCCCAATTCTAGGTTCTGGGCCAAAATGCGCTACCACATGCCTGTGAAAAACTCTCAGGGATTCACGTGGAACCAGCTCAGAATTACCTCTAGGATTTTTCAGTGGAAAGGACTCAGTAGAACAGAAACCACTGGGAGGAGCTCCCAGCCTAAGGAATGGTGA;

[0068] SEQ ID NO.11 (T2A sequence):

[0069] GAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT。

[0070] 2. Packaging of lentivirus

[0071] A three-plasmid packaging system (packaging helper plasmid pMD2.G, psPAX2, and target plasmid) and a PEI cationic polymer transfection reagent were used to transfect HEK-293T cells for plasmid packaging. pMD2.G and psPAX2 were added to serum-free DMED medium at a ratio of 5:3:5 with the target plasmids MUC1-CAR and BTLA / IL-18R-MUC1-CAR, respectively, to prepare system A. The transfection reagent PEI was added to serum-free DMED medium at a PEI:DNA mass ratio of 3:1 to prepare system B. System A and system B were allowed to stand separately for 5 minutes, then mixed and allowed to stand for 20 minutes. The mixture was then added dropwise to HEK-293T cells. Fresh medium was replaced after 6-8 hours, and the lentivirus was harvested and concentrated at 48 and 72 hours. 1 μL, 2 μL, and 4 μL of the concentrated lentivirus were taken to infect 293T cells for titer determination. The lentivirus titer was calculated as follows: virus titer (TU / mL) = (2×10 5 × positive ratio) / virus volume. Figure 2 As shown, the titer of MUC1-CAR lentivirus was 8.22×10 7 TU / mL, and the BTLA / IL-18R-MUC1-CAR lentivirus titer was 5.44×10 7 TU / mL.

[0072] 3. Detection of CAR-T cell positivity rate

[0073] Human blood (provided by Shanghai Blood Center) was subjected to density gradient centrifugation to obtain peripheral blood mononuclear cells (PBMCs). T cells were sorted using CD3 sorting magnetic beads, and then stimulated with CD3 / CD28 antibody magnetic beads for 48 hours to activate T cells. T cells were then infected with MUC1-CAR and BTLA / IL-18R-MUC1-CAR lentiviruses, respectively. The positive rate of T cells was detected two days later, and Mock T was used as a negative control. The results are shown in Figure 2. Figure 3 The results showed that no CAR was expressed in Mock T cells, while the CAR positive rates in MUC1-CAR-T cells and BTLA / IL-18R-MUC1-CAR-T cells were both above 90%, and the BTLA expression level in BTLA / IL-18R-MUC1-CAR-T cells was significantly increased, indicating that MUC1-CAR-T cells and BTLA / IL-18R-MUC1-CAR-T cells were successfully prepared.

[0074] 4. Detection of BTLA / IL-18R's killing ability on MUC1-CAR-T cells

[0075] (1) Ligand expression was detected in pancreatic cancer cell lines Panc-1, Panc-28, Capan-2, and HPAC (all purchased from ATCC (American Type Culture Collection), with the numbers: Panc-1: CRL-1469; Panc-28: CRL-1420; Capan-2: HTB-80; HPAC: CRL-2119). The expression levels of MUC1 and BTLA ligand HVEM on pancreatic cancer cells were detected. The results are as follows: Figure 4 The results showed that the mean fluorescence intensity (MFI) levels of MUC1 and BTLA in Capan-2 and HPAC cell lines were higher, so Capan-2 and HPAC were selected for verification of subsequent killing experiments.

[0076] (2) The firefly luciferase method was used to detect the killing ability of CAR-T cells. First, Luciferase cell lines were constructed from pancreatic cancer cells Capan-2 and HPAC and screened. Three groups of effector cells, Mock T, MUC1-CAR-T and BTLA / IL-18R-MUC1-CAR-T, were co-incubated with three target cells at effector-target ratios of 1:1, 2:1, and 4:1 for 16 hours. The control group contained only target cells without effector cells. The fluorescence intensity of the remaining target cells was detected by chemiluminescence and the killing ability of T cells was calculated. Killing efficiency (%) = (luciferase activity of control group - luciferase activity of experimental group) / luciferase activity of control group × 100. The results are as follows Figure 5 As shown in the figure, compared with Mock T, MUC1-CAR-T cells have a significant killing effect on Capan-2 and HPAC, and the killing ability of CAR-T cells is stronger with the increase of effector-target ratio. In addition, the killing ability of MUC1-CAR-T cells co-expressing BTLA / IL-18R chimeric receptors is further significantly enhanced.

[0077] 5. Detection of BTLA / IL-18R activation level of MUC1-CAR-T cells

[0078] After being stimulated by target cell antigens, T cells begin to activate, and CD69 will be rapidly transcribed and expressed on the cell surface. It is an important marker for early T cell activation. During the T cell activation process, CD107a is expressed on the cell surface as a marker of T cell degranulation. After effector cells Mock T, MUC1-CAR-T and BTLA / IL-18R-MUC1-CAR-T were co-cultured with target cells Capan-2, the expression levels of CD69 and CD107a on T cells were detected by cell surface staining and FACS analysis. The results are as follows: Figure 6Compared with Mock T cells, the expression levels of CD69 and CD107a in MUC1-CAR-T cells were significantly increased, and the BTLA / IL-18R chimeric receptor further promoted the expression of CD69 and CD107a in MUC1-CAR-T cells, significantly promoting the activation level of T cells.

[0079] 6. Detection of BTLA / IL-18R on the proliferation ability of MUC1-CAR-T cells

[0080] When cells are labeled with the fluorescent dye CFSE, as the cells divide, CFSE will be evenly distributed to the daughter cells, and the fluorescence intensity will decrease accordingly, which can characterize the proliferation level of T cells. After three groups of effector cells Mock T, MUC1-CAR-T and BTLA / IL-18R-MUC1-CAR-T were labeled with the fluorescent dye CFSE, they were co-incubated with target cells Capan-2 and the fluorescence intensity of T cell CFSE was detected. The experimental results are as follows Figure 7 As shown in the figure, on day 0 of co-incubation, the fluorescence level of CFSE was detected, and there was no difference in the mean fluorescence intensity (MFI) of CFSE in the three groups of effector cells. After 5 days, the MFI value of CFSE in MUC1-CAR-T cells was significantly lower than that in Mock T cells, indicating that MUC1-CAR-T cells had stronger proliferation ability, while the MFI value of BTLA / IL-18R-MUC1-CAR-T cells was further significantly reduced, indicating that co-expression of BTLA / IL-18R chimeric receptors significantly promoted the division of T cells and significantly improved their proliferation ability.

[0081] 7. Detection of BTLA / IL-18R differentiation ability of MUC1-CAR-T cells

[0082] Effector cells were co-incubated with tumor cells Capan-2 at a low efficiency target ratio of 10:1 for one week to detect the memory differentiation phenotype of T cells, such as Figure 8 The results showed that after long-term co-incubation with target cells, the CD45RO + CD62L + Central memory T cells (T cm ) ratio was significantly increased in the other two groups, while there was basically no difference in the other two groups, indicating that co-expression of BTLA / IL-18R chimeric receptor promoted the proliferation of MUC1-CAR-T cells into T cells. cm Differentiation contributes to the long-term survival and self-renewal of T cells, and plays an important role in enhancing and maintaining immune responses.

[0083] 8. Detection of BTLA / IL-18R on MUC1-CAR-T cell exhaustion level

[0084] After T cells are continuously stimulated by antigens, they express inhibitory receptors such as Tim-3 and PD-1 on their surface. After their expression is upregulated, they bind to the corresponding ligands to transmit inhibitory signals, causing T cells to enter a state of exhaustion and weakening the immune effector function of T cells. Effector cells were co-incubated with tumor cells Capan-2 at a low efficiency target ratio of 10:1 for one week, and the expression level of cell surface inhibitory receptors was detected by flow cytometry. The results are as follows Figure 9 As shown in the figure, because mock T cells cannot specifically recognize antigen targets on Capan-2 cells, their exhaustion level is low. However, due to long-term stimulation by Capan-2 cells, the expression levels of Tim-3 and PD-1 in MUC1-CAR-T cells are significantly increased. However, the expression levels of Tim-3 and PD-1 in MUC1-CAR-T cells co-expressing BTLA / IL-18R chimeric receptors are significantly reduced, and their MFI values ​​are also significantly reduced, indicating that BTLA / IL-18R receptors can effectively reduce the exhaustion level of MUC1-CAR-T cells, thereby promoting T cell survival and the continuation of immune responses.

[0085] 9. Detection of BTLA / IL-18R on the anti-tumor ability of MUC1-CAR-T cells in vivo

[0086] The immunodeficient mice used were 6- to 8-week-old female C-NKG immunodeficient mice purchased from Saiye Biotechnology Co., Ltd., with ethics number: m20210611.

[0087] Preparation method of tumor cell Capan-2-luciferase: It is obtained by overexpressing the Luciferase gene in a conventional manner and screening stable transfected cells.

[0088] Luciferase gene accession number: M15077.

[0089] To further explore the in vivo anti-tumor effect of MUC1-CAR-T cells co-expressing BTLA / IL-18R, immunodeficient mice were subcutaneously loaded with Capan-2-luciferase tumor cells. After 14 days of tumor bearing, the tumor-bearing mice were randomly divided into four groups: PBS, Mock T, MUC1-CAR-T, and BTLA / IL-18R-MUC1-CAR-T groups. Each group was injected with the corresponding PBS (100 μL) or cell suspension (5×10 6 The fluorescence intensity of the tumor ( Figure 10 ), tumor volume change trend ( Figure 11 ), survival curve of mice ( Figure 12) for statistical analysis. The results showed that compared with the PBS and Mock T groups, the tumor fluorescence in the MUC1-CAR-T cell-treated group showed a downward trend after two weeks, inhibiting tumor cell proliferation. Co-expression of the BTLA / IL-18R chimeric receptor further significantly inhibited tumor growth in the MUC1-CAR-T cell group and improved the survival rate of the mice.

[0090] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A MUC1-CAR-T cell co-expressing BTLA / IL-18R chimeric receptor, characterized in that: The MUC1-CAR-T cells comprise a BTLA / IL-18R chimeric receptor and a MUC1-CAR structure; The BTLA / IL-18R chimeric receptor includes the BTLA extracellular region, the IL-18R transmembrane region and the IL-18R intracellular region; The MUC1-CAR structure includes a signal peptide, a detection tag, a MUC1 antibody single-chain variable fragment, a hinge region, a transmembrane domain and a signal transduction domain.

2. The MUC1-CAR-T cell according to claim 1, wherein The BTLA / IL-18R chimeric receptor and MUC1-CAR structure are connected via the T2A sequence; The T2A sequence is shown as SEQ ID NO.

11.

3. The MUC1-CAR-T cell according to claim 1, wherein The nucleotide sequences of the BTLA extracellular region, IL-18R transmembrane region, and IL-18R intracellular region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively; The nucleotide sequences of the signal peptide, detection tag, single-chain variable fragment, hinge region and transmembrane domain of the MUC1 antibody are shown in SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.4, respectively; The signal transduction domains are 4-1BB and CD3ζ, and the nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

4. An expression vector, characterized in that The expression vector comprises a BTLA / IL-18R chimeric receptor encoding gene, a MUC1-CAR structure encoding gene, and a T2A sequence; The BTLA / IL-18R chimeric receptor includes the BTLA extracellular region, the IL-18R transmembrane region, and the IL-18R intracellular region, and the encoding genes are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively; The MUC1-CAR structure includes a signal peptide, a detection tag, a MUC1 antibody single-chain variable fragment, a hinge region, a transmembrane domain, and a signal transduction domain. The signal transduction domain is 4-1BB and CD3ζ, and the encoding genes are shown in SEQ ID NO.2, SEQ ID NO.7, SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively. The T2A sequence is shown as SEQ ID NO.

11.

5. The expression vector according to claim 4, wherein The expression vector includes a lentiviral vector.

6. A recombinant lentivirus, characterized in that The recombinant lentivirus is prepared by co-transfecting mammalian cells with the expression vector according to claim 4 or 5 and a packaging helper plasmid.

7. The method for preparing MUC1-CAR-T cells according to any one of claims 1 to 3, wherein: The method comprises the step of introducing the expression vector according to claim 4 or 5 or the recombinant lentivirus according to claim 6 into T cells.

8. Use of the MUC1-CAR-T cell according to any one of claims 1 to 3, the expression vector according to claim 4 or 5, or the recombinant lentivirus according to claim 6 in the preparation of a drug for treating tumors.

9. The use according to claim 8, characterized in that The tumor includes pancreatic cancer.

10. A drug for treating tumors, characterized in that: The drug comprises the MUC1-CAR-T cells according to any one of claims 1 to 3.

Images