Recombinant lentivirus capable of indicating bovine spermatogonial stem cell differentiation, spermatogonial stem cell line and application
By constructing a recombinant lentivirus containing the bovine PRM1 promoter and mCherry, visual detection of bovine spermatogonial stem cell differentiation was achieved, solving the problem of difficulty in monitoring the differentiation process in existing technologies and providing a new method for studying and optimizing the differentiation system.
Patent Information
- Application Number
- CN202510874945.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2025-09-12
AI Technical Summary
The existing technology lacks methods to visualize the differentiation of bovine spermatogonial stem cells, making it difficult to monitor their differentiation process in real time and accurately.
A recombinant lentivirus containing the bovine PRM1 promoter and the red fluorescent reporter gene mCherry was constructed to indicate the differentiation process of bovine spermatogonial stem cells through fluorescent protein, and a visual detection system was established.
It realizes the visualization detection of the differentiation process of bovine spermatogonial stem cells, provides tools for studying their differentiation mechanism and optimizing the differentiation system, solves the problem of difficulty in obtaining sperm from excellent breeds of bovines, and has good application prospects.
Smart Images

Figure CN120624375A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of cell biology, and in particular to a recombinant lentivirus capable of instructing the differentiation of bovine spermatogonial stem cells, a spermatogonial stem cell line and applications thereof. Background Art
[0002] Bovine spermatogonial stem cells (bSSCs) are a key cell type in the male reproductive system that maintains spermatogenesis. They reside in the seminiferous tubules of the testis. bSSCs possess the capacity for self-renewal and differentiation, providing a continuous supply of precursor cells for spermatogenesis. Under the influence of a suitable microenvironment (e.g., growth factors secreted by Sertoli cells), bSSCs can differentiate into spermatocytes, spermatids, and ultimately mature sperm. Research on bSSCs has important applications in livestock breeding, genetic improvement, and endangered species conservation. In recent years, researchers have focused on optimizing bSSC culture conditions in vitro and exploring their gene regulation mechanisms to enhance their in vitro expansion efficiency and reproductive applications. However, visualization techniques for bSSCs remain imperfect, necessitating the development of a visual detection system for bSSCs to characterize their differentiation process.
[0003] Protamine 1 (PRM1) is a sperm-specific protein encoding a gene that plays a crucial role in sperm maturation. Protamines are small, basic proteins specific to spermatocytes that replace histones and highly compact DNA during spermatogenesis, thereby protecting genetic material from damage and promoting sperm functional maturation. During bovine spermatogenesis, the promoter and regulatory elements of the PRM1 gene determine its temporal expression.
[0004] Lentiviruses are important members of the retroviridae family. Their key distinguishing characteristic from traditional gamma-retroviruses is their ability to bypass host cell cycle constraints. Lentiviruses can not only infect dividing cells but also efficiently transduce quiescent or terminally differentiated non-dividing cells (such as neurons, hematopoietic stem cells, and spermatogonial stem cells), integrating foreign genes into the host genome for stable expression. This groundbreaking property stems from the active transport of the pre-integration complex (PIC) within the viral particle into the nucleus of quiescent cells through nuclear pores, whereas the PIC of traditional retroviruses passively enters through nuclear membrane rupture during cell division. The lentivirus core genome structure consists of 5' and 3' long terminal repeats (LTRs), a packaging signal region (Ψ), and a pathogenic gene backbone (e.g., gag-pol-rev). Through genetic engineering, pathogenic genes (e.g., env, vif, and nef) are completely eliminated, making them safe gene delivery vehicles. To expand application scenarios, researchers often use VSV-G envelope protein to replace natural Env protein (pseudo-packaging). This type of virus particles can not only infect a wide range of mammalian cells, but can also withstand ultracentrifugation concentration to increase virus titer.
[0005] Currently, there is no mature technology for visualizing the differentiation process of spermatogonial stem cells. Therefore, how to visualize the differentiation process of bovine spermatogonial stem cells in real time and accurately is crucial for the research on bovine spermatogonial stem cell differentiation. Summary of the Invention
[0006] The purpose of the present invention is to provide a recombinant lentivirus, spermatogonial stem cell line and application that can indicate the differentiation of bovine spermatogonial stem cells. The fluorescent protein mCherry is used to indicate the expression of PRM1, and then to indicate the differentiation process of bovine spermatogonial stem cells. This provides a good tool for inducing the differentiation of bovine spermatogonial stem cells into sperm, studying the developmental mechanism and optimizing the differentiation system of bovine spermatogonial stem cells. It is a new way to solve the problem of difficulty in obtaining high-quality bovine sperm in scientific research and production. It can also be used for downstream research such as optimization of spermatogonial stem cell differentiation system, sperm sorting and purification, and even drug screening, and has good application prospects.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions: The present invention provides a recombinant lentivirus capable of indicating the differentiation of bovine spermatogonial stem cells. The recombinant lentivirus comprises a bovine PRM1 promoter and a red fluorescent reporter gene mCherry.
[0008] Preferably, the sequence of the bovine PRM1 promoter is shown as SEQ ID NO.3; the sequence of the red fluorescent reporter gene mCherry is shown as SEQ ID NO.6.
[0009] Preferably, the recombinant lentivirus further comprises an EF-1α promoter, a green fluorescent reporter gene copGFP, a self-cleaving polypeptide 2A, Puro, and a transcription termination signal bGHpA.
[0010] The present invention also provides a use of the above-mentioned recombinant lentivirus capable of instructing the differentiation of bovine spermatogonial stem cells in research on the differentiation of bovine spermatogonial stem cells.
[0011] The present invention also provides a method for preparing the above-mentioned recombinant lentivirus capable of instructing bovine spermatogonial stem cell differentiation, comprising the following steps: The bovine PRM1 promoter and mCherry sequences were amplified and inserted between the SpeI and NotI restriction sites of the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector using enzyme ligation to obtain a recombinant lentivirus that can instruct the differentiation of bovine spermatogonial stem cells.
[0012] The present invention also provides a method for preparing a spermatogonial stem cell line that indicates bovine sperm differentiation, comprising the following steps: (1) Taking the above-mentioned recombinant lentivirus that indicates the differentiation of bovine spermatogonial stem cells, transfecting it into cells, culturing and isolating them to obtain recombinant lentiviral particles; (2) Infecting bovine spermatogonial stem cells with the recombinant lentiviral particles of step (1), and screening to obtain a spermatogonial stem cell line that indicates bovine sperm differentiation.
[0013] The present invention also provides a spermatogonial stem cell line indicating bovine sperm differentiation prepared by the above-mentioned method for preparing a spermatogonial stem cell line indicating bovine sperm differentiation.
[0014] The present invention also provides a use of the spermatogonial stem cell line indicating bovine sperm differentiation in bovine spermatogonial stem cell related research.
[0015] The beneficial effects of the present invention compared with the prior art are: (1) The present invention provides a method for constructing a spermatogonial stem cell line that indicates bovine sperm differentiation based on lentiviral transduction technology. The PRM1 promoter is used to regulate the expression of mCherry protein to construct a visual detection system for the differentiation of spermatogonial stem cells into spermatocytes, thereby indicating the developmental stage of bovine spermatogonial stem cells.
[0016] (2) In the present invention, the mCherry protein is linked to the PRM1 promoter, which can promote the expression of the mCherry protein in the spermatogonial cell line. The fluorescent protein mCherry is detected by the flow cytometry fluorescence analysis system and microscopic imaging technology. The fluorescent protein mCherry is used to indicate the expression of PRM1, and then to indicate the differentiation process of bovine spermatogonial stem cells. It provides a good tool for the induction of bovine spermatogonial stem cells to differentiate into sperm, the study of developmental mechanisms and the optimization of the differentiation system of bovine spermatogonial stem cells. It is a new way to solve the bottleneck problem of the difficulty in obtaining high-quality bovine sperm in scientific research and production. It can also be used for downstream research such as the optimization of spermatogonial stem cell differentiation system, sperm sorting and purification, and even drug screening, and has good application prospects.
[0017] (3) The reporter fluorescence expression of the spermatogonial stem cell line indicating the differentiation of bovine sperm constructed by the present invention is bright and specific, and can be stably expressed for a long time. In addition, a strong fluorescence signal can still be detected when the tissue is fixed for terminal detection. It can effectively detect the process of bovine spermatogonial stem cells differentiating into sperm, providing a new option for studying the differentiation of bovine spermatogonial stem cells. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0019] Figure 1 Schematic diagram of the location of the bovine PRM1 promoter in the genome in Example 1 of the present invention; Figure 2 The lentiviral vector PRM1 Promoter-mCherry-pCDH in Example 1 of the present invention -Schematic diagram of the structure of Nramp1-copGFP-T2A-Puro; Figure 3 This is a diagram of the spermatogonial stem cell line that indicates bovine sperm differentiation in Example 1 of the present invention; Figure 4 In Experimental Example 1 of the present invention, photos of bSSCs were taken using a fluorescence microscope after differentiation was induced; Figure 5 These are the results of fluorescence quantitative PCR detection of Stra8, c-Kit and PRM1 in bSSCs after induced differentiation in Experimental Example 1 of the present invention. DETAILED DESCRIPTION
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.
[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.
[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0025] The present invention provides a method for constructing a spermatogonial stem cell line that indicates bovine sperm differentiation, comprising the following steps: (1) Preparation of lentiviral vector The PRM1 promoter sequences of mCherry and bSSC were amplified by PCR, and then inserted between the XbaI and NotI restriction sites and the SpeI and XbaI restriction sites of the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector using enzyme ligation, and named PRM1 Promoter-mCherry-pCDH-Nramp1-copGFP-T2A-Puro.
[0026] (2) Preparation of recombinant lentiviral particles HEK293T cells were transfected with the PRM1 Promoter-mCherry-pCDH-Nramp1-copGFP-T2A-Puro construct using PEI. Cell growth should be monitored during culture; green fluorescence should be observed approximately 24 hours after transfection. Virus-containing supernatant was collected 36-48 hours after transfection and centrifuged at 12,000 × g for 10 minutes at 4°C to pellet cell debris.
[0027] (3) Purification and enrichment of lentiviral particles Purify and enrich the lentiviral particles in step (2) using a lentiviral concentration kit; (4) Obtaining bovine PRM1 promoter fluorescent reporter cell line Culture bSSCs in 60 mm culture dishes. When the cells reach 60-80% confluency, mix DMEM / F-12 medium with the lentiviral venom at a volume ratio of 1-2:1-2. Add polybrene (1 μL / mL) and mix thoroughly. Incubate in a 37°C, 5% CO2 incubator for 12 hours, then replace the medium with DMEM / F-12. Change the medium every 24 hours. Screening can be performed if cell fluorescence reaches 50% or higher within 24-48 hours after challenge.
[0028] Wash the cells three times with PBS between each medium change to remove negative cells killed by puromycin. Then, add DMEM / F-12 supplemented with 1-2 μg / mL puromycin. Continue screening for 2-4 times, with 24-hour intervals between each. After screening, resume normal culture when the positive cell rate reaches over 90%. Once the cells reach the appropriate density, proceed with normal subculture and cryopreservation.
[0029] The preferred embodiments of the present invention are described in detail below in conjunction with the accompanying drawings so that the advantages and features of the invention can be more easily understood by those skilled in the art, thereby making a clearer and more precise definition of the scope of protection of the present invention, but the present invention is not limited to the scope of the embodiments. The reagents and raw materials used in the following examples are all commercially available, and the test methods for which specific conditions are not specified are generally carried out under conventional conditions or under the conditions recommended by the manufacturers. Furthermore, unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields conventional in the art.
[0030] The sequences used in the present invention are as follows: SEQ ID NO.1: CAGAACCTGGCATACACTGT; SEQ ID NO.2:GAGCAGGTGGAATTTGTGGG; SEQ ID NO.3: CAGAACCTGGCATACACTGTAAACTGACTGAGTGGATGAGCTAGTGAGTGTCCTTACAAAGAAAAAGTCACCTCATTCCCCTTTACAGAATTCCTCCTTTACAGAGGAGGCGGCATGGAGACCTGGACGTCATAGCTGGGTTCGGGCTGCTCATGGGGTCTTGGACCAGCTTGGCAGGAACTGTCATGACTCCTCTACCTCCCCCCCCTCCCCACTGCATGATGTGATGTGGTCAAATTTATATGCATTAATGACCTGGGGGGTCATTAATTAATGTGGAGGGGCCCCACCCCCACACACATCACAGCCCCACCCCTGCACATCACAGCCCCGCCCTCCCTCACCAAGCACCTCCCACATGCCCATATATGGGCATGATTTGGGCAGCTCTGACCCTGGTCTGTGAGGTCTGGGTCTCTGTGACCTCACAATGACCAGGACCCTGCCCGGGTCTATATAAGAGGCCGGGAAGTCGGCCCCTGTCACAGCCCACAAATTCCACCTGCTC; SEQ ID NO.4:ATGGTGAGCAAGGGCGAG; SEQ ID NO.5:TTACTTGTACAGCTCGTCC; SEQ ID NO.6: ATGGTGAGCAAGGGCGAGGAGGATAACATGGCGATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAA; SEQ ID NO.7:GCTGGCATCAGGGTGACTT; SEQ ID NO.8:ACACATGAACACACCGGAA; SEQ ID NO.9:TGTGCCCAGGTGTTCATCTC; SEQ ID NO.10:GGGGAGCAGCAGGATTTCAC; SEQ ID NO.11:TTACTTGTACAGCTCGTCC。
[0031] Example 1 Example 1 of the present invention provides a method for constructing a spermatogonial stem cell line that indicates bovine sperm differentiation, comprising the following steps: (1) Sequence acquisition The bovine PRM1 promoter (located as shown in Figure 2) was amplified using primers SEQ ID NO.1 and SEQ ID NO.2. Figure 1 ), its sequence is shown in SEQ ID NO.3.
[0032] The mCherry gene was amplified using primer sequences of SEQ ID NO.4 and SEQ ID NO.5, and its sequence is shown in SEQ ID NO.6.
[0033] (2) Plasmid construction Take the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector plasmid and use the enzyme ligation method to insert the PRM1 promoter sequence of mCherry and bSSC between the XbaI and NotI restriction sites and the SpeI and XbaI restriction sites to obtain PRM1 Promoter-mCherry-pCDH- Nramp1-copGFP-T2A-Puro (as Figure 2 shown).
[0034] (3) Preparation of recombinant lentiviral particles Add 500 μL Opti-MEM and 12 μg PEI to a 1.5 mL EP tube, vortex to mix, and then add the PRM1 Promoter-mCherry-pCDH-Nramp1-copGFP-T2A constructed in step (2) 4 μg of -Puro plasmid was pipetted and mixed thoroughly, then allowed to stand at room temperature for 20 minutes. The mixture was added to HEK293T cells and transfected at 37°C, 5% CO2 for 12 hours. The culture medium was then replaced with DMEM containing 10% FBS. The growth of the transfected HEK293T cells was observed, and green fluorescence was observed approximately 24 hours after transfection. The supernatant containing the virus was collected 48 hours after transfection. 4°C, 12000× g Centrifuge for 10 min to fully pellet cell debris.
[0035] (4) Purification of lentiviral particles The lentiviral particles in step (3) were purified and enriched using a lentiviral concentration kit (Shanghai Yazyme Biopharmaceutical Technology Co., Ltd.); (5) Construction of bovine PRM1 promoter mCherry fluorescent reporter cell line: Mix the DMEM / F-12 culture medium and the lentiviral venom prepared in step (5) at a volume ratio of 1:1, and continue to add polybrene (final concentration of 1 μL / mL) to obtain a mixed solution; Use 60 mm culture dishes to culture bSSC cells. When the cell confluence reaches 70%, add the mixed solution into the culture dish and mix well. After culturing in a constant temperature incubator at 37°C and 5% CO2 for 12 hours, replace the culture medium with DMEM / F-12 medium, and then change the medium every 24 hours.
[0036] Screening can be performed within 24-48 hours after challenge when cell fluorescence reaches 50% or higher. During screening, wash the cells three times with PBS, changing the medium each time, to remove negative cells killed by puromycin. Then, add DMEM / F-12 containing 1 μg / mL puromycin and perform screening three times, with 24-hour intervals between each wash.
[0037] After the screening, if the positive cell rate reaches more than 90%, normal culture can be resumed to obtain the bovine PRM1 promoter mCherry fluorescent reporter cell line (such as Figure 3 As shown in the figure), when the density is appropriate, normal subculture and cryopreservation can be carried out to obtain the spermatogonial stem cell line PRM1 Promoter-mCherry cell line (abbreviated as PRM1mCherry) that indicates bovine sperm differentiation.
[0038] Test Example 1 Experimental Example 1 of the present invention verifies whether the bovine spermatogonial stem cell line prepared in Example 1, which indicates the differentiation of bovine sperm, can be used to detect the differentiation of bSSC into sperm. The specific steps are as follows: (1) Preparation of embryoid bodies The bovine spermatogonial stem cell line prepared in Example 1 was digested and its density was adjusted to 2×10 6 / mL, and then dripped it on the cover of the culture dish that had not been treated with TC in a volume of 40 μL. The culture dish cover was buckled on the culture dish with PBS, and cultured in a constant temperature incubator at 37°C and 5% CO2 for 3 days to obtain embryoid bodies.
[0039] (2) Induced differentiation The embryoid bodies prepared in step (1) were taken and placed in a 48-well plate treated with gelatin, and a concentration of 5×10 -5 , 5×10 -6 , 5×10 -7 The cells were cultured in a 37°C, 5% CO2 constant temperature incubator for 7 days and the cells were observed under a fluorescence microscope every day to see if they emitted red fluorescence. Figure 4 shown.
[0040] (3) RCR detection After the cells emitted red fluorescence, the cells were harvested and total RNA was extracted using the Takara RNAiso Plus extraction kit. After reverse transcription using the HiScript III RT SuperMix for qPCR (+gDNA wiper) kit from Nanjing Novozymes Biotech Co., Ltd., fluorescent quantitative PCR was used to detect the mRNA levels of Stra8, c-Kit (primer sequences for Stra8 and c-Kit are shown in SEQ ID NOs. 7-10), and PRM1 (sequences shown in SEQ ID NOs. 1 and 11). The results are shown in Figure 2. Figure 5 shown.
[0041] Figure 4 、 5 The results show that the bovine PRM1 promoter fluorescent reporter cell line prepared by the present invention can effectively detect the differentiation process of bovine spermatogonial stem cells into sperm. It is reliable, effective, and has good application prospects, providing a new option for studying the differentiation of bovine spermatogonial stem cells.
[0042] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A recombinant lentivirus capable of directing the differentiation of bovine spermatogonial stem cells, characterized in that: The recombinant lentivirus includes a bovine PRM1 promoter and a red fluorescent reporter gene mCherry.
2. The recombinant lentivirus capable of directing the differentiation of bovine spermatogonial stem cells according to claim 1, characterized in that: The sequence of the bovine PRM1 promoter is shown in SEQ ID NO.3; the sequence of the red fluorescent reporter gene mCherry is shown in SEQ ID NO.
6.
3. The recombinant lentivirus capable of directing the differentiation of bovine spermatogonial stem cells according to claim 1, characterized in that: The recombinant lentivirus further comprises an EF-1α promoter, a green fluorescent reporter gene copGFP, a self-cleaving polypeptide 2A, Puro and a transcription termination signal bGHpA.
4. Use of the recombinant lentivirus capable of instructing the differentiation of bovine spermatogonial stem cells according to any one of claims 1 to 3 in research on the differentiation of bovine spermatogonial stem cells.
5. A method for preparing a recombinant lentivirus capable of directing the differentiation of bovine spermatogonial stem cells according to any one of claims 1 to 3, characterized in that: The steps include: The bovine PRM1 promoter and mCherry sequences were amplified and inserted between the SpeI and NotI restriction sites of the pCDH-CMV-MCS-EF1-copGFP-T2A-Puro vector using enzyme ligation to obtain a recombinant lentivirus that can instruct the differentiation of bovine spermatogonial stem cells.
6. A method for preparing a spermatogonial stem cell line that indicates bovine sperm differentiation, characterized in that: The steps include: (1) Taking the recombinant lentivirus that indicates the differentiation of bovine spermatogonial stem cells according to any one of claims 1 to 3, transfecting it into cells, culturing, and isolating to obtain recombinant lentiviral particles; (2) Infecting bovine spermatogonial stem cells with the recombinant lentiviral particles of step (1), and screening to obtain a spermatogonial stem cell line that indicates bovine sperm differentiation.
7. A spermatogonial stem cell line indicating bovine sperm differentiation prepared according to the method for preparing a spermatogonial stem cell line indicating bovine sperm differentiation according to claim 6.
8. Use of the spermatogonial stem cell line indicating bovine sperm differentiation as claimed in claim 7 in a study on the differentiation of bovine spermatogonial stem cells.