Alkaline xylanase mutant and application thereof

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to an alkaline xylanase mutant and application thereof. The invention provides a mutant containing an N165H mutation site on the basis of wild type xylanase H1. Compared with a wild type, the heat resistance of the xylanase mutant is remarkably improved, and wide popularization and application of the xylanase mutant in the industrial field are facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and protein engineering, and in particular to an alkaline xylanase mutant and application thereof. Background Art

[0002] Xylan is a polysaccharide with D-xylose as its primary component. Its backbone is composed of β-(1-4)-pyranose D-xylose units linked by β-1,4-glycosidic bonds. Most xylans are heteropolysaccharides, with the backbone often containing arabinose and coumaric acid, and side chains containing a variety of substituted glycosyl groups, most commonly ferulic acid and uronic acid. Because the residues of xylan's side chains are linked to lignin, pectin, glucan, and other substances, xylan is difficult to degrade. Xylanases play a crucial role in xylan degradation, opening the backbone and side chains and breaking down xylan into fermentable oligosaccharides or monosaccharides for bioavailability.

[0003] Xylanase (endo-1,4-β-D-xylanxylanohydrolase EC3.2.1.8) is a hydrolase, a complex enzyme system that degrades xylan into oligosaccharides or xylose, typically consisting of both endo- and exo-enzymes. The commonly referred to xylanase is endo-β-1,4-D-xylanase (EC3.2.1.8), which primarily degrades the backbone of xylan. The hydrolysis products are primarily xylobiose and oligosaccharides above xylobiose, along with smaller amounts of xylose, arabinose, and mannose. Xylanases are considered one of the most critical enzymes in the xylan degradation process. Xylanases can be categorized as acidophilic, alkaline, and neutral based on the pH at which they act. They can also be divided into thermophilic, mesophilic, and cryophilic enzymes based on their temperature sensitivity.

[0004] Xylanases come from a wide range of sources. Currently, nearly dozens of genera and over a hundred species of xylanase-producing microorganisms have been discovered, including bacteria, fungi, actinomycetes, and certain yeasts. Reported bacteria include Butyrivibro and Clostridium; fungi include Penicillium, Trichoderma, and Aspergillus; actinomycetes include Streptomyces sp., Streptomyces flavogriseus, and Pseudomonos; and yeasts include Cryptococcus albidus. Different microbial species produce different types of xylanases, and even the same microorganism can produce different xylanases.

[0005] Due to its crucial role in xylan degradation, xylanases are widely used in various industries, including the pulp and paper industry, animal feed, food, energy, pharmaceuticals, and textiles. While xylanases can be obtained from animals, plants, and microorganisms, they are currently primarily obtained through fermentation of fungi and bacteria. Acidic xylanases maintain high activity at pH values ​​below 4.0 and are therefore widely used in a wide range of applications, including the feed, brewing, and food industries, demonstrating their enormous potential in production.

[0006] However, xylanases currently face limitations such as low yield, high cost, and difficulty obtaining thermostable enzymes. Therefore, using genetic and protein engineering methods to produce high-yield, low-cost, commercially viable new xylanases has become an urgent issue to be addressed. Summary of the Invention

[0007] The present invention aims to provide an alkaline xylanase mutant. The present invention obtains a mutant protein by protein engineering xylanase derived from Paecilomyces sp., which significantly improves its tolerance to high temperatures and is conducive to its wide application in industrial fields.

[0008] One aspect of the present invention relates to a xylanase mutant, which is obtained by mutating the 165th amino acid of the xylanase with the amino acid sequence of SEQ ID NO: 1 from Asn to His.

[0009] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0010] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.

[0011] The present invention also relates to a host cell comprising the above-mentioned recombinant expression plasmid.

[0012] When the plasmid is transferred into a host cell, the high temperature tolerance of the recombinantly expressed xylanase mutant is significantly improved.

[0013] In some embodiments of the present invention, the host cell is Pichia pastoris.

[0014] Compared with the wild-type xylanase H1, the mutant containing the N165H mutation site provided by the present invention has significantly improved heat resistance. After being treated at 80°C for 30 minutes, the residual enzyme activity rate increased by 47.24%, and after being treated at 85°C for 30 minutes, the residual enzyme activity rate increased by 73.4%, achieving unexpected technical effects and being more conducive to its wide application in the industrial field. DETAILED DESCRIPTION

[0015] The present invention discloses an alkaline xylanase mutant and its application, as well as a DNA molecule, vector, and host cell encoding the xylanase mutant. Those skilled in the art can refer to the present disclosure and appropriately modify the process parameters to implement the present invention. The methods and applications of the present invention have been described through preferred embodiments. It is apparent that those skilled in the art can modify, alter, and combine the methods and applications described herein without departing from the present disclosure, spirit, and scope to implement and apply the present invention.

[0016] The present invention uses the conventional techniques and methods used in the field of genetic engineering and molecular biology, such as the methods described in MOLECMLACONE:ALBORATORMANE,3rd Ed.(Sambrook,2001) and CURRENT PROTOCOLS INMOLECMLACONE(Ausubel,2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols and reagents in this area, without being limited to the specific embodiments of the present invention. For example, the present invention can use the following experimental materials and reagents:

[0017] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0018] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0019] Culture medium formula:

[0020] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0021] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0022] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0023] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0024] The present invention will be further described below in conjunction with the embodiments:

[0025] Example 1 Construction of recombinant plasmid

[0026] The xylanase gene from Paecilomyces sp was optimized based on the codon preference of Pichia pastoris. Six bases, GAATTC (an EcoR I restriction site), were added before the ATG start codon, and GCGGCCGC (a Not I restriction site) was added after the TAA stop codon. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. This xylanase was named H1, with its amino acid sequence as SEQ ID NO: 1 and its encoding nucleotide sequence as SEQ ID NO: 2.

[0027] The xylanase gene was digested with restriction enzymes EcoR I and Not I (Fermentas). Simultaneously, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase (Fermentas). The ligated products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced (Invitrogen) to ensure accuracy.

[0028] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-H1.

[0029] Example 2 Screening of thermostable xylanase mutants

[0030] To further improve the temperature tolerance of xylanase H1, the protein structure was analyzed. This protein, a GH11 family xylanase, has a β-jellyroll structure, with both the protein surface and the active center exposed to the external environment. Therefore, changes in the external environment, particularly high temperatures, can directly affect the stability of both the enzyme's surface structure and its active center. To improve the enzyme's tolerance to high temperatures, it was necessary to increase the overall rigidity of the protein and stabilize its overall structure. Further mutations were then performed on the gene without disrupting the enzyme's secondary structure or active center.

[0031] 1.1 Design PCR primers H1-F1 and H1-R1:

[0032] H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (underlined is the restriction endonuclease EcoRI recognition site);

[0033] H1-R1:ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (the underline indicates the restriction endonuclease NotI recognition site).

[0034] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above-mentioned primers using the GeneMorph II Random Mutation PCR Kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes. The product was transformed into Escherichia coli BL21 (DE3), spread on LB-Amp plates, and cultured inverted at 37°C. After transformants appeared, they were picked one by one with a toothpick into a 96-well plate, and 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain E. coli cell lysate containing xylanase.

[0035] Two aliquots of lysate were taken out and treated as follows: the first aliquot was diluted with pH 8.0 buffer, and the second aliquot was diluted with pH 8.0 buffer and treated at 75°C for 5 min. Then, 30 μL of the above-treated lysate was taken to two new 96-well plates, and 30 μL of substrate prepared with the corresponding buffer was added to each 96-well plate. After reacting at 50°C for 30 min, the reducing sugar generated was determined by DNS method, and the residual enzyme activity of the mutant was calculated.

[0036] Experimental results showed that different mutants retained varying levels of activity after high-temperature treatment. Some mutations had no effect on the temperature tolerance of xylanase, while others even worsened its temperature tolerance or enzymatic activity. Still other mutations, while improving the temperature tolerance of xylanase, led to significant changes in its enzymatic properties, failing to meet the requirements. Ultimately, the applicant identified a mutation site, N165H, that significantly improved the temperature tolerance of xylanase H1 without affecting its activity or original enzymatic properties.

[0037] Based on the wild-type xylanase H1, the present invention provides a mutant comprising a single point mutation N165H.

[0038] Example 3 Expression of xylanase in Pichia pastoris

[0039] 3.1 Construction of expression plasmid

[0040] The gene sequences of alkaline xylanase H1 and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0041] According to the method described in Example 1, the gene sequences of the synthesized xylanase H1 and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The cells were then transformed into Escherichia coli DH5a, plated on LB-Amp plates, and inverted cultured at 37°C. After transformants appeared, colony PCR was performed (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM) 0.5 μL, 3'AOX primer 0.5 μL, ddH2O 14.5 μL, reaction procedure: 95°C pre-denaturation for 5 min, 30 cycles of: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). Positive clones were verified by sequencing, and the correct recombinant expression plasmid was obtained.

[0042] 3.2 Construction of Pichia pastoris engineered strains

[0043] 3.2.1 Preparation of competent yeast

[0044] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 single clone was inoculated into 6 mL YPD liquid medium and cultured at 30°C and 220 rpm for about 12 h. The bacterial solution was then transferred to a 30 mL The cells were cultured in a triangular flask of YPD liquid medium at 30°C and 220 rpm for about 5 h. The cell density was detected by UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of cells were collected into sterile EP tubes by centrifugation at 9000 rpm at 4°C for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterilized filter paper and the cells were resuspended in 1 mL of pre-cooled sterile water. The cells were centrifuged at 9000 rpm at 4°C for 2 min, and the supernatant was gently discarded. The cells were washed again with 1 mL of sterile water, and then centrifuged at 9000 rpm at 4°C for 2 min. The supernatant was gently discarded and the cells were resuspended in 1 mL of pre-cooled sorbitol (1 mol / L). The cells were centrifuged at 9000 rpm at 4°C for 2 min, and the supernatant was gently discarded. The cells were gently resuspended in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0045] 3.2.2 Transformation and screening

[0046] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0047] The obtained transformants were transferred to BMGY medium and cultured with shaking at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured with shaking at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; and the bacteria were removed by centrifugation at 9000 rpm for 10 minutes to obtain fermentation supernatants containing xylanase H1 and xylanase mutants, respectively.

[0048] 1. Xylanase activity assay

[0049] (1) Definition of xylanase activity unit

[0050] Under the conditions of temperature of 50℃ and pH of 8.0, the amount of enzyme required to degrade and release 1 μmol of reducing sugar from a 5 mg / mL xylan solution per minute is one enzyme activity unit, expressed in U.

[0051] (2) Xylanase activity determination method

[0052] 10.0 mL of xylan solution was drawn in and equilibrated at 50°C for 20 min.

[0053] Pipette 10.0 mL of appropriately diluted enzyme solution and equilibrate at 50°C for 5 min.

[0054] Blank sample determination: Pipette 2.00mL of appropriately diluted enzyme solution (already equilibrated at 50℃) and add it to a graduated test tube. Then add 5mL of DNS reagent and oscillate electromagnetically for 3s. Then add 2.0mL of xylan solution, equilibrate at 50℃ for 30min, and heat in a boiling water bath for 5min. Cool to room temperature with tap water, add water to make up to 25mL, and oscillate electromagnetically for 3s to 5s. Use the standard blank sample as a blank control and measure the absorbance A at 540nm. B .

[0055] Sample determination: Pipette 2.00mL of appropriately diluted enzyme solution (equilibrated at 50℃) and add it to a graduated test tube. Then add 2.0mL of xylan solution (equilibrated at 50℃), electromagnetically oscillate for 3s, and maintain temperature at 50℃ for 30min. Add 5.0mL of DNS reagent and electromagnetically oscillate for 3s to terminate the enzymatic reaction. Heat in a boiling water bath for 5min, cool to room temperature with tap water, add water to make up to 25mL, and electromagnetically oscillate for 3s. Use the standard blank sample as a blank control and measure the absorbance A at 540nm. E .

[0056] Formula (1): X D =[(A E -A B )×K+C0]×1000 / (M×t).

[0057] Where:

[0058] X D —Xylanase activity in the sample dilution, U / mL;

[0059] A E —Absorbance of enzyme reaction solution;

[0060] A B —Absorbance of enzyme blank;

[0061] K—slope of the standard curve;

[0062] C0—intercept of the standard curve;

[0063] M—molar mass of xylose M(C5XYN 110 O5)=150.2g / mol;

[0064] t—enzyme hydrolysis reaction time, min;

[0065] 1000—conversion factor, 1mmol=1000μmol;

[0066] X DThe value should be between 0.04 and 0.10 U / mL. If it is not within this range, the enzyme solution dilution should be reselected and the analysis should be repeated.

[0067] Formula (2): X = X D ·D f .

[0068] Where:

[0069] X—xylanase activity in the sample, U / mL;

[0070] D f —Dilution factor of the sample.

[0071] The calculated value of enzyme activity was rounded to three significant figures.

[0072] 2. Heat resistance analysis

[0073] The fermentation supernatant of the recombinant Pichia pastoris strain was diluted to 200 U / mL with 0.1 M sodium hydrogen phosphate disodium and 0.05 M citric acid, then diluted 10-fold with preheated buffer for 10 minutes. The mixture was mixed thoroughly and treated at 80°C and 85°C for 30 minutes, respectively. Samples were collected at the end of the treatment and cooled to room temperature. The xylanase activity was then measured, and the residual enzyme activity was calculated based on the activity of the untreated sample as 100%. The results are shown in Table 1.

[0074] Residual enzyme activity (%) = enzyme activity of treated sample / enzyme activity of untreated sample × 100%.

[0075] Table 1 Analysis of the heat resistance of xylanase H1 and its mutants

[0076]

[0077] As can be seen from the results in Table 1, compared with the wild-type xylanase H1, the mutant containing the N165H mutation site provided by the present invention has significantly improved heat resistance. After treatment at 80°C for 30 minutes, the residual enzyme activity rate increased by 47.24%, and after treatment at 85°C for 30 minutes, the residual enzyme activity rate increased by 73.4%, achieving unexpected technical effects.

[0078] In summary, the heat resistance of the alkaline xylanase mutant provided by the present invention is significantly improved, which is conducive to its wide promotion and application in the industrial field.

Claims

1. A xylanase mutant, characterized in that The mutant is obtained by mutating the 165th amino acid of the xylanase with the amino acid sequence of SEQ ID NO: 1 from Asn to His.

2. A DNA molecule encoding the xylanase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, wherein The host cell is Pichia pastoris ( Pichia pastoris ).

Images