Gene regulation and control method for improving gibberellic disease resistance of wheat based on STTM-mediated tRF-Lys silencing technology

Abstract

The invention relates to a gene regulation and control method for improving wheat scab resistance based on an STTM mediated tRF-Lys silencing technology, belongs to the technical field of gene engineering, and aims to inhibit tRF-Lys through the STTM technology, realize obvious improvement of wheat scab resistance and have multiple innovation values. Firstly, the strategy directly aims at pathogen infection key targets, the disease resistance of wheat ears is remarkably improved, toxin accumulation is effectively reduced, and a new way is provided for guaranteeing the grain yield and quality. And secondly, endogenous non-coding RNA is regulated and controlled by a gene editing means, so that the use of chemical agents is avoided, the environmental burden is reduced, the ethical dispute of the traditional transgenic technology is avoided, and the development trend of green agriculture is met. Besides, the research discloses a new function of tRF-Lys in wheat-gibberellic disease interaction, enriches a disease-resistant gene resource library, and provides a theoretical basis and technical support for crop disease-resistant breeding.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to a gene regulation method for improving wheat resistance to scab based on STTM-mediated tRF-Lys silencing technology. Background Art

[0002] Fusarium head blight (FHB) is a global fungal disease of wheat caused by Fusarium graminearum. It not only causes wheat head wilt, shrunken kernels, and severe yield reductions, but also leads to the accumulation of mycotoxins such as deoxynivalenol (DON) in the kernels, threatening food security and human health. The occurrence of fusarium head blight is significantly influenced by climatic conditions and is particularly prevalent in warm and humid regions. It has become a major disease in wheat production. Traditional control measures rely primarily on chemical fungicides and agricultural management practices. However, long-term use of chemical agents can easily lead to pathogen resistance and may have negative impacts on the environment and food safety. Breeding resistant varieties through breeding is a more sustainable solution, but the genetic mechanisms of wheat fusarium head blight resistance are complex, the resistance levels of existing resistant varieties are limited, and resistance gene resources are scarce, resulting in slow progress in disease-resistant breeding.

[0003] In recent years, genetic engineering technology has provided new ideas for improving crop disease resistance. RNA interference (RNAi) and gene editing technologies have been widely used in plant disease resistance research, enhancing resistance by regulating host gene expression or targeting key genes of pathogens. However, genetic engineering research on wheat fusarium scabra still faces challenges, such as insufficient functional analysis of resistance-related genes, low transgenic efficiency, and the complexity of resistance mechanisms. At the same time, the role of non-coding RNA (such as microRNA and small interfering RNA) in plant immune response has gradually attracted attention, but its specific function in the interaction between wheat and fusarium scabra is still unclear.

[0004] tRNA-derived fragments (tRFs) are a class of non-coding RNA molecules formed by tRNA endonuclease cleavage. They can regulate the expression of target genes or directly participate in disease resistance by binding to AGO proteins to form complexes. Studies have shown that tRFs respond to pathogen infection in plants such as Arabidopsis and rice, and affect disease resistance by regulating the expression of immune-related genes. For example, some tRFs can enhance resistance by inhibiting pathogen effector proteins or activating host defense signaling pathways. However, there is currently almost no research on the function of tRFs in wheat resistance to Fusarium graminearum, and its specific mechanism of action in the interaction between Fusarium graminearum and wheat has not yet been elucidated, which limits the development of disease resistance strategies based on tRFs.

[0005] Further research revealed significant differences in tRF expression profiles between fusarium graminearum-susceptible and resistant varieties after inoculation with Fusarium graminearum, suggesting that specific tRFs may be involved in regulating wheat resistance to fusarium graminearum. For example, previous work in this field identified a tRF (named tRF-Lys) derived from the 5' end of lysine tRNA (Lys-tRNA) through small RNA sequencing. This tRF accumulated significantly after inoculation in susceptible varieties, while its expression level was lower in resistant varieties. This phenomenon suggests that tRF-Lys may negatively regulate wheat disease resistance, but its specific function and mechanism of action still require further verification. If the expression of tRF-Lys can be inhibited through molecular means, it may provide a new approach to enhancing wheat resistance to fusarium graminearum.

[0006] Short Tandem Target Mimic (STTM) technology is a strategy that involves designing artificial RNA molecules to competitively bind to target microRNAs or tRFs, thereby blocking their function. STTM technology has been successfully applied to the functional study of miRNAs in plants, but its application in regulating tRFs and disease resistance has not yet been reported. Currently, there are no methods for using STTM technology to target tRF-Lys to enhance wheat resistance to ergot disease, and there is also a lack of functional validation and transformation systems for this tRF. Therefore, developing a method based on STTM technology to specifically inhibit the expression of tRF-Lys and thereby improve wheat resistance to ergot disease has important theoretical significance and practical value.

[0007] In summary, existing technologies for controlling wheat fusarium head blight have limitations, and traditional breeding and conventional genetic engineering methods are difficult to effectively improve resistance. Furthermore, the functional role of tRFs in wheat disease resistance mechanisms is understudied, especially the regulatory role of tRF-Lys, which remains unclear. A novel molecular strategy is urgently needed to precisely regulate host disease resistance pathways by targeting key tRF molecules, thus providing a new breakthrough for improving wheat fusarium head blight resistance. Summary of the Invention

[0008] Technical problems to be solved: The present invention aims to solve the key technical problems in the field of wheat fusarium head blight prevention and control, and provides a gene regulation method based on STTM-mediated tRF-Lys silencing technology to enhance wheat resistance to fusarium head blight. At present, wheat fusarium head blight not only leads to serious yield reduction, but the fungal toxins it produces also threaten food security and human health. Traditional chemical control methods are prone to induce drug resistance in pathogens and pose environmental and food safety risks; while disease-resistant breeding has made slow progress due to the complex genetic mechanism of resistance and the lack of genetic resources. Although genetic engineering technology provides new ideas for improving crop resistance, the functional analysis of resistance genes to wheat fusarium head blight is insufficient, especially the research on the role of non-coding RNAs such as tRF-Lys in disease resistance mechanisms is still blank. Therefore, the development of precise regulatory strategies based on gene editing technology to target the inhibition of tRF-Lys to improve wheat fusarium head blight resistance has become a core challenge to break through the limitations of existing prevention and control.

[0009] Technical solution: A DNA molecule tRF-Lys, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO: 1.

[0010] A DNA molecule STTM tRF-Lys The nucleotide sequence of the DNA molecule is shown in SEQ ID NO: 2, and is used to specifically induce the degradation of tRF-Lys in plants.

[0011] A recombinant vector comprising the above-mentioned STTM tRF-Lys A DNA molecule is inserted between the HindIII and Sad restriction endonuclease sites of the pCambia3300 vector. The nucleotide sequence of the recombinant vector is shown in SEQ ID NO: 3.

[0012] An Agrobacterium strain comprising the above recombinant vector.

[0013] A method for improving wheat scab resistance comprises the following steps: (a) introducing the above-mentioned recombinant vector into wheat recipient plants using Agrobacterium-mediated genetic transformation; (b) screening and obtaining STTM expressing tRF-Lys A transgenic wheat plant having a higher resistance to fusarium head blight than a non-transgenic recipient plant.

[0014] A method for detecting the expression level of tRF-Lys in plants comprises the following steps: (a) reverse transcribing plant RNA using the stem-loop primer RT-TaLys shown in SEQ ID NO:4 to obtain cDNA; and (b) performing real-time fluorescence quantitative PCR using the forward primer SEQ ID NO:5 and the reverse primer SEQ ID NO:6 to quantitatively analyze the expression level of tRF-Lys.

[0015] A method for identifying transgenic wheat plants comprises the following steps: (a) extracting genomic DNA from the plant to be tested; and (b) performing PCR amplification using primers SEQ ID NO: 7 and SEQ ID NO: 8 to detect the presence of a BAR gene.

[0016] The application of the above recombinant vector in improving the resistance of gramineous plants to fusarium head blight.

[0017] A transgenic wheat seed comprises the above-mentioned recombinant vector, and the offspring plants of the seed show enhanced resistance to scab.

[0018] Beneficial effects: The present invention inhibits tRF-Lys through STTM technology, achieving a significant improvement in wheat resistance to ergot disease, and has multiple innovative values. First, this strategy directly targets the key targets of pathogen infection, significantly improves the disease resistance of wheat ears, effectively reduces toxin accumulation, and provides a new way to ensure grain yield and quality. Secondly, by regulating endogenous non-coding RNA through gene editing, the use of chemical agents is avoided, which not only reduces the environmental burden, but also circumvents the ethical controversy of traditional transgenic technology, and is in line with the development trend of green agriculture. In addition, this study reveals the new function of tRF-Lys in the interaction between wheat and ergot pathogens, enriches the disease-resistant gene resource library, and provides a theoretical basis and technical support for crop disease-resistant breeding. Finally, the present invention expands the application scenarios of STTM technology in crop disease prevention and control, promotes the innovative application of gene editing technology in agricultural biotechnology research and development, and is of great significance to improving global food security and promoting sustainable agricultural development. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the expression of tRF-Lys between resistant and susceptible varieties in Example 1 of the present invention.

[0020] Figure 2 This is a nucleic acid sequence alignment diagram of the tRF-Lys and Lys-tRNA precursor sequences in Example 1 of the present invention.

[0021] Figure 3 This is a simplified diagram of the vector construction in Example 1 of the present invention.

[0022] Figure 4 This is a positive identification diagram of transgenic in Example 1 of the present invention.

[0023] Figure 5 This is the expression detection diagram of the positive strain in Example 1 of the present invention.

[0024] Figure 6 The STTM in Example 1 of the present invention tRF-Lys Fusarium phenotype of overexpressing transgenic materials.

[0025] Figure 7 The STTM in Example 1 of the present invention tRF-Lys Statistical results of diseased ear rate of fusarium head blight phenotype of overexpressing transgenic materials. DETAILED DESCRIPTION

[0026] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0027] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0028] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.

[0029] Unless otherwise specified, the raw materials used in the examples of the present invention are commercially available.

[0030] The Chinese Spring wheat variety, which is moderately susceptible to fusarium and also sequenced, and the highly resistant fusarium variety were inoculated with fusarium, and samples were collected for small RNA sequencing. tRF-Lys that specifically responded to fusarium were found. Further quantitative verification revealed that tRF-Lys accumulated more in the susceptible variety after inoculation ( Figure 1 By cloning and sequencing tRF-Lys, it was found that tRF-Lys is derived from the 5' end of Lys-tRNA ( Figure 2 ). We then artificially synthesized STTM tRF-Lys The nucleotide sequence of tRF-Lys is shown in SEQ ID NO.1 in the sequence table, and its STTM tRF-Lys The sequence is shown as SEQ ID NO.2.

[0031] Example 1

[0032] (1) Wheat RNA extraction and stem-loop reverse transcription:

[0033] RNA extraction:

[0034] ① Preparation: Sample, 2mL / 1.5mL enzyme-free centrifuge tube, enzyme-free pipette tip, 75% alcohol (prepared with DEPC-treated water), isopropanol, centrifuge pre-cooled to 4℃.

[0035] ② Pre-cool the mortar and pestle with liquid nitrogen, quickly transfer the sample to the mortar, and grind into powder. Pour an appropriate amount of powder into a 2 mL enzyme-free centrifuge tube, place the tube on ice, add 1 mL of Trizol, and place it on a shaker. Shake thoroughly for 30 seconds to fully lyse the sample. Then add 400 μL of chloroform and shake thoroughly on a shaker for 15 seconds. After standing for 3 minutes, place the tube in a centrifuge at 4°C, 12,000 rpm, and centrifuge for 15 minutes.

[0036] ③ Pipette 400 μL of supernatant into a 1.5 mL enzyme-free centrifuge tube, add isopropanol at a 1:1 ratio, invert the tube 5-10 times to mix, and place in a -20°C refrigerator for 30 minutes to precipitate RNA. After precipitation, place in a centrifuge at 4°C, 12,000 rpm, and centrifuge for 15 minutes;

[0037] ④ Remove the centrifuge tube, discard the supernatant, and add 1 mL of 75% alcohol (prepared with DEPC-treated water) to wash the RNA precipitate. Place the tube in a centrifuge at 4°C, 12,000 rpm, and centrifuge for 5 minutes. Discard the supernatant and centrifuge for 10-20 seconds. Use an enzyme-free pipette tip to remove any remaining alcohol.

[0038] ⑤Place the centrifuge tube in a clean bench and air dry for 15-20 minutes until transparent, add preheated 70℃ DEPC water and dissolve for 5 minutes.

[0039] ⑥Store the extracted RNA in a -80℃ freezer.

[0040] cDNA was reverse transcribed using a stem-loop reverse transcription kit (Novozymes, Nanjing):

[0041] The primers used for stem-loop inversion were designed based on the reference genome, and the sequences are as follows:

[0042] Stem-loop primers are RT-TaLys:

[0043] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCAAC(SEQ ID NO:4)

[0044] ①Removal of genomic DNA:

[0045] Table 1

[0046]

[0047] PCR program: 42°C, 2 min.

[0048] ②Reverse transcription of cDNA:

[0049] Table 2

[0050]

[0051] PCR program: 25°C for 5 min, 50°C for 15 min, and 85°C for 5 min. The reverse transcription product was stored at -20°C.

[0052] (2) Stem-loop real-time fluorescence quantitative PCR:

[0053] The primers used for quantification were designed based on the reference genome, and their sequences are as follows:

[0054] The forward primer was: GGACCGCCCGTCTAGCTCA (SEQ ID NO: 5);

[0055] The reverse primer was: GTGCAGGGTCCGAGGT (SEQ ID NO: 6);

[0056] Real-time fluorescence quantitative PCR: Prepare 10 μL of quantitative PCR system as follows:

[0057] Table 3

[0058]

[0059] PCR program: pre-denaturation: 95°C for 30 s; cycling reaction: 95°C for 5 s, 60°C for 34 s, 40 cycles; melting curve: 95°C for 15 s, 60°C for 60 s, 95°C for 15 s.

[0060] (3) Construction of transgenic vector:

[0061] The tRF-Lys sequence was designed and synthesized using STTM technology, and then synthesized and ligated into the pUC57 vector by Nanjing GenScript. After obtaining E. coli, the plasmid was extracted and digested using a plasmid DNA miniprep kit (Sangon, China).

[0062] Ligation of pCambia3300 vector:

[0063] Prepare 10 μL of ligation system with the following components:

[0064] Table 4

[0065]

[0066] The PCR program was 25°C for 2 h.

[0067] The ligation product was transformed into E. coli Fast-T1 competent cells. After plating overnight, 20 single clones were selected from each plate for PCR to detect positive strains. The plasmids of the positive strains were extracted and transformed into Agrobacterium EHA105 for the creation of transgenic materials. The constructed vector is shown in the following figure. Figure 3 The nucleotide sequence of the recombinant vector is shown in SEQ ID NO: 3, wherein CaMV35S represents the strong promoter of tobacco mosaic virus 35S, and the BAR gene can confer herbicide resistance to plants.

[0068] (4) Genetic transformation: The creation of transgenic materials was completed by Quanmai Biotechnology Co., Ltd.

[0069] (5) Positive identification of transgenic genes:

[0070] DNA level identification:

[0071] Extraction of transgenic wheat DNA:

[0072] ① Grind wheat leaves in a mortar with liquid nitrogen. Transfer the thoroughly ground powder to a 1.5 mL centrifuge tube. Add 650 mL of CTAB extraction solution (100 mM Tris-HCl (pH 8.0), 4 mol / L NaCl, 20 mmol / L EDTA (pH 8.0), 2% CTAB, and add 2 mL / 100 mL β-mercaptoethanol before use) and mix thoroughly.

[0073] ② Incubate in a 65℃ water bath for 30 minutes, shaking gently several times in between;

[0074] ③ Place on ice for 5 minutes;

[0075] ④Add 400 μL of chloroform and mix gently;

[0076] ⑤Stand at room temperature for 10 minutes, centrifuge at 12000 rpm for 15 minutes, and collect the supernatant;

[0077] ⑥Add 2 times the volume of ice ethanol, mix well, and let stand at -20℃ for 30 minutes;

[0078] ⑦ Centrifuge and discharge the supernatant;

[0079] ⑧ Rinse twice with 1 mL of 70% ethanol and let dry;

[0080] ⑨ Dissolve in 100 μL sterile water for later use.

[0081] BAR gene detection: BAR gene detection primers are as follows:

[0082] Forward primer: CTACATCGAGACAAGCACGGTCAA (SEQ ID NO: 7)

[0083] Reverse primer: AGAAACCCACGTCATGCCAGTTC (SEQ ID NO: 8)

[0084] The following PCR procedure was used for detection. The PCR reaction system was as follows:

[0085] Table 5

[0086]

[0087] PCR program: 95°C, 3 min; 95°C, 30 s, 58°C, 30 s, 72°C, 30 s, 35 cycles; 72°C, 5 min;

[0088] The PCR products were identified using 2% agarose gel. Figure 4 As shown. Among them, the detected gene is the BAR gene. #13, #14 and #24 represent three transformed strains respectively.

[0089] The expression level identification results are as follows Figure 5 shown.

[0090] Phenotypic analysis of ergot disease:

[0091] Experimental strains and bacterial solution preparation:

[0092] The Fusarium graminearum strain used in this experiment was sequenced PH-1, provided by Dr. Li Bing of Zhengzhou University. The strain and bacterial culture preparation steps are as follows:

[0093] (1) The strain was activated on PDA solid culture medium and cultured in a constant temperature incubator at 25°C for 5 days to ensure the growth and reproduction of the strain.

[0094] (2) After the culture is completed, use a sterilized punch to take 4 bacterial blocks from the culture medium, transfer the obtained bacterial blocks to 50 mL of mung bean soup liquid culture medium, set the shaking temperature and speed to 25°C and 150 r / min respectively, and culture for 3-5 days.

[0095] (3) After the culture is complete, take 1 μL of spore solution and drop it onto a blood cell counting plate. Use a microscope to observe and count the spores to determine the spore concentration. When the spore concentration reaches 1×10 5 When the spore solution reaches 100 μg / mL, it can be used for inoculation experiments.

[0096] Fusarium scab inoculation and phenotypic identification:

[0097] During the flowering period of wheat, the bacterial solution was injected between the inner and outer lemmas of the florets on both sides of the fifth spikelet using the double flower drip method. A label was affixed to the spikelet axis with the inoculation date. 10 days after inoculation, fusarium spores were identified. The diseased spikelet rate was calculated as follows: diseased spikelet rate = diseased spikelet / total number of spikelets. Phenotypic identification and statistical results are shown in the figure below. Figure 6 、 7 shown. Figure 6 The Fielder in the middle represents the transgenic recipient variety, and #13, #14, and #24 represent three transformed lines. The scale bar represents 1 cm. The image shows a side view of an ear. Figure 7 "PSS" stands for Percentage of Symptom Spikelets. The number of spikelets inoculated and phenotyped for each transgenic line was greater than or equal to 6. Statistical analysis was performed using the Student's t test. ns indicates p > 0.05, and *** indicates p < 0.001. Phenotypic statistical results indicate that STTM silencing of tRF-Lys reduced the symptom spikelet rate from 35% in the wild type to approximately 15%. In line #14, the symptom spikelet rate was only 10%, demonstrating the significant efficacy of STTM silencing.

[0098] Figure 1 Figure 2 shows the expression of tRF-Lys in resistant and susceptible varieties. "CSM" represents the control sample of Chinese Spring, "CSI" represents the inoculated sample of Chinese Spring, "SMM" represents the control sample of Sumai 3, and "SMI" represents the inoculated sample of Sumai 3. These results indicate that tRF-Lys is significantly induced by F. graminearum, with even stronger induction in the susceptible variety CS. Figure 2 This is a nucleic acid sequence alignment diagram of tRF-Lys and Lys-tRNA precursor sequences, where the bases marked in red represent the tRF-Lys sequence formed by the Lys-tRNA, and the bases marked in blue represent the anticodon for the transported amino acid. Figure 5 This is the expression detection diagram of the positive strains, among which Fielder is the transgenic recipient variety, #13, #14 and #24 represent three transformed strains respectively. From the expression results, it can be seen that the STTM sequence cannot be detected in Fielder, while relatively strong STTM expression can be detected in the three transgenic strains.

[0099] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, and all of these should be included in the scope of the present invention.

Claims

1. A DNA molecule tRF-Lys, characterized in that The nucleotide sequence of the DNA molecule is shown in SEQ ID NO:

1.

2. A DNA molecule STTM tRF-Lys , characterized in that, The nucleotide sequence of the DNA molecule is shown in SEQ ID NO: 2, and is used to specifically induce the degradation of tRF-Lys in plants.

3. A recombinant vector, characterized in that Containing the STTM according to claim 2 tRF-Lys A DNA molecule is inserted between the HindIII and Sad restriction endonuclease sites of the pCambia3300 vector. The nucleotide sequence of the recombinant vector is shown in SEQ ID NO:

3.

4. An Agrobacterium strain, characterized in that Comprising the recombinant vector according to claim 3.

5. A method for improving wheat head blight resistance, characterized in that: The following steps are involved: (a) using Agrobacterium-mediated genetic transformation to introduce the recombinant vector of claim 3 into wheat recipient plants; (b) screening and obtaining plants expressing STTM tRF-Lys A transgenic wheat plant having a higher resistance to fusarium head blight than a non-transgenic recipient plant.

6. A method for detecting the expression level of tRF-Lys in plants, characterized in that: The following steps are involved: (a) Plant RNA was reverse transcribed using the stem-loop primer RT-TaLys shown in SEQ ID NO:4 to obtain cDNA; (b) Real-time fluorescence quantitative PCR was performed using the forward primer SEQ ID NO:5 and the reverse primer SEQ ID NO:6 to quantitatively analyze the expression level of tRF-Lys.

7. A method for identifying transgenic wheat plants, characterized in that: The following steps are involved: (a) Extracting genomic DNA from the plant to be tested; (b) Performing PCR amplification using primers SEQ ID NO: 7 and SEQ ID NO: 8 to detect the presence of the BAR gene.

8. Use of the recombinant vector according to claim 3 in improving the resistance of grass plants to scab.

9. A transgenic wheat seed, characterized in that: The seeds contain the recombinant vector of claim 3, and offspring plants of the seeds show enhanced resistance to ergot disease.

Images