Gene for promoting development of lonicera macranthoides flower organ and application of gene in regulation and control of inflorescence branching

Abstract

The invention discloses a gene for promoting development of lonicera macranthoides flower organs and application of the gene in regulation and control of inflorescence branching, and relates to the technical field of plant genetic engineering.The gene for promoting development of the lonicera macranthoides flower organs is SVP3, and the gene sequence of the gene is shown as SEQ ID NO.1; an amino acid sequence of a coding protein of the gene is shown as SEQ ID NO.2, and the gene can be cloned through RNA extraction and reverse transcription; the gene is used for regulating and controlling organ development of lonicera macranthoides, is used for constructing a plant overexpression vector, and can regulate and control plant inflorescence branching; the invention provides a gene for promoting the development of a lonicera macranthoides flower organ. The invention provides a cloning method of the gene SVP3 for promoting the development of the lonicera macranthoides flower organ and a specific primer required by cloning. Meanwhile, the invention also provides application of the gene in regulating and controlling inflorescence branching, which indicates that the gene has a good application prospect and provides a valuable gene resource for cultivating new varieties of flower medicinal materials and flower ornamental plants.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, in particular to a gene for promoting organ development of honeysuckle and an application thereof in regulating inflorescence branching. Background Art

[0002] Lonicera macranthoides, a perennial evergreen shrub or vine in the Caprifoliaceae family and Lonicera genus, is one of the primary basal plants of the traditional Chinese medicine "Shan Yinhua." Its medicinal parts, the dried buds and newly opened flowers, possess high medicinal and economic value. As a floral medicinal material, the development of its floral organs has long been a key and challenging area of ​​research for researchers. However, current research focuses primarily on the molecular mechanisms underlying flowering duration and corolla failure, with little research on inflorescence branching, a yield trait. To further increase Shan Yinhua yield, enhance its ornamental value, and provide new, superior germplasm resources, it is crucial to conduct in-depth research into the mechanisms of inflorescence branching and its impact on yield.

[0003] The short vegetation phase (SVP) gene, a member of the STMADS11 subfamily of the MADS-box gene family, is highly conserved throughout evolution. SVP is a flowering repressor gene that shares high sequence similarity with AGAMOUS-like 24 (AGL24), also in the STMADS11 subfamily, but functions in contrast to AGL24, a flowering-promoting gene. SVP plays a crucial role in regulating flowering time, floral organ development, and dormancy. Within the floral pathway, SVP interacts with multiple genes in the flowering time regulatory network to repress the expression of floral genes such as SOC1, FT, and LFY, thereby delaying flowering and maintaining the vegetative phase. Previous studies have shown that SVP genes generally function during the early stages of floral organ development, determining floral meristem specificity. However, their modes of action and functions vary across plant species, and even SVP genes isolated from the same species exhibit distinct functions.

[0004] Although SVP homologous genes have been isolated from multiple species, including Lonicera cinerea, and two SVP genes have been reported from Lonicera cinerea, their functions are to delay flowering and alter the morphology of floral organs such as petals, carpels, and calyx, and they do not regulate inflorescence branching. The present invention cloned another SVP gene from Lonicera cinerea that has the function of regulating inflorescence branching. Using this gene as a starting point, the function of this gene and its application in the development of floral organs such as inflorescence branching in plants were studied through methods such as vector construction and genetic transformation of Arabidopsis thaliana. Summary of the Invention

[0005] In view of this, the present invention addresses the deficiencies in the prior art, and its main purpose is to provide a gene that promotes the development of the organs of Lonicera japonica. It provides an SVP3 gene that promotes the development of the organs of Lonicera japonica and its encoding protein sequence. The present invention provides a cloning method for the gene SVP3 that promotes the development of the organs of Lonicera japonica and the specific primers required for cloning; it also provides the application of the gene in regulating inflorescence branching, indicating that the gene has good application prospects and provides valuable genetic resources for cultivating new varieties of flower medicinal materials and flower ornamental plants.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A gene promoting organ development of honeysuckle is disclosed. The gene is SVP3, and its gene sequence is shown in SEQ ID NO.1. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. The gene can be cloned through RNA extraction and reverse transcription.

[0008] As a preferred solution, the gene is cloned by RNA extraction and reverse transcription in the following specific steps:

[0009] S1. Using Lonicera japonica as the material, RNA was extracted and reverse transcribed to generate cDNA, which was used as a template for PCR amplification to obtain the LmSVP3 gene of Lonicera japonica;

[0010] S2. Analyze the obtained L. glauca LmSVP3 gene sequence and design PCR specific primers;

[0011] S3. Using L. glauca cDNA as a template, PCR amplification was performed with LmSVP3-specific primers to obtain the cloned gene and the amino acid sequence of the protein it encoded.

[0012] As a preferred solution: the expression characteristics of the cloned gene obtained in step S3 are analyzed: the expression pattern of the LmSVP3 gene in the flower buds, stems and leaves of different varieties of Lonicera japonica is analyzed using qRT-PCR.

[0013] As a preferred solution: the PCR specific primer in step S2 includes LmSVP3-F, and its primer sequence is: ATGGTGAGACAGAGAATAGAAAT; the PCR specific primer includes LmSVP3-R, and its primer sequence is: TCATTTGTCGAAAGGTTGTCCCA.

[0014] As a preferred solution: the reaction system for PCR amplification in step S3 is: 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of LmSVP3-F and LmSVP3-R, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O.

[0015] As a preferred solution: the PCR reaction program in step S3 is: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 1 minute, 35 cycles; complete extension at 72°C for 5 minutes; and continuous at 12°C.

[0016] As a preferred solution: overexpression of the gene is used to promote organ development of Lonicera japonica. The gene is applied to the construction of a plant overexpression vector, and the gene can promote inflorescence branching.

[0017] As a preferred solution: the specific method for constructing the plant overexpression vector is: using the homologous recombination method to construct the PHG-LmSVP plant overexpression vector, using homologous recombination primers to amplify the target fragment, and then recombining it into the linearized vector PHG vector, transforming the recombination reaction into Escherichia coli and picking single clones for identification and sequencing.

[0018] As a preferred solution: when constructing the plant overexpression vector, the enzymes BamH I and Pst I are used to design specific primers with vector homologous sequences based on the restriction sites contained in the SVP3 gene sequence itself and the multiple cloning site contained in the plant overexpression vector PHG used.

[0019] As a preferred solution: the names and sequences of the specific primers with vector homologous sequences are as follows:

[0020] p-LmSVP3-F:CTCTCTCTCAAGCTTGGATCCATGGTGAGACAGAGAATAGAAA;

[0021] p-LmSVP3-R:ACGGGTCATGAGCTCCTGCAGTCATTTGTCGAAAGGTTGTCCC.

[0022] Compared with the prior art, the present invention has obvious advantages and beneficial effects. Specifically, it can be seen from the above technical scheme that a gene that promotes the development of the flower organs of gray felt honeysuckle is provided, the coding protein of the gene, the method for preparing the SVP3 gene and the primers required in the preparation process are provided, and the function of the SVP3 gene in promoting the branching of plant inflorescences is verified by the successful construction of the SVP3 gene overexpression vector and the genetic transformation of Arabidopsis thaliana. The present invention provides a cloning method for the gene SVP3 that promotes the development of the flower organs of gray felt honeysuckle; provides a vector, host cell and engineered bacteria containing the gene; also provides the application of the gene in regulating inflorescence branching, and provides an application path for the gene in improving plant traits, indicating that the gene has good application prospects and provides valuable genetic resources for cultivating new varieties of flower medicinal materials and flower ornamental plants.

[0023] To more clearly illustrate the structural features and effects of the present invention, it is described in detail below with reference to the accompanying drawings and specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a schematic diagram of the CDS cloning of the LmSVP3 gene of Lonicera japonica of the present invention;

[0025] Figure 2 Schematic diagram of the NJ phylogenetic tree of the Lonicera japonica LmSVP3 protein of the present invention;

[0026] Figure 3 Schematic diagram of the expression pattern of the LmSVP gene of the present invention in different tissues of Lonicera japonica cultivars 'Longhua' and 'Baiyun';

[0027] Figure 4 Schematic diagram of the PCR amplification fragment of the LmSVP3 recombinant bacterial solution of the present invention;

[0028] Figure 5 Schematic diagram of HYG resistance screening of transgenic Arabidopsis thaliana of the present invention;

[0029] Figure 6 Schematic diagram of the screening and identification of the Arabidopsis transgenic lines of the present invention;

[0030] Figure 7 Schematic diagram showing the phenotype comparison of LmSVP3 transgenic Arabidopsis thaliana of the present invention. DETAILED DESCRIPTION

[0031] The present invention Figures 1 to 7As shown, a gene that promotes the organ development of honeysuckle is SVP3, and its gene sequence is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2. The gene can be cloned by RNA extraction and reverse transcription.

[0032] The specific steps for cloning the gene through RNA extraction and reverse transcription are as follows:

[0033] S1. Using Lonicera japonica as the material, RNA was extracted and reverse transcribed to generate the first-strand cDNA, which was used as a template for PCR amplification to obtain the LmSVP3 gene of Lonicera japonica;

[0034] S2. Analyze the obtained L. glauca LmSVP3 gene sequence and design PCR specific primers;

[0035] S3. Using L. glauca cDNA as a template, PCR amplification was performed with LmSVP3-specific primers to obtain the cloned gene and its encoded protein sequence.

[0036] The expression characteristics of the positive cloned genes and their encoded proteins obtained in step S3 were analyzed: qRT-PCR was used to analyze the expression pattern of the LmSVP3 gene in the flower buds, stems and leaves of different varieties of Lonicera japonica.

[0037] In step S2, the PCR specific primer includes LmSVP3-F, and the primer sequence thereof is ATGGTGAGACAGAGAATAGAAAT; the PCR specific primer includes LmSVP3-R, and the primer sequence thereof is TCATTTGTCGAAAGGTTGTCCCA.

[0038] The reaction system for PCR amplification in step S3 is as follows: 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of LmSVP3-F and LmSVP3-R, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O.

[0039] The PCR reaction procedure in step S3 is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; complete extension at 72°C for 5 min; and continuous at 12°C.

[0040] Overexpression of this gene is used to promote the organ development of honeysuckle flowers. This gene is used in the construction of plant overexpression vectors, and this gene can promote inflorescence branching.

[0041] The specific method for constructing the plant overexpression vector is as follows: the PHG-LmSVP plant overexpression vector is constructed by homologous recombination, the target fragment is amplified using homologous recombination primers, and then recombined into the linearized vector PHG vector, the recombination reaction is transformed into Escherichia coli, and a single clone is picked for identification and sequencing.

[0042] When constructing the plant overexpression vector, enzymes BamH I and Pst I are used to design specific primers with vector homologous sequences based on the restriction sites contained in the SVP3 gene sequence itself and the multiple cloning sites contained in the plant overexpression vector PHG.

[0043] The names and sequences of the specific primers with vector homology sequences are as follows:

[0044] p-LmSVP3-F:CTCTCTCTCAAGCTTGGATCCATGGTGAGACAGAGAATAGAAA;

[0045] p-LmSVP3-R:ACGGGTCATGAGCTCCTGCAGTCATTTGTCGAAAGGTTGTCCC.

[0046] Example 1: Cloning and molecular characterization of the LmSVP3 gene of Lonicera japonica

[0047] S1. Using Lonicera japonica L. 'Longhua' as the material, RNA was extracted and reverse transcribed to generate cDNA, which was used as a template for PCR amplification.

[0048] S2. Analyze the LmSVP3 gene sequence of Lonicera japonica obtained from the transcriptome to design specific primers. The primer sequences for PCR reaction are shown in Table 1:

[0049] Table 1: PCR reaction primers

[0050] Primer name Primer sequence (5'-3') LmSVP3-F ATGGTGAGACAGAGAATAGAAAT LmSVP3-R TCATTTGTCGAAAGGTTGTCCCA

[0051] S3. PCR amplification was performed using L. griseum cinerea cDNA as a template using LmSVP3-specific primers. The reaction mixture (25 μL) consisted of 12.5 μL of 2× Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of LmSVP3-F and LmSVP3-R, 0.5 μL of PhantaMax Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O. The PCR protocol was as follows: 95°C initial denaturation for 3 min; 35 cycles of 95°C denaturation for 15 s, 60°C annealing for 15 s, and 72°C extension for 1 min; a complete extension at 72°C for 5 min; and a continuous extension at 12°C. After completion of the reaction, the PCR product was subjected to 1.0% agarose gel electrophoresis and recovered using an agarose gel purification kit. The recovered product was ligated into the pTOPO vector and transformed into competent E. coli DH5α cells. Positive clones were isolated and sequenced.

[0052] Bioinformatics analysis was performed on the LmSVP3 gene and its encoded protein obtained by cloning.

[0053] Result analysis:

[0054] The CDS sequence of this gene was obtained from the transcriptome of Lonicera japonica. RT-PCR was performed using Lonicera japonica cDNA as a template. PCR amplification products were detected by 1.0% agarose gel electrophoresis. The results showed that a clear and distinct band appeared between 750 bp and 500 bp of the marker, which was consistent with the expected size. Figure 1 The positive single clones were identified and sent for sequencing. The sequencing results were compared and found to be consistent with the sequence in the transcriptome, as shown in SEQ ID NO.1.

[0055] The results of online analysis using EditSeq and ExPASy ProtParam showed that the CDS length of the cloned LmSVP3 gene was 639 bp, encoding a protein of 212 amino acids (SEQ ID NO. 2), and its molecular formula was estimated to be C 1909 H 3181 N 639 O 778 S 131The number of atoms is 6638, the relative molecular mass is 24337.42, the isoelectric point (Theoretical pI) is 9.15, and the instability index is 58.07>40, which is an unstable protein. The hydropathicity coefficient (Grand average of hydropathicity) is -0.829, which is speculated to be a hydrophilic protein. The subcellular localization was predicted online using WOLF PSORT, and the results showed that the LmSVP3 protein was localized in the nucleus. TMHMM2.0 analysis found that LmSVP3 does not have a transmembrane region. SignalP 4.1 software predicted that the LmSVP3 protein does not have a signal peptide sequence and is a non-secretory protein.

[0056] To further understand the phylogenetic evolution of LmSVP3, a phylogenetic tree was constructed using the amino acid sequences of the MADS-box family from Quercus lobata, Citrus sinensis, Citrus x clementina, Actinidia deliciosa, Actinidia eriantha, Nelumbo nucifera, Camellia lanceoleosa, Prunus persica, Glycine soja, Herrania umbratica, Durio zibethinus, Vigna unguiculata, Osmanthus fragrans, Coffea arabica, Phaseolus vulgaris, Alnus glutinosa, and Solanum dulcamara, which share some homology with the LmSVP3 amino acid sequence. The results showed that the cloned gene of Lonicera glauca belongs to the SVP class ( Figure 2 ), named LmSVP3.

[0057] Example 2: Analysis of expression characteristics of L. grisea LmSVP3 gene

[0058] The expression pattern of LmSVP3 gene in flower buds, stems and leaves of Lonicera japonica cultivars 'Longhua' and 'Baiyun' was studied by qRT-PCR.

[0059] (1) Total RNA was extracted from young leaves, mature leaves, stems, and flower buds of Lonicera japonica ‘Longhua’ and ‘Baiyun’ cultivars and reverse transcribed into cDNA;

[0060] (2) The 18S rRNA gene of Lonicera japonica was selected as the internal reference gene for qPCR analysis, and specific primers for the internal reference gene and target gene were designed using PrimerPremier 6.0. The primers are shown in Table 2:

[0061] Table 2: Real-time fluorescence quantitative PCR primers for Lonicera japonica

[0062] Primer name Primer sequence (5'-3') LmSVP3-qF GTGCCCAATCCGATCCCTCAAAG LmSVP3-qR GCTTGCCAGTGGAAGAGAAGACA 18SrRNA-qF CTTCGGGATCGGAGTAATGA 18SrRNA-qR GCGGAGTCCTAGAAGCAACA

[0063] (3) Using the cDNA obtained by reverse transcription as a template, qPCR analysis was performed on the expression of LmSVP3 gene in different varieties and different tissues of L. gracile. Reaction system: 2×RealStar Green Fast MixturePCR 5μL, Forward primer 0.4μL, Reverse primer 0.4μL, cDNA 1μL, ddH2O 3.2μL. Amplification program: 95℃ pre-denaturation for 2min; 95℃ denaturation for 15s, 60℃ annealing for 30s, 72℃ extension for 20s, 40 cycles. After the reaction, melting curve analysis was performed. The melting curve was 95℃ 5s, 56℃ 5s, 95℃ continuously. Each sample was repeated 3 times, using 2 -ΔΔCt The relative expression levels of genes were calculated.

[0064] Result analysis:

[0065] The expression of LmSVP3 gene in different tissue parts (flowers, leaves and stems) of L. glauca ‘Longhua’ and ‘Baiyun’ cultivars was analyzed by qRT-PCR using 18S rRNA as internal reference gene. Figure 3 The results showed that the LmSVP gene was expressed in the young leaves, mature leaves, stems, and flower buds of both the 'Longhua' and 'Baiyun' varieties, with expression in leaves significantly higher than in stems and flower buds. In flower buds, the expression level of the LmSVP3 gene in the 'Longhua' variety was significantly higher than that in the 'Baiyun' variety (P < 0.05).

[0066] Example 3: Construction of Lonicera japonica LmSVP3 gene overexpression vector and genetic transformation of Arabidopsis thaliana

[0067] (1) Construction of plant overexpression vector

[0068] Based on the restriction sites contained in the LmSVP3 gene sequence and the characteristics of the multiple cloning site contained in the plant overexpression vector PHG, the most suitable enzymes BamH I and Pst I were selected, and specific primers with vector homology sequences were designed. The primer names and sequences are as follows:

[0069] p-LmSVP3-F:CTCTCTCTCAAGCTT GGATCC ATGGTGAGACAGAGAATAGAAA;

[0070] p-LmSVP3-R:ACGGGTCATGAGCTC CTGCAG TCATTTGTCGAAAGGTTGTCCC

[0071] The PHG vector was double-digested with the restriction endonucleases QuickCut BamH I and Pst I. The correctly sequenced bacterial solution in Example 1 was used as a template, and the insert fragment was amplified by PCR. The digestion products and PCR amplification products were detected by electrophoresis, recovered, and purified, and then homologous recombination reactions were carried out using the ClonExpress II OneStep Cloning Kit according to the instructions. The recombinant products were transformed into Escherichia coli DH5α competent cells. After culture, the single clones were identified and sequenced. The sequencing results were compared, and the correctly sequenced bacterial solution plasmid was extracted.

[0072] The extracted recombinant vector plasmid was transformed into Agrobacterium GV3101, and the floral organ infection method was used to genetically transform Arabidopsis thaliana with the Agrobacterium containing the PHG-LmSVP3 vector plasmid.

[0073] Table 3: Plasmid PHG double enzyme digestion reaction system

[0074]

[0075]

[0076] Reaction conditions: 37°C for 1 h.

[0077] Table 4: Recombination reaction system

[0078] Linearized vector PHG 2μL Target gene fragment 1 μL 5×CEIIBuffer 4 μL ExnaseII 2μL <![CDATA[ddH2O]]> 11μL

[0079] The reaction conditions were: 37°C for 30 min.

[0080] (2) Screening and identification of Hyg resistance in transgenic Arabidopsis

[0081] T1 seeds from infected Arabidopsis plants were harvested, disinfected, and sown on 1 / 2 MS medium (supplemented with 30 mg / L Hyg). Wild-type Arabidopsis seeds were disinfected and sown on 1 / 2 MS medium (without antibiotics) as a control. Vernalization was performed in a dark refrigerator at 4°C for 2 days before placement in a plant culture room. Plants were grown in an environment with a relative humidity of 60%, a constant temperature of 20-22°C, a photoperiod of 16 hours light and 8 hours dark, and a light intensity of 80-200 μmol / M 2After 8-15 days of growth, the normally growing T1 generation Arabidopsis seedlings were transplanted into the cultivation medium for further cultivation.

[0082] DNA was extracted from T0 generation Arabidopsis seedlings screened for Hyg resistance and wild-type Arabidopsis WT plants. PCR detection was performed using the hygromycin resistance gene-specific primers HPT-F (GGTCGCGGAGGCTATGGATGC) and HPT-R (GCTTCTGCGGGCGA TTTGTGT). Arabidopsis seedlings with positive PCR results were cultured and harvested as T2 generation seeds. Screening was continued according to the above steps until the T3 generation was obtained.

[0083] PCR reaction system: 2×Taq mix 10μL; genomic DNA 2μL; primer 0.8μL; ddH2O 7.2μL.

[0084] PCR reaction conditions: 94°C for 3 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 1 min; 35 cycles; 72°C for 5 min.

[0085] (3) Phenotypic observation of transgenic Arabidopsis

[0086] The growth of LmSVP3 transgenic Arabidopsis thaliana and wild-type Arabidopsis thaliana was observed, and the bolting time (based on the time when the stalk extended 1 cm), the time when the first flower bud appeared, the number of main inflorescences, the time when the corolla expanded, and the number of rosette leaves at the corresponding time were counted. Each strain included 12 plants.

[0087] Table 5: Phenotypic statistics of T2 Arabidopsis thaliana transgenic with LmSVP3 gene

[0088]

[0089] Result analysis:

[0090] The PHG-LmSVP plant overexpression vector was constructed using homologous recombination. The target fragment was amplified using homologous recombination primers and then recombined into the linearized PHG vector. The recombination reaction was transformed into Escherichia coli and a single clone was picked for identification and sequencing. Figure 4 ) showed that the target fragment was connected to the vector, and the sequencing results were consistent with the sequence in the transcriptome, indicating that the PHG-LmSVP3 plant overexpression vector was successfully constructed.

[0091] The floral organ infection method was used to genetically transform Arabidopsis thaliana with the PHG-LmSVP3 vector plasmid into Agrobacterium. After the seeds matured, they were harvested and dried, disinfected, and sown on 1 / 2MS solid culture medium. The wild-type Arabidopsis was used as a control. The robust Arabidopsis seedlings that grew after resistance screening were transplanted and further cultured, and DNA was extracted for PCR detection. The test results were as follows: Figure 6 After hygromycin screening and PCR identification, a total of 16 LmSVP3 transgenic Arabidopsis lines were obtained. After the seeds of the identified transgenic Arabidopsis plants matured, they were collected and screened to the T3 generation for future use. The results of the T2 generation screening are as follows: Figure 5 shown.

[0092] The wild-type Arabidopsis WT was used as a control to observe the development of transgenic Arabidopsis overexpressing LmSVP3. Figure 7 . The results showed that Arabidopsis plants overexpressing LmSVP3 did not show a late flowering phenotype, and the time required for the first flower to open was 30.80-31.20 days, which was basically the same as the flowering time of wild-type Arabidopsis. This shows that overexpression of LmSVP3 does not cause an obvious late flowering phenotype in Arabidopsis. However, overexpression of LmSVP3 can cause changes in the number of main inflorescences of Arabidopsis. Arabidopsis plants overexpressing LmSVP3 can grow 3 or more main inflorescences at the same time, which is significantly more than wild-type Arabidopsis with only 1 main inflorescence. In addition, there are no other obvious phenotypic changes in Arabidopsis overexpressing LmSVP3. The above shows that the LmSVP3 gene has the function of promoting the branching of Arabidopsis inflorescences.

[0093] The design focus of the present invention is to provide a gene that promotes the development of flower organs of gray felt honeysuckle, provide the coding protein sequence of the gene, and a method for preparing the SVP3 gene and the specific primers required in the preparation process. The function of the SVP3 gene in promoting plant inflorescence branching is verified by the successful construction of the SVP3 gene overexpression vector and genetic transformation of Arabidopsis thaliana. The present invention provides a cloning method for the gene SVP3 that promotes the development of flower organs of gray felt honeysuckle; provides a vector, host cell and engineered bacteria containing the gene; and also provides the application of the gene in regulating inflorescence branching, and provides an application path for the gene in improving plant traits, indicating that the gene has good application prospects and provides valuable genetic resources for cultivating new varieties of flower medicinal materials and flower ornamental plants.

[0094] The above description is merely a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any minor modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. A gene that promotes organ development in Lonicera japonica, characterized by: The gene is SVP3, and its gene sequence is shown in SEQ ID NO.1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2. The gene can be cloned through RNA extraction and reverse transcription.

2. The gene for promoting organ development of Lonicera japonica according to claim 1, characterized in that: The specific steps of cloning the gene by RNA extraction and reverse transcription are as follows: S1. Using Lonicera japonica as the material, RNA was extracted and reverse transcribed to generate cDNA, which was used as a template for PCR amplification to obtain the LmSVP3 gene of Lonicera japonica; S2. Analyze the obtained L. glauca LmSVP3 gene sequence and design PCR specific primers; S3. Using L. glauca cDNA as a template, PCR amplification was performed with LmSVP3-specific primers to obtain the gene and its encoded protein sequence.

3. The gene for promoting organ development of Lonicera japonica according to claim 2, characterized in that: The expression characteristics of the cloned gene obtained in step S3 were analyzed: qRT-PCR was used to analyze the expression pattern of the LmSVP3 gene in the flower buds, stems and leaves of different varieties of Lonicera japonica.

4. The gene for promoting organ development of Lonicera japonica according to claim 2, characterized in that: The PCR specific primer in step S2 includes LmSVP3-F, and its primer sequence is: ATGGTGAGACAGAGAATAGAAAT; the PCR specific primer includes LmSVP3-R, and its primer sequence is: TCATTTGTCGAAAGGTTGTCCCA.

5. The gene for promoting organ development of Lonicera japonica according to claim 2, characterized in that: The reaction system for PCR amplification in step S3 is: 12.5 μL of 2×Phanta Max Buffer, 0.5 μL of dNTP Mix, 1 μL each of LmSVP3-F and LmSVP3-R, 0.5 μL of Phanta Max Super-Fidelity DNA Polymerase, 1.5 μL of cDNA template, and 8.0 μL of ddH2O.

6. The gene for promoting organ development of Lonicera japonica according to claim 5, characterized in that: The PCR reaction procedure in step S3 is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 1 min, 35 cycles; complete extension at 72°C for 5 min; and continuous at 12°C.

7. A use of a gene for promoting organ development of Lonicera japonica as claimed in claim 1, characterized in that: Overexpression of the gene is used to promote the organ development of Lonicera japonica. The gene is applied to the construction of a plant overexpression vector. The gene can promote the branching of plant inflorescences.

8. The use of a gene for promoting organ development of Lonicera japonica according to claim 7, characterized in that: The specific method for constructing the plant overexpression vector is: constructing the PHG-LmSVP3 plant overexpression vector using the homologous recombination method, using homologous recombination primers to amplify the target fragment, and then recombining it into the linearized vector PHG vector, transforming the recombination reaction into Escherichia coli and picking single clones for identification and sequencing.

9. The use of a gene for promoting organ development of Lonicera japonica according to claim 8, characterized in that: When constructing the plant overexpression vector, enzymes BamH I and Pst I are used to design specific primers with vector homologous sequences based on the restriction sites contained in the SVP3 gene sequence itself and the multiple cloning site contained in the plant overexpression vector PHG.

10. The use of a gene for promoting organ development of Lonicera japonica according to claim 9, characterized in that: The names and sequences of the specific primers with vector homology sequences are as follows: p-LmSVP3-F:CTCTCTCTCAAGCTTGGATCCATGGTGAGACAGAGAATAGAAA; p-LmSVP3-R:ACGGGTCATGAGCTCCTGCAGTCATTTGTCGAAAGGTTGTCCC。

Images