Application of BnaXTH22 gene or encoded protein thereof in regulating aluminum toxicity resistance of plants

Abstract

The invention provides an application of a BnaXTH22 gene or an encoded protein thereof in regulating aluminum toxicity resistance of plants, and belongs to the technical field of gene engineering. The invention provides an application of a BnaXTH22 gene, a protein coded by the BnaXTH22 gene or a derivative of the BnaXTH22 gene in at least one of the following aspects: adjusting the aluminum toxicity resistance and / or oxidation resistance of a plant, and culturing a plant variety with the aluminum toxicity resistance and / or oxidation resistance. The result of the embodiment of the invention shows that in an aluminum stress environment, compared with a wild type control WT, the root activity of a plant (OEs) over-expressing BnaXTH22 is improved, the malondialdehyde accumulation amount and the relative conductivity are reduced, and stronger aluminum toxicity tolerance and oxidation resistance are shown. Therefore, the BnaXTH22 gene or the encoded protein thereof can improve the aluminum toxicity resistance and oxidation resistance of the plant.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to an application of a BnaXTH22 gene or its encoded protein in regulating plant resistance to aluminum toxicity. Background Art

[0002] In acidic soils (pH < 4.5 to 5.0), aluminum exists mainly in the form of soluble and toxic Al3+. 3+ It can seriously interfere with the normal metabolic activities of soil biological communities and have toxic effects on plants. 3+ It can inhibit root growth, affect the plant's ability to absorb water and nutrients, thereby limiting plant growth and productivity, and also destroy the structure and function of plant root cells.

[0003] Developing and cultivating crops resistant to acidic aluminum-toxic soils is crucial for improving land utilization, crop quality, and yield in areas with these soils. While research has focused on plant aluminum detoxification mechanisms and tolerance to aluminum toxicity, few genes have been identified that effectively enhance plant aluminum tolerance. Summary of the Invention

[0004] In view of this, the present invention provides an application of a BnaXTH22 gene or its encoded protein in regulating plant resistance to aluminum toxicity, which can effectively improve the plant's resistance to aluminum toxicity and also effectively improve the plant's antioxidant capacity.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides an application of a BnaXTH22 gene, a protein encoded by the BnaXTH22 gene, or a derivative of the BnaXTH22 gene in at least one of the following: regulating plant resistance to aluminum toxicity and / or antioxidant properties and cultivating plant varieties with resistance to aluminum toxicity and / or antioxidant properties.

[0007] Preferably, the BnaXTH22 gene, the protein encoded by the BnaXTH22 gene or the derivative of the BnaXTH22 gene improves the plant's tolerance to aluminum toxicity and / or improves the plant's antioxidant capacity through positive regulation.

[0008] Preferably, said improving the plant's resistance to aluminum toxicity includes improving the activity of the plant's root system.

[0009] Preferably, the improving the antioxidant capacity of the plant includes reducing the malondialdehyde content of the plant and / or reducing the electrical conductivity of the plant.

[0010] Preferably, the derivative of the BnaXTH22 gene includes a recombinant expression vector containing the BnaXTH22 gene or a recombinant bacterium containing the BnaXTH22 gene.

[0011] Preferably, the backbone vector of the recombinant expression vector includes pCAMBIA1301;

[0012] The host bacteria of the recombinant bacteria include Agrobacterium (Alcaligenes) strain EHA105.

[0013] The present invention provides a method for improving the aluminum toxicity resistance and / or antioxidant ability of plants, and overexpresses the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene in plants.

[0014] The present invention provides a method for identifying the aluminum toxicity resistance and / or antioxidant ability of a plant, which comprises detecting the relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene in the plant, and judging the aluminum toxicity resistance and / or antioxidant ability of the plant based on the relative expression level: the relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene is positively correlated with the aluminum toxicity resistance and / or antioxidant ability of the plant.

[0015] Preferably, the reagent for detecting the relative expression level of the BnaXTH22 gene includes the forward primer shown in SEQ ID NO: 1 and the reverse primer shown in SEQ ID NO: 2.

[0016] Preferably, the plant comprises a plant of the family Brassicaceae.

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] The present invention provides a use of a BnaXTH22 gene, a protein encoded by the BnaXTH22 gene, or a derivative of the BnaXTH22 gene for at least one of the following: regulating plant tolerance to aluminum toxicity and / or antioxidant activity and cultivating plant varieties resistant to aluminum toxicity and / or antioxidant activity. The present invention genetically transforms the CDS sequence of BnaXTH22 into Brassica napus Westar (WT) to obtain plants (OEs) stably overexpressing BnaXTH22. Phenotypic character identification of the expressing plants, determination of physiological indicators, and overexpression transcriptome analysis revealed that, compared with WT, the overexpressing plants had significantly or extremely significantly increased taproot relative elongation and relative total root length, lower MDA accumulation and relative electrical conductivity, and significantly improved root activity, exhibiting stronger aluminum toxicity tolerance and antioxidant activity. Overexpression transcriptome analysis revealed that overexpression of BnaXTH22 can enhance adverse biological processes such as phenylpropanoid metabolism, fatty acid biosynthesis, lignin biosynthesis, and phenylpropanoid biosynthesis, thereby enhancing aluminum toxicity tolerance and antioxidant activity. It can be seen that the BnaXTH22 gene or its encoded protein described in the present invention can improve the aluminum toxicity resistance and antioxidant capacity of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure shows the results of total RNA integrity test; Lane M is a 5 kb marker (5000, 3000, 2000, 1500, 1000, 750, 500, 250, 100 bp); Lanes 1 to 3 represent three biological replicates, respectively;

[0020] Figure 2 The CDS detection results of BnaXTH22 are shown in Figure 1, where lane M is a 2 kb marker (2000, 1000, 750, 500, 250, 100 bp);

[0021] Figure 3 This is a map of the pCAMBIA1301-BnaXTH22 plasmid;

[0022] Figure 4 The figure shows the positive identification results of transgenic plants; lanes 1 to 9 represent 9 genetically transformed plants respectively; lane 10 is the recombinant plasmid pCAMBIA1301-BnaXTH22; lane 11 is the recipient material Westar; lane M is a 2 kb marker (2000, 1000, 750, 500, 250, 100 bp);

[0023] Figure 5 The relative expression level of BnaXTH22 in overexpressing plants is detected; "*" and "**" indicate significant differences at the 0.05 and 0.01 levels, respectively;

[0024] Figure 6 The hydroponic phenotypes of WT and OEs under 0 and 60 μM AlCl3 treatments;

[0025] Figure 7 The statistical results of WT and OEs phenotypes under 0 and 60 μM AlCl3 treatments; "*" and "**" indicate significant differences at the 0.05 and 0.01 levels, respectively;

[0026] Figure 8 The figure shows the effect of aluminum toxicity stress on the malondialdehyde content of WT and OEs;

[0027] Figure 9 The graph shows the effect of aluminum toxicity stress on the relative conductivity of WT and OEs;

[0028] Figure 10 This is the result diagram of the effect of aluminum toxicity stress on the root activity of WT and OEs;

[0029] Figure 11 This is the Spearman correlation heat map between TPM expression samples;

[0030] Figure 12 DEG distribution map and DEG Venn diagram between OE-2 vs WT at 0 h and 24 h, respectively, where A is the DEG distribution map and B is the DEG Venn diagram;

[0031] Figure 13 This is the result of GO-T enrichment analysis of differentially expressed genes at 0 h;

[0032] Figure 14 This is the result of GO-T enrichment analysis of differentially expressed genes in 24 hours;

[0033] Figure 15 Pathway-T enrichment analysis of differentially expressed genes at 0 h;

[0034] Figure 16 Pathway-T enrichment analysis of differentially expressed genes within 24 hours. DETAILED DESCRIPTION

[0035] The present invention provides an application of a BnaXTH22 gene, a protein encoded by the BnaXTH22 gene, or a derivative of the BnaXTH22 gene in at least one of the following: regulating plant resistance to aluminum toxicity and / or antioxidant properties and cultivating plant varieties with resistance to aluminum toxicity and / or antioxidant properties.

[0036] In the present invention, the plant preferably includes a plant of the family Brassicaceae. The plant of the family Brassicaceae preferably includes at least one of the genera Brassica oleracea, Brassica juncea, Brassica napus, and Brassicaceae, and more preferably includes the genus Brassica napus. The genus Brassica napus preferably includes Brassica napus.

[0037] In the present invention, the BnaXTH22 gene is preferably a fragment of positions 371 to 1015 of the gene with accession number XM_048742940.1 in GenBank. The nucleotide sequence of the BnaXTH22 gene is preferably as shown in SEQ ID NO: 3 (ATGCAGATGAAACTCGTCCCTGGTAACTCCGCAGGAACAGTCACAACAC).

[0038] In the present invention, the derivative of the BnaXTH22 gene preferably includes a recombinant expression vector containing the BnaXTH22 gene or a recombinant bacterium containing the BnaXTH22 gene. The backbone vector of the recombinant expression vector preferably includes pCAMBIA1301. The recombinant expression vector preferably obtains the BnaXTH22 gene by inserting the BnaXTH22 gene into the multiple cloning sites BstEII and BglII of the backbone vector. The host bacteria of the recombinant bacteria preferably include Agrobacterium (Alcaligenes) strain EHA105. The recombinant bacteria are preferably obtained by introducing the recombinant expression vector into Agrobacterium strain EHA105. The introduction method preferably adopts the freeze-thaw method. In an embodiment of the present invention, the recombinant bacteria are genetically transformed into Brassica napus Westar through the cotyledonary node method to obtain BnaXTH22 gene overexpression plants (OEs), and the aluminum toxicity resistance and antioxidant properties of OEs under aluminum toxicity stress are significantly improved compared to WT. The genetic transformation was entrusted to Wuhan Boyuan Biotechnology Co., Ltd.

[0039] In the present invention, the BnaXTH22 gene, the protein encoded by the BnaXTH22 gene or the derivative of the BnaXTH22 gene preferably improves the plant's tolerance to aluminum toxicity and / or improves the plant's antioxidant capacity through positive regulation.

[0040] In the present invention, the improvement of plant resistance to aluminum toxicity includes improving plant root activity. The improvement of plant root activity preferably includes increasing the relative elongation of the main root and / or increasing the relative total root length. The aluminum toxicity in the aluminum toxicity resistance preferably includes Al 3+ The poisoning caused by the Al 3+ The concentration of Al is preferably 30 to 70 μM, more preferably 40 to 65 μM, and most preferably 60 μM. 3+ At a concentration of , the BnaXTH22 gene, the protein or the derivative of the BnaXTH22 gene can improve the plant's tolerance to aluminum toxicity and / or improve the plant's antioxidant capacity through positive regulation. Root growth and elongation are the result of the synergistic effect of root cell division and cell elongation. The earliest morphological change of crops under aluminum induction is the inhibition of root and tip growth. Root cap cells, meristem cells, elongation cells and root hair cells are the most severely affected parts. Aluminum interferes with the cell division of the root tip and lateral roots by inhibiting the production and transport of cytokinins. Aluminum toxicity stress induces increased accumulation of callose in the root cell plasma membrane to affect the transport of auxin between cells, thereby inhibiting root growth. The results of the examples of the present invention show that, compared with the treatment without aluminum toxicity, the relative elongation (RET) of the main root of rapeseed seedlings after aluminum toxicity treatment is extremely significantly reduced, and with the increase of Al 3+As the concentration increased, the RTE of rapeseed seedlings decreased, consistent with Han Depeng's findings that rapeseed RTE gradually decreased under aluminum stress. Furthermore, after treatment with 60 μM AlCl₃, the RTE and relative total root length (RTRL) of OEs were significantly or extremely significantly higher than those of wild-type plants (WT). This indicates that OEs exhibit significantly greater tolerance to aluminum toxicity than WT plants, suggesting that overexpression of the BnaXTH22 gene or its encoded protein enhances plant tolerance to aluminum toxicity.

[0041] In the present invention, the improvement of plant antioxidant capacity preferably includes reducing the malondialdehyde content of the plant and / or reducing the electrical conductivity of the plant. MDA is the end product of membrane lipid peroxidation and can be used to characterize the degree of membrane lipid peroxidation of plant cells; relative electrical conductivity is a basic indicator reflecting the permeability of plant cell membranes and is associated with the antioxidant capacity of plants. The results of the examples of the present invention show that under aluminum toxicity stress, the malondialdehyde content (MDA) content in WT and OEs increased, and the relative electrical conductivity increased; compared with WT, the MDA content of OEs was lower after 7 days of aluminum toxicity stress treatment, and the increase in MDA content was smaller than that at 0h; the increase in relative electrical conductivity (REC) of OEs after 7 days of treatment was smaller than that at 0h, and the REC of OEs was lower or significantly lower than that of WT; the root activity of WT after 7 days of treatment was lower or significantly lower than that of OEs. It can be seen that OEs suffered less damage, further indicating that overexpression of BnaXTH22 or its encoded protein improves the antioxidant capacity of plants.

[0042] In one embodiment of the present invention, transcriptome sequencing of plants overexpressing BnaXTH22 under different treatments was further performed. The results showed that under aluminum toxicity treatment, DEGs (Differentially Expressed Genes) were mainly involved in adverse biological processes such as phenylpropanoid metabolism, fatty acid biosynthesis, lignin biosynthesis, and phenylpropanoid biosynthesis, which is beneficial to enhancing the aluminum toxicity tolerance and antioxidant capacity of plants overexpressing BnaXTH22.

[0043] The present invention provides a method for improving the aluminum toxicity resistance and / or antioxidant ability of plants, and overexpresses the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene in plants.

[0044] In the present invention, the method for overexpression in plants preferably genetically transforms the recombinant bacteria described in the above technical solution into plants. The present invention does not particularly limit the method for genetic transformation, and conventional genetic transformation methods in the art can be used. In an embodiment of the present invention, the genetic transformation is completed by Wuhan Boyuan Biotechnology Co., Ltd. In an embodiment of the present invention, the recombinant bacteria are genetically transformed into Brassica napus Westar through the cotyledonary node method to obtain BnaXTH22 gene overexpressing plants (OEs), and the aluminum toxicity resistance and antioxidant properties of OEs under aluminum toxicity stress are significantly improved compared to WT.

[0045] The present invention provides a method for identifying the aluminum toxicity resistance and / or antioxidant ability of a plant, which comprises detecting the relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene in the plant, and judging the aluminum toxicity resistance and / or antioxidant ability of the plant based on the relative expression level: the relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene is positively correlated with the aluminum toxicity resistance and / or antioxidant ability of the plant.

[0046] In the present invention, the reagent for detecting the relative expression level of the BnaXTH22 gene includes the forward primer set forth in SEQ ID NO: 1 and the reverse primer set forth in SEQ ID NO: 2. The reagent for detecting the relative expression level of the BnaXTH22 gene preferably also includes an internal reference gene primer. The internal reference gene primer preferably includes the forward primer set forth in SEQ ID NO: 6 and the reverse primer set forth in SEQ ID NO: 7. The reaction system for detecting the relative expression level of the BnaXTH22 gene preferably includes the following components: 0.8 μl of a 10 μM forward primer, 0.8 μl of a 10 μM reverse primer, 2.0 μl of a 15 ng / μl DNA template, 10.0 μl of 2×PCR Mix, and DEPC-treated water to a volume of 20.0 μl. The reaction procedure for detecting the relative expression level of the BnaXTH22 gene preferably includes pre-denaturation at 94°C for 3 min, followed by 40 cycles of denaturation at 94°C for 15 s and annealing at 60°C for 30 s, followed by a melting curve at 60°C to 95°C. The reaction system and the reaction procedure can accurately detect the relative expression level of the BnaXTH22 gene.

[0047] In the present invention, the plant preferably includes a plant of the family Brassicaceae. The plant of the family Brassicaceae preferably includes at least one of the genera Brassica oleracea, Brassica juncea, Brassica napus, and Brassicaceae, and more preferably includes the genus Rapeseed. The genus Rapeseed preferably includes Brassica napus.

[0048] In order to further illustrate the present invention, the solutions provided by the present invention are described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0049] Example 1

[0050] Method for constructing plants overexpressing BnaXTH22

[0051] 1. CDS cloning of BnaXTH22

[0052] 1.1 Total RNA extraction and reverse transcription

[0053] Thirty plump seeds of the resistant Brassica napus cultivar R178 were cleaned and floated and sown on gauze in square plastic basins filled with pure water. Seven days later, when the cotyledons were fully expanded but the lateral roots had not yet differentiated from the main root, 30 seedlings of each material with relatively uniform growth were selected. Without damaging the roots, they were first transferred to square basins containing 1 / 4 modified Hoagland's nutrient solution for 3 days of seedling hardening. Then, they were transferred to 1 / 2 modified Hoagland's nutrient solution for 3 days of seedling hardening. After 3 days, aluminum toxicity was assessed: plants were removed from the nutrient solution and transferred to a 0.5 mM CaCl₂ aqueous solution (pH = 4.5) for 24 hours of seedling hardening. They were then transferred to a 0.5 mM CaCl₂ aqueous solution (pH = 4.5) containing 150 μM AlCl₃. Six hours after treatment, the rapeseed roots were wrapped in tin foil and quickly frozen in liquid nitrogen. Three biological replicates were performed.

[0054] The light and temperature conditions during the culture period were: 25°C-14h / 20°C-10h (day / night). The modified Hoagland nutrient solution was from Beijing Coolabo Technology Co., Ltd. (Coolabo, China), and the nutrient solution preparation method was referred to its instructions.

[0055] Total RNA from three samples was extracted using the MiniBEST PlantRNAExtractionKit (TaKaRa, Japan) according to the instructions. 2 μl of RNA was collected and tested for integrity using 2.0% agarose gel electrophoresis, and 1 μl was collected and tested for total RNA concentration using an ultra-micro nucleic acid protein analyzer P330 (IMPLEN, Germany) to obtain high-quality total RNA. Figure 1 As shown, the 28S and 18S bands of the three biological replicates were all bright, but the second replicate (lane 2) was relatively more complete and clear. The total RNA of the second replicate was selected for mRNA isolation and reverse transcription.

[0056] Using PrimerScript TM cDNA was synthesized using the RTMasterMix kit (TaKaRa, Japan) for reverse transcription. The synthesis method was described in the manufacturer's instructions. PCR amplification was performed using the cDNA as a template using a forward primer and a reverse primer containing dual restriction enzyme sites. The forward primer had a BstE II restriction site (GGTNACC) at its 5' end, and the nucleotide sequence of the forward primer was 5'-ATGCAGATGAAACTCGTCCCT-3' (SEQ ID NO: 4). The reverse primer had a Bgl II restriction site (AGATCT) at its 5' end, and the nucleotide sequence of the reverse primer was 5'-CTATGCAGCAAAGCACTCTTTA-3' (SEQ ID NO: 5). The PCR amplification system and reaction procedure are shown in Table 1.

[0057] Table 1 PCR amplification system and procedure

[0058]

[0059] The PCR products were separated by 1.0% agarose gel electrophoresis. The fragment size was consistent with the expectation (fragment length 658 bp, of which the gene size was 645 bp, and the primers introducing the restriction sites of BstEⅡ and BglII totaled 13 bp). The products were recovered using an agarose gel recovery kit (Tiangen, China) according to the instructions.

[0060] 1.2Terminal modification of BnaXTH22 and its T-vector ligation

[0061] A single base "A" was added to the end of the PCR product using the DNA A-Tailing Kit (TaKaRa, Japan). The "A"-added product was purified using SV Gel and PCR Clean-Up System (Promega, USA), and the purified product was ligated to a T-vector using pGEM_T EasyVector Systems (Promega, USA). The "A"-added product, product purification, and T-vector ligation procedures were all performed according to the manufacturer's instructions.

[0062] 1.3 Transformation of E. coli competent cells and PCR detection of positive clones

[0063] The T-vector ligation product of BnaXTH22 was transformed into Escherichia coli competent cells. The transformation procedure was as follows: 8 μl of the T-vector ligation product of BnaXTH22 was added to 100 μl of Escherichia coli competent cells DH5α (TaKaRa, Japan), and the mixture was placed on ice for 30 min; heat-shocked in a 42°C water bath for 60 s; allowed to stand on ice for 10 min; 800 μl of SOC liquid culture medium was added and cultured on a constant temperature shaker at 37°C and 180 rpm for 60 min; centrifuged at 12,000 rpm for 1 min at room temperature; the supernatant was discarded, and the resuspended Escherichia coli competent cells were spread on LB solid culture medium containing ampicillin (Amp), X-Gal and TPTG, and cultured in an inverted manner at 37°C for 16 to 18 h (overnight).

[0064] Add 10 g of tryptone, 5 g of yeast extract, and 10 g of NaCl per liter of LB liquid culture medium, and make up the rest with ultrapure water. Use NaOH to adjust the pH of the liquid culture medium to a pH suitable for the growth of E. coli, that is, pH = 7.4. For LB solid culture medium, add 15 g to 20 g of agar powder to the LB liquid culture medium formula. Sterilize the solid and liquid culture media with high-temperature steam at 121°C for 20 min.

[0065] Single white colonies were picked from the plates and added to 400 μl of SOC liquid medium. The cells were then incubated on a shaker at 37°C, 180 rpm, for 4 hours. PCR was performed using the T-vector universal primers RV-M and M13-47, using the cultured bacterial broth as a template. PCR products were analyzed by 2.0% agarose gel electrophoresis. Twenty positive clones with the expected size were sent for sequencing at Shanghai Bioengineering. The resulting sequences were aligned with the CDS sequence of BnaXTH22.

[0066] The size of the CDS cloned PCR product of BnaXTH22 was 645 bp ( Figure 2 ), and the size was consistent with the expected value. Agarose gel electrophoresis confirmed that the fragment (BnaXTH22 CDS) matched the expected size. This fragment was recovered, amplified with "A," ligated with a T vector, and transformed into E. coli. PCR-positive single colonies were detected, and product sequencing was consistent with the CDS sequence of BnaXTH22, resulting in a positive single white colony.

[0067] 2. Construction of BnaXTH22 overexpression vector

[0068] The plasmids of positive white single colonies and the basic overexpression vector pCAMBIA1301 (Biovector, China) containing BstEII and BglII restriction sites were extracted and double-enzyme digested. The digestion products were detected and separated by 1.0% agarose gel electrophoresis. The fragment sizes were consistent with the expectations. The target fragments were recovered using an agarose gel recovery kit (Tiangen, China). The size of BnaXTH22 was 645 bp, and the size of pCAMBIA1301 was 9795 bp.

[0069] The enzyme digestion system for 50.0 μl is as follows: 37.0 μl of plasmid, 4.0 μl of BstEⅡ, 4.0 μl of BglII, and 5.0 μl of 10× buffer. Digest at 37°C for 2 hours and then at 4°C overnight.

[0070] Ligate the BnaXTH22 double-digested product recovered by gel electrophoresis with the pCAMBIA1301 double-digested product using T4 ligase. A 15 μl ligation system is as follows: 9.5 μl of BnaXTH22 recovered product, 2.0 μl of pCAMBIA1301 plasmid recovered product, 2.0 μl of T4 ligase, and 1.5 μl of 10× buffer. Digest at room temperature (22°C–28°C) for 2 hours and then at 4°C overnight.

[0071] After the ligation reaction is completed, 1.5ul of the ligation product is taken to transform the competent cells of Escherichia coli, and the cells are inverted and cultured at 37°C on LB solid medium containing Kan resistance for 16h to 18h, and single clones are selected for re-culture. The culture solution is used as a template, and PCR detection is performed with the forward primer shown in SEQ ID NO: 4 and the reverse primer shown in SEQ ID NO: 5. The PCR system and procedure refer to Table 1. The product size is 645bp. 2.0% agarose gel electrophoresis is used to determine whether the insertion of the basic vector is in line with expectations. The expected colonies are sent to Shanghai Biotechnology for sequencing. The sequencing is consistent with the CDS sequence of BnaXTH22, and the overexpression recombinant vector pCAMBIA1301-BnaXTH22 ( Figure 3 ).

[0072] 3. BnaXTH22 Genetic Transformation

[0073] The overexpression recombinant vector pCAMBIA1301-BnaXTH22 was introduced into Agrobacterium tumefaciens EHA105 using the freeze-thaw method to generate recombinant Agrobacterium tumefaciens EHA105 / pCAMBIA1301-BnaXTH22. Recombinant Agrobacterium tumefaciens EHA105 / pCAMBIA1301-BnaXTH22 was genetically transformed into Brassica napus Westar via the cotyledonary node method. Transformation was performed by Wuhan Boyuan Biotechnology Co., Ltd.

[0074] 4. Detection of relative expression of BnaXTH22 in plants overexpressing BnaXTH22

[0075] The primers TGACGTAAGGGATGACGCAC (SEQ ID NO: 8) and TGGGAGTTCCATCGACTGTG (SEQ ID NO: 9) were used to detect T0 by PCR. The detection system and detection procedure are shown in Table 2. The detection results of transgenic plant T0 are shown in Table 2. Figure 4 As shown, the product size was 372 bp, which was in line with expectations. Among the 9 tested samples, 8 plants were positive.

[0076] Table 2 Positive detection PCR amplification system and procedure

[0077]

[0078] T1 seeds from T0-positive transgenic (overexpressing) plants were harvested, T1 seeds were self-pollinated to harvest T2 seeds, T2 seeds were self-pollinated to harvest T3 seeds, and overexpressing plants were isolated and cultivated. Three strains (OE-2, OE-4, and OE-6) and WT were randomly selected from the T3 seeds and hydroponically cultured using the same method as in Example 1.

[0079] The expression level of BnaXTH22 in the treated T3 hydroponic seedlings was detected by qRT-PCR. The total RNA of 24 samples was extracted using MiniBEST Plant RNA Extraction Kit (TaKaRa, Japan), and the extraction method was referred to its instructions. 2 μl was aspirated to detect the integrity of RNA using 2.0% agarose gel electrophoresis, and 1 μl was aspirated to determine the total RNA concentration using the ultra-micro nucleic acid protein analyzer P330 (IMPLEN, Germany) to obtain high-quality total RNA. PrimerScript TM The first strand of cDNA was synthesized by reverse transcription using the RT Master Mix Kit (TaKaRa, Japan). The synthesis method was described in the manufacturer's instructions. The target gene BnaXTH22 was selected for real-time fluorescence quantitative PCR (qRT-PCR) validation. To verify the reliability of the candidate gene, qRT-PCR primers spanning the gene intron were designed using the online software Primer-BLAST (http: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). The product length was 120 bp to 250 bp. The reference gene ACT7 was used as the internal reference gene for normalization, and 2 -△△Ct Relative expression levels were determined using the qRT-PCR method, with three technical replicates performed for each candidate gene and reference gene. The nucleotide sequences of qRT-PCR primers and PCR product sizes are shown in Table 3, and the qRT-PCR amplification system and procedure are shown in Table 4. All primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as Shanghai Sangon).

[0080] Table 3 qRT-PCR primer sequences

[0081]

[0082] Table 4 qRT-PCR amplification system and procedure

[0083]

[0084] The results of the BnaXTH22 expression level test in the overexpression plants are as follows Figure 5 As shown, the relative expression levels of BnaXTH22 in leaves and roots of OEs (OE-2, OE-4, and OE-6) of BnaXTH22-overexpressing plants were upregulated by 2.47 to 6.64 times compared with WT, indicating that BnaXTH22-overexpressing plants were successfully created.

[0085] Example 2

[0086] Phenotypic characterization and antioxidant physiological index determination of plants overexpressing BnaXTH22

[0087] 1. Effects of aluminum toxicity stress on seedling root phenotypes

[0088] WT and overexpressing plants (OE-2, OE-4, and OE-6) were used as materials and hydroponically cultured according to the method of Example 1. A 0.5 mM CaCl2 aqueous solution (pH = 4.5) without AlCl3 was used as a control. The experimental group was treated with a 0.5 mM CaCl2 aqueous solution (pH = 4.5) containing 60 μM AlCl3 (screened AlCl3 concentration). Phenotypic identification was performed for 7 days. The pH of the solution was maintained at 4.5 with 1 mM NaOH or 1 mM HCl every 2 days. The taproot lengths of WT, OE-2, OE-4, and OE-6 were measured before and after the treatment. The relative elongation of taproot (RET) of each plant was calculated according to Formula I. The root systems of WT, OE-2, OE-4, and OE-6 were scanned using a RhizoScan in situ root scanner (Regent, Canada). The total root lengths of WT, OE-2, OE-4, and OE-6 after the treatment were calculated according to Formula I, and the relative total root length (RTRL) was calculated according to Formula II.

[0089] Relative elongation of taproot (RET) = elongation of taproot of treatment / elongation of taproot of control Formula I;

[0090] Relative total root length (RETL) = total root length of treatment / total root length of control Formula II.

[0091] Under the condition of 60 μM AlCl3 treatment, the RTE of WT was 0.593, and the RTEs of OE-2, OE-4 and OE-6 were 0.649, 0.672 and 0.657, respectively, which were 9.44%, 13.32% and 10.79% higher than that of WT, respectively. There was no statistically significant difference in RTE among the OE groups, but all of them were significantly or extremely significantly higher than that of WT ( Figure 6 and Figure 7 The RTRLs of OE-2, OE-4, and OE-6 were 0.781, 0.749, and 0.757, respectively, which were 9.78%, 8.15%, and 12.89% higher than the WT RTRL (0.675). There were no statistically significant differences in RTRL between the OE groups, but all were significantly or extremely significantly higher than the WT, similar to the RTE. Furthermore, both the WT and OEs showed a RTRL greater than the RTE, indicating that aluminum toxicity was more inhibitory to the primary root than to the lateral root.

[0092] 2. Effects of aluminum toxicity stress on antioxidant capacity of seedling roots and leaves

[0093] Hydroponics was performed according to the method of Example 1, with treatment using 60 μM AlCl₃. Root and leaf samples were collected from WT and overexpressing plants (OE-2, OE-4, and OE-6) at 0 h, 6 h, 24 h, and 7 days after treatment. Root and leaf physiological indicators, including malondialdehyde (MDA) content and relative electrical conductivity (REC), were measured. Root activity was also measured in the roots. Physiological indicators were measured using kits from Suzhou Gress Biotechnology Co., Ltd. Specific instructions for sampling, storage, and measurement were followed according to the kit instructions.

[0094] The results of malondialdehyde (MDA) content test ( Figure 8 ) showed that there were no significant differences in MDA content among the OEs treatments, with MDA content in leaves higher than in roots. In the roots, MDA content in both WT and OEs initially increased and then decreased with prolonged treatment time, reaching its highest level at 24 hours of treatment. Seven days after treatment, MDA content increased by 11.43% and 9.52%, respectively, compared to 0 hours. Furthermore, MDA content in WT was significantly higher than that in OEs at 24 hours and 7 days. In leaves, MDA content in both WT and OEs increased with prolonged treatment time. Similarly, MDA content in WT was higher or significantly higher than that in OEs at 24 hours and 7 days after treatment. This indicates that aluminum toxicity increases MDA content, and at 7 days after treatment, MDA content in OEs was lower or significantly lower than that in WT.

[0095] The relative conductivity (REC) test results ( Figure 9 ) showed that there were no significant differences in REC among the OEs (OE-2, OE-4, and OE-6) treatments. However, REC in both the WT and OEs increased with treatment duration, reaching its highest level at 7 days. The REC in roots was higher than that in leaves. In roots, the REC in the WT was significantly higher than that in the OEs at 7 days. In leaves, the REC in the WT was higher or significantly higher than that in the OEs at 24 hours and 7 days after treatment. This indicates that aluminum toxicity increases REC, and the REC in the OEs was significantly lower than that in the WT at 7 days after treatment.

[0096] The root activity test results ( Figure 10 ) showed that there was no significant difference in root activity among the OEs treatments. As the treatment time prolonged, the root activity of WT and OEs decreased. Compared with the treatment at 0 h, the root activity of WT and OEs decreased by 29.93% and 16.61% after 24 h treatment, and decreased by 38.35% and 20.68% after 7 d treatment, respectively. The root activity of OEs was significantly higher than that of WT at 24 h and 7 d treatment.

[0097] Example 3

[0098] Overexpression transcriptome analysis - analysis of differentially expressed genes between WT and OE-2 treated at different times

[0099] 1. Sample Preparation

[0100] WT and OE-2 rapeseed plants were hydroponically cultured according to the method described in Example 1, treated with 60 μM AlCl₃. Three biological replicates were set up. Roots of rapeseed plants were collected at 0 and 24 hours after treatment, wrapped in tin foil, and quickly frozen in liquid nitrogen. A total of 18 samples were stored in a -80°C freezer until needed. The taproot length of WT and OE-2 plants was measured before and 24 hours after treatment to assess the RET index.

[0101] The root phenotypic results showed that the relative elongation of the main root of WT and OE-2 decreased under aluminum toxicity stress. After treatment with 60μMAlCl3 for 24h, the RTE of WT and OE-2 were 0.621±0.034 and 0.533±0.042, respectively. The RTE of OE-2 was increased by 15.23% compared with WT, and reached a significant level.

[0102] 2. Transcriptome Sequencing

[0103] The samples were sent to Shenzhen Micro-Technology Group Co., Ltd. for quality testing, library construction, and sequencing. The quality of the original paired-end sequence reads was evaluated, clean reads were obtained by filtering, and alignment analysis was performed with the reference genome Brassica_napus_v4.1 sequence.

[0104] RNA-seq sample output data: Whole genome resequencing of 12 samples of WT and OE-2 was performed using high-throughput sequencing technology, generating a total of 7.75×10 8 reads, 1.16×10 11 bases, of which clean reads were 7.70×10 8 , accounting for 99.43% of the total reads, and the number of effective bases was 1.10×10 11 , accounting for 95.01% of the total bases, and 9 WT samples generated 3.94×10 8 reads, 9 OE-2 samples generated 3.76×10 8 Reads were mapped to the reference genome, and the alignment results showed that there were 6.94×10 8 cleanreads (accounting for 90.15% of clean reads) were successfully mapped to the reference genome, and the data of each sample alignment were within 3.50×10 7 ~4.45×10 7 The sequencing data quality was high (Q30 ≥ 92.45%) (Table 5).

[0105] Table 5 RNA-seq sample output data statistics

[0106]

[0107]

[0108] 3. Screening of Differentially Expressed Genes

[0109] Gene expression has spatiotemporal specificity, and there are differences in gene expression levels under two different treatments (environments). The present invention analyzes the DEGs between different materials (WT and OE-2) at the same time, uses the TPM data of the samples to calculate the correlation coefficient between the two samples, and evaluates the repeatability of the biological experiment within the sample group. The FPKM (Fragments per kilobase of transcript per million fragments mapped, FPKM) method is used to calculate the index of transcript or gene expression level. The standard for screening DEGs in the present invention is that the ratio difference of the expression amount between the two samples (groups) is ≧1, that is, |log2(FlodChange, FC)| ≧1, and the Benjamini-Hochberg correction method is used to correct the significant p-value (p-value). Finally, the false discovery rate (False Discovery Rate, FDR) is used as the key indicator for screening DEGs, that is, FDR < 0.01.

[0110] Sample reproducibility analysis: The correlation coefficients of two samples were calculated by TPM expression. The correlation coefficients of samples within the group were ≥ 0.9, and the correlation coefficients of samples between groups were ≥ 0.89. However, the correlation coefficients of samples within the group were generally higher than those between groups ( Figure 11 ), indicating that the biological experiments within the sample group had good repeatability.

[0111] Statistics of differentially expressed genes between treatments at different times: DEGs in the two comparison groups of OE-2 vs WT at different treatment times (0 h and 24 h) were statistically identified. After screening by |log2FC|≧1.0, p<0.05, and FDR<0.01, there were 4877 DEGs in the two comparison groups of OE-2 vs WT at 0 h and 24 h, of which 2197 DEGs were up-regulated and 2680 DEGs were down-regulated ( Figure 12 Middle A). At 0 h treatment, there were 3827 DEGs in OE-2 vs WT, 1737 DEGs were up-regulated, and 2090 DEGs were down-regulated; at 24 h treatment, there were 1310 DEGs in OE-2 vs WT, 565 DEGs were up-regulated, and 745 DEGs were down-regulated. There were 260 DEGs that were differentially expressed at both 0 h and 24 h between OE-2 vs WT ( Figure 12 Middle B).

[0112] GO enrichment analysis of differentially expressed genes between different time treatments: GO enrichment analysis of 3827 DEGs of WT and OE-2 at 0h showed that these DEGs were involved in a variety of biological processes, including DNA-dependent DNA replication, DNA replication, water transport, and liquid transport. Under the condition of aluminum poisoning for 24h, they were mainly involved in adverse biological processes such as phenylpropanoid metabolism, fatty acid biosynthesis, lignin biosynthesis, and phenylpropanoid biosynthesis ( Figure 13 and Figure 14 ).

[0113] Pathway enrichment analysis of WT and OE-2 at 0 h showed that these DEGs were significantly enriched in arginine and proline metabolism, arginine biosynthesis, and purine metabolism, while under aluminum toxicity treatment for 24 h, they were significantly enriched in alanine, aspartate and glutamate metabolism, arginine biosynthesis, arginine and proline metabolism, etc. Figure 15 and Figure 16 ).

[0114] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. Other embodiments can be obtained based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A use of a BnaXTH22 gene, a protein encoded by the BnaXTH22 gene, or a derivative of the BnaXTH22 gene in at least one of the following: regulating plant tolerance to aluminum toxicity and / or antioxidant properties and cultivating plant varieties that are resistant to aluminum toxicity and / or antioxidant properties.

2. The application according to claim 1, characterized in that The BnaXTH22 gene, the protein encoded by the BnaXTH22 gene or the derivative of the BnaXTH22 gene improves the plant's tolerance to aluminum toxicity and / or improves the plant's antioxidant capacity through positive regulation.

3. The application according to claim 2, characterized in that: The improving of plant resistance to aluminum toxicity includes improving plant root activity.

4. The application according to claim 2, characterized in that: The improving of plant antioxidant capacity includes reducing plant malondialdehyde content and / or reducing plant electrical conductivity.

5. The application according to claim 1, characterized in that: The derivatives of the BnaXTH22 gene include a recombinant expression vector containing the BnaXTH22 gene or a recombinant bacterium containing the BnaXTH22 gene.

6. The application according to claim 5, characterized in that The backbone vector of the recombinant expression vector includes pCAMBIA1301; The host bacteria of the recombinant bacteria include Agrobacterium (Alcaligenes) strain EHA105.

7. A method for improving the aluminum toxicity and / or antioxidant capacity of plants, characterized in that: The BnaXTH22 gene or the protein encoded by the BnaXTH22 gene is overexpressed in the plant.

8. A method for identifying the ability of a plant to resist aluminum toxicity and / or antioxidant activity, characterized in that: The relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene in the plant is detected, and the plant's resistance to aluminum toxicity and / or antioxidant ability is judged based on the relative expression level: the relative expression level of the BnaXTH22 gene or the protein encoded by the BnaXTH22 gene is positively correlated with the plant's resistance to aluminum toxicity and / or antioxidant ability.

9. The method according to claim 8, characterized in that The reagent for detecting the relative expression level of the BnaXTH22 gene includes a forward primer shown in SEQ ID NO: 1 and a reverse primer shown in SEQ ID NO:

2.

10. The method according to any one of claims 7 to 9, characterized in that: The plants include plants of the family Brassicaceae.

Images