OsSULTR2, OsSULTR2; application of 2 protein and coding gene thereof in regulating and controlling salt tolerance of rice

By reducing the content and activity of OsSULTR2;2 protein in rice and using CRISPR/Cas9 vector to perform gene knockout, the problem of regulating rice salt tolerance was solved and the growth and yield of rice under salt stress were improved.

CN120624540AActive Publication Date: 2025-09-12NATIONAL TECHNOLOGY INNOVATION CENTER FOR SALT-ALKALI TOLERANT RICE AT SANYA +1

Patent Information

Application Number
CN202511129857.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-13
Publication Date
2025-09-12
Estimated Expiration
2045-08-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively regulate the salt tolerance of rice, which affects its growth and yield.

Method used

By reducing the content and/or activity of OsSULTR2;2 protein in rice, gene knockout technology is performed using CRISPR/Cas9 vectors to inhibit the expression of the OsSULTR2;2 gene and regulate the salt tolerance of rice.

Benefits of technology

Significantly improve the salt tolerance of rice and enhance its growth and yield under salt stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624540A_ABST
    Figure CN120624540A_ABST
Patent Text Reader

Abstract

The invention relates to the field of rice gene engineering, and particularly provides OsSULTR2; the invention also discloses application of the 2 protein and the coding gene thereof in regulating and controlling the salt tolerance of rice. The protein meets the following conditions: B1) a protein with an amino acid sequence of SEQ ID NO.1; and B2) a fusion protein with the same function obtained by connecting a tag to the N end and / or C end of B1). The method is used for detecting OsSULTR2; the salt stress phenotype identification in the seedling stage is carried out on the transgenic rice with the gene knockout 1, 2, and the result shows that when the gene segment is deleted, the salt stress tolerance of the rice is improved, and the function and the application way of the gene are proved. Therefore, the OsSULTR2 of the present invention; the 2 protein and the coding gene thereof can regulate and control the salt tolerance of rice, and have important significance for cultivating salt-tolerant transgenic rice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of rice genetic engineering, and in particular relates to the application of OsSULTR2;2 protein and its encoding gene in regulating the salt tolerance of rice. Background Art

[0002] Plants are subject to numerous abiotic stresses during their growth. Soil salinization, among them, not only restricts the range of rice growth but also reduces rice yield and quality. Rice is a staple food for 65% of my country's population. Approximately 99 million hectares of saline-alkali land are salinized, of which only 20% is suitable for cultivation. This leaves significant room for reclamation and improvement of saline-alkali land. Therefore, identifying salt-tolerant genes, studying the mechanisms of rice salt tolerance, and developing new salt- and alkali-tolerant rice varieties are crucial for increasing rice yields in saline-alkali land.

[0003] The most obvious harm of soil salinization to rice is the inhibition of its growth and development, primarily affecting seed germination, the seedling stage, and the reproductive stage. Under salt stress conditions, rice seed germination is hindered primarily due to osmotic and ion toxicity, which restrict the seeds' physiological water uptake and disrupt the membrane structure, thereby inhibiting seed germination. Rice is sensitive to salt stress during the seedling stage, manifesting as significant inhibition of root growth, death of older leaves, and chlorosis. Salt stress is most severe in rice leaves during the tillering stage, manifested by a decrease in chloroplast number, reduced leaf area, and suppressed photosynthesis. During the panicle initiation stage, salt stress significantly reduces panicle length, the number of primary branches, the number of spikelets, and grain size, impacting rice yield and quality. Furthermore, salt stress severely shortens the stalk and panicle during the heading stage, significantly affecting the number of effective panicles and 1000-grain weight. During the grain filling and fruiting period, salt stress will lead to insufficient photosynthetic products, hindered panicle differentiation, decreased fruit setting rate, and delayed maturity, resulting in reduced rice yield and quality.

[0004] The salt stress tolerance mechanism of rice mainly includes four aspects: osmotic regulation, ion balance regulation, hormone regulation and antioxidant regulation. Many salt-tolerant genes involved in these regulatory mechanisms have been identified in rice. Salt stress can induce the expression of osmotic regulation substance biosynthesis genes. When overexpressed in rice, OsP5CS1, OsRPK1 and OsTPP1 When the gene is expressed, the content of proline and trehalose in rice plants will increase or decrease, thus affecting their salt tolerance. In the process of regulating the salt tolerance of rice ion balance, it is mainly through Na + or K + transporter (HKT), K + transporter (HAK), Na + / H + Antiporters NHX, SOS1, and Ca 2+Ion response mechanisms mediated by channel proteins to clear excess Na + Or maintain ion homeostasis to avoid toxicity. Similarly, some hormone-responsive transcription factors play a vital role in regulating salt stress in rice, such as OsABAR1 In addition, the antioxidant system of rice also plays an important role in improving the tolerance of rice to salt stress. Overexpression of antioxidant enzyme functional genes OsMn-SOD1 、 OsCu / Zn-SOD, OsGR3 and OsGRX8 and antioxidant enzyme regulatory genes OsZFP213 、 OsMYB2 Can resist damage caused by salt stress.

[0005] Salt tolerance in rice is a complex quantitative trait, and breeding salt-tolerant rice varieties using traditional breeding methods is a lengthy process. However, using modern breeding techniques, identifying key salt-tolerance genes in rice, or transferring homologous genes from other crops into rice, elucidating their physiological and molecular mechanisms, and applying these mechanisms to practical breeding are crucial for fully utilizing saline-alkali land and ensuring national food security. Summary of the Invention

[0006] The technical problem to be solved by the present invention is how to regulate the salt tolerance of rice (e.g., increase or decrease the salt tolerance of rice). The technical problem to be solved is not limited to the technical subject matter described herein. Other technical subjects not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions: A first aspect of the present invention provides an application for reducing protein content and / or activity, wherein the application is any one of the following: A1) Application in improving salt tolerance of rice; A2) Application in the preparation of products for improving salt tolerance of rice; A3) Application in breeding salt-tolerant rice; A4) Use in the preparation of products for breeding salt-tolerant rice; A5) Application in salt-tolerant rice breeding or improvement of salt-tolerant rice germplasm resources; The protein is named OsSULTR2;2 and meets the following conditions: B1) a protein having the amino acid sequence of SEQ ID NO. 1; or B2) a fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1).

[0008] In the above application, the protein OsSULTR2;2 can be derived from rice.

[0009] Furthermore, the protein OsSULTR2;2 may be the rice salt tolerance-related protein OsSULTR2;2.

[0010] In order to facilitate purification or detection of the protein in B1), a tag protein may be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing.

[0011] The tag protein includes but is not limited to: GST (glutathione sulfhydryl transferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0012] The second aspect of the present invention provides the use of biomaterials related to the protein OsSULTR2;2, wherein the use is any of the following: D1) Application in improving salt tolerance of rice; D2) Application in the preparation of products for improving salt tolerance of rice; D3) Application in breeding salt-tolerant rice; D4) Use in the preparation of products for breeding salt-tolerant rice; D5) Application in salt-tolerant rice breeding or improvement of salt-tolerant rice germplasm resources; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing E3) a recombinant microorganism containing the recombinant vector; E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

[0013] In the above application, the nucleotide sequence of the gene encoding the protein OsSULTR2;2 (CDS) is the nucleotide sequence shown in SEQ ID NO. 2.

[0014] The third aspect of the present invention provides a method for cultivating salt-tolerant plants, which comprises reducing the content and / or activity of the protein OsSULTR2;2 in the target plant to obtain a salt-tolerant plant having higher salt tolerance than the target plant, wherein the plant is rice.

[0015] In the above method, reducing the content and / or activity of the protein OsSULTR2;2 in the target plant is achieved by reducing the expression level of the gene encoding the protein OsSULTR2;2 in the target plant.

[0016] In the above method, reducing the expression level of the gene encoding the protein in the target plant is to use gene knockout technology to reduce the expression level of the gene encoding the protein OsSULTR2;2 in the genome of the target plant.

[0017] In the above method, the gene knockout technology is used to reduce the expression level of the gene encoding the protein OsSULTR2;2 in the genome of the target plant by using a CRISPR / Cas9 vector. The CRISPR / Cas9 vector is a recombinant vector constructed based on the dual target sites sgRNA1 (SEQ ID NO. 5): GCCAAGCTGGACCCTCAGTATGG and sgRNA2 (SEQ ID NO. 6): ACGCCGTCATGGGGACGTCGCGG of the encoding gene.

[0018] The present invention has the beneficial effects: The OsSULTR2;2 protein and its encoding gene, first proposed in this invention, can regulate salt tolerance in rice. By reducing the content and / or activity of the OsSULTR2;2 protein in target plants (e.g., by inhibiting, silencing, or interfering with the expression of the OsSULTR2;2 gene), the salt tolerance of target plants can be significantly improved. Therefore, the rice salt tolerance-related protein OsSULTR2;2 and its encoding gene have important theoretical and practical significance in regulating rice salt tolerance, and this invention is of great significance for the development of salt-tolerant transgenic rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 for OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1 and ko-OsSULTR2;2-2 )middleOsSULTR2;2 The mutation site of the gene and the sequences on both sides.

[0020] Figure 2 The wild type Zhonghua11 (WT) and OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1 and ko-OsSULTR2;2-2 ) seedling phenotypes under salt stress.

[0021] Figure 3 The wild type Zhonghua11 (WT) and OsSULTR2;2 Gene mutants ( ko-OsSULTR2;2-1 and ko- OsSULTR2;2-2 ) Seedling survival rate under salt stress. DETAILED DESCRIPTION

[0022] The following examples define the present invention and describe the invention in the construction of OsSULTR2;2 The CRISPR mutant material was used to identify its genotype to obtain a homozygous mutant, and the salt stress phenotype was identified at the seedling stage. According to all or part of the implementation steps described below, those skilled in the art can determine the basic characteristics of the present invention, and without departing from the spirit and scope of the present invention, various changes and modifications can be made to the present invention to make it suitable for different uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the field; the reagents or materials, unless otherwise specified, are all derived from commercial channels.

[0023] Example 1: Rice OsSULTR2;2 Cloning of gene coding region sequences (CDS) Using the cDNA of the aerial part of rice cultivar Zhonghua 11 seedlings as template, the primer pair consisting of Primer1 and Primer2 was used to amplify the gene OsSULTR2;2 The CDS fragment was amplified by PCR.

[0024] Primer1:5'-ATGGAGGACACGGCGGCGGCGGTC-3' (SEQ ID NO.3); Primer2:5'-TCAGCATTCCAGAGCAGTGCCCTT-3' (SEQ ID NO. 4).

[0025] The PCR reaction system (50 μL) consisted of 1 μL template cDNA (200 ng / μL), 1.5 μL Primer 1 (10 μM), 1.5 μL Primer 2 (10 μM), 5 μL 10× PCR Buffer for KOD-Plus-Neo, 5 μL 2 mM dNTPs, 3 μL 25 mM MgSO₄, 1 μL KOD-Plus-Neo (1 U / μL), and 32 μL ddH₂O. PCR amplification was performed in a PCR amplifier. The PCR protocol was as follows: 94°C denaturation for 2 min; 35 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 30 s, and extension at 68°C for 2 min; extension at 68°C for 5 min; and storage at 4°C.

[0026] The PCR product was purified using a DNA purification kit (Nanjing Novozymes Biotechnology Co., Ltd.) and ligated into the pEASY-Blunt expression vector (Beijing Quanshijin Biotechnology Co., Ltd.). The ligation product was transformed into Escherichia coli DH5α competent cells (Baoriyi Biotechnology (Beijing) Co., Ltd.), and positive clones were selected for sequencing (Sangon Biotechnology (Shanghai) Co., Ltd.).

[0027] Sequencing results showed that the PCR amplification OsSULTR2;2 The CDS fragment of the gene has a nucleotide sequence shown in SEQ ID NO. 2, and encodes a protein consisting of 660 amino acid residues shown in SEQ ID NO. 1.

[0028] Example 2: Construction of transgenic plants of the rice gene OsSULTR2;2 mutant one, OsSULTR2;2 Construction of gene knockout vector according to OsSULTR2;2 The genome sequence of the gene (SEQ ID NO.1) was used to design CRISPR-Cas9 sgRNA targets using the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). OsSULTR2;2 The dual target sequences for gene editing vector construction are: GCCAAGCTGGACCCTCAGTATGG (SEQ ID NO. 6) and ACGCCGTCATGGGGACGTCGCGG (SEQ ID NO. 7).

[0029] Based on the target sequence, Primer3 and Primer4, Primer5 and Primer6 were synthesized, and the two pairs of primers were annealed to obtain two double-stranded DNA molecules with sticky ends. The two double-stranded DNA molecules were ligated with BsaI-cleaved pOs-sgRNA linearized vector (the vector construction method is described in the literature "Targeted mutagenesis in rice using CRISPR-Cas system") using T4 DNA ligase. The obtained ligation product was transformed into DH5a Escherichia coli. Positive clones were identified by colony PCR, and plasmids were extracted and sequenced. The sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO.5 and SEQ ID NO.6 was obtained and named pOs-sgRNA- OsSULTR2;2 .

[0030] Primer3: 5'-ggcaGCCAAGCTGGACCCTCAGTATGG-3' (SEQ ID NO.7); Primer4: 5'-aaacCCATACTGAGGGTCCAGCTTGGC-3' (SEQ ID NO.8); Primer5: 5'-ggcaGCCAAGCTGGACCCTCAGTATGG-3' (SEQ ID NO.9); Primer6: 5'-aaacCCATACTGAGGGTCCAGCTTGGC-3' (SEQ ID NO. 10).

[0031] pOs-sgRNA- OsSULTR2;2 Plasmid and CRISPR-Cas9 vector plasmid were PCR amplified according to the corresponding system; PCR reaction system (10 μl) was: H2O 6 μL, CRISPR-Cas9 vector plasmid 2 μL pOs-sgRNA- OsSULTR2;2 1 μL of plasmid and 1 μL of enzyme mix were added, and then mixed on ice. After mixing, the reaction was allowed to react at room temperature (20°C) for 1 hour. Transformation of E. coli: 5 μL of the reaction solution was added to at least 50 μL of competent cells, mixed, and then placed on ice for 30 minutes. Gently remove the cells, heat shock them at 42°C for 60 seconds, and immediately place them on ice for 2 minutes. 500 μL of SOB / LB was added and incubated at 37°C at 200 rpm for 1 hour. An appropriate amount of the bacterial solution was spread on an LB plate containing kanamycin and incubated inverted at 37°C overnight. Positive clones were identified by colony PCR, and plasmids were extracted and sequenced to obtain the plasmid pH-Ubi-cas9- containing the sequences shown in SEQ ID NO.6 and SEQ ID NO.7. OsSULTR2;2 .

[0032] 2. Obtaining recombinant Agrobacterium pH-Ubi-cas9- OsSULTR2;2 Mix with Agrobacterium EHA105 competent cells, incubate on ice for 5 min, and electroporate (1500 V, 5 ms) to OsSULTR2;2 Transformed into Agrobacterium EHA105 competent cells to obtain a recombinant strain, and the correct recombinant strain identified by colony PCR was named EH-pH-Ubi-cas9 -OsSULTR2;2 .

[0033] 3. Obtaining transgenic plants The above recombinant Agrobacterium strain was transformed into the rice variety Nipponbare, and the specific method was as follows: Seed induction: alcohol for 30 seconds, 30% sodium hypochlorite solution for 15 minutes, sterile water 5 times. Wash in the above order, remove excess water and place in induction medium for culture.

[0034] Callus subculture: Use sterile tweezers to remove the young shoots and seeds, retain the mature callus tissue, and place it on the culture medium for further cultivation.

[0035] Agrobacterium activation: Use a 200 μL pipette tip to dip the Agrobacterium liquid, streak on YEP plates, and culture in the dark at 28 degrees for 2 days.

[0036] Agrobacterium infection: Use infection solution to flush the carrier on the plate into a suspension, soak the callus tissue with the suspension for 15 minutes, then transfer the callus to sterile filter paper to absorb excess liquid, place it at 25 degrees, and culture for 3 days.

[0037] Screening culture: Wash the callus after dark culture with water containing carbenicillin, use the air of the clean bench to dry the surface moisture, and then place it on the screening culture medium for screening culture.

[0038] Differentiation and regeneration: The positive particles grown on the screening medium are transferred to the differentiation medium for regeneration.

[0039] Rooting of seedlings: The seedlings grown on the differentiation medium take root in the rooting tubes and undergo root strengthening culture.

[0040] The differentiated rice seedlings are hardened and transferred to the field for growth, and the T0 generation transgenic plants are obtained.

[0041] Example 3: Rice OsSULTR2;2 Molecular identification of gene mutants and transgenic plants The obtained OsSULTR2;2The aboveground part of the seedlings of the T0 generation transgenic plants was sampled, and genomic DNA was extracted as a template. The primers consisting of Primer7 and Primer8 were used to PCR amplify the editing target sites shown in SEQ ID NO.6 and SEQ ID NO.7 and the DNA fragments on both sides.

[0042] Primer7: 5'-GCAGTAACCAGCATAACAGAAAAG-3' (SEQ ID NO. 11); Primer8: 5'-TCTTGTTCGGCTTAACTGTAGTAA-3' (SEQ ID NO. 12).

[0043] The obtained PCR products were detected by 1% agarose gel electrophoresis and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. According to the sequencing results, two OsSULTR2;2 The individual strains with specific gene mutations are: ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 -2, the editing target sites and the DNA sequences on both sides of these two strains are as follows Figure 1 shown.

[0044] in ko- OsSULTR2;2 -1 in a single plant, OsSULTR2;2 The gene has a deletion of four nucleotides (CCTC) in exon 2 and one nucleotide (G) in exon 3; in ko- OsSULTR2;2 -2 in a single plant, OsSULTR2;2 The gene has a deletion of thirteen nucleotides in exon 2 (ACCCTCAGTATGG) and one nucleotide (G) in exon 3; In these two mutant strains OsSULTR2;2 Mutations in the gene CDS sequence all lead to frameshift mutations and premature termination of the encoded protein.

[0045] Embodiment 4: OsSULTR2;2 Identification of salt-tolerance phenotype of gene mutant plants at the seedling stage The two identified in Example 3 OsSULTR2;2 The T0 generation transgenic plants of the gene mutant were self-pollinated for two generations to obtain the homozygous mutant line ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 These two homozygous mutant lines were used together with the wild type of Zhonghua 11 to conduct salt tolerance test at the seedling stage.

[0046] (1) Select plump rice seeds and soak them in tap water in a 37°C incubator for 2 days, followed by germination for 1 day. Select seeds with uniform germination and sow them onto a 96-well PCR plate without a tube bottom. Place them in a blue culture pot filled with tap water and culture them as seedlings in an artificial climate chamber. Culture conditions are: 14 h light (28°C) / 10 h dark (24°C), 100% illumination, and 70% relative humidity. After culturing in tap water for another week, switch to 800× Yoshida rice nutrient solution (three components) for culture.

[0047] (2) When the rice seedlings grew to the three-leaf and one-heart stage, the nutrient solution was replaced with 800× Yoshida rice nutrient solution (three components) containing 8‰ NaCl for salt stress treatment.

[0048] (3) After 14 days of NaCl treatment, rewater the seedlings with 800× Yoshida rice nutrient solution (three components) without NaCl. Seven days later, the survival rate of the rice seedlings was calculated. Survival rate = number of surviving seedlings / total number of treated seedlings × 100%.

[0049] (4) The results of salt tolerance identification are shown in the following table: Compared with the wild type (WT) of Zhonghua 11, the two OsSULTR2;2 Gene mutant strains (ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 -2) The salt damage symptoms such as leaf wilting and drying are relatively mild ( Figure 2 ); After 14 days of salt stress treatment and 7 days of rehydration, ko- OsSULTR2;2 -1 and ko- OsSULTR2;2 The seedling survival rate of -2 line was significantly higher than that of the wild type (WT) ( Figure 3 ).

[0050] The above experimental results show that OsSULTR2;2 The gene has the function of negatively regulating the salt tolerance of rice seedlings. Knocking out this gene can significantly improve the salt tolerance of rice.

[0051] The present invention has been described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0052] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0053] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0054] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0055] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, can be equivalent parameters, concentration and conditions, implement the present invention in a wide range. Although the present invention provides special embodiments, it should be understood that the present invention can be further improved. In a word, by the principle of the present invention, the application is intended to include any variation, purposes or improvements to the present invention, including departing from the disclosed range in the application, and the changes performed with conventional techniques known in the art.

Claims

1. Application for reducing protein content and / or activity, characterized in that, The application is any of the following: A1) Application in improving salt tolerance of rice; A2) Application in the preparation of products for improving salt tolerance of rice; A3) Application in breeding salt-tolerant rice; A4) Use in the preparation of products for breeding salt-tolerant rice; A5) Application in salt-tolerant rice breeding or improvement of salt-tolerant rice germplasm resources; The protein is: B1) a protein having the amino acid sequence of SEQ ID NO. 1; or B2) a fusion protein having the same function obtained by connecting a tag to the N-terminus and / or C-terminus of B1).

2. Use of a biomaterial related to the protein according to claim 1, characterized in that: The application is any of the following: D1) Application in improving salt tolerance of rice; D2) Application in the preparation of products for improving salt tolerance of rice; D3) Application in breeding salt-tolerant rice; D4) Use in the preparation of products for breeding salt-tolerant rice; D5) Application in salt-tolerant rice breeding or improvement of salt-tolerant rice germplasm resources; The biological material is any one of the following E1) to E7): E1) a nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein according to claim 1; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) A recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing E3) a recombinant microorganism containing the recombinant vector; E5) a transgenic plant cell line containing the nucleic acid molecule of E1), or a transgenic plant cell line containing the expression cassette of E2), or a transgenic plant cell line containing the recombinant vector of E3); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) A transgenic plant organ containing the nucleic acid molecule described in E1) or a transgenic plant organ containing the expression cassette described in E2).

3. The use according to claim 2, characterized in that The CDS sequence of the gene encoding the protein is shown in SEQ ID NO.

2.

4. A method for cultivating salt-tolerant plants, characterized in that: The method comprises reducing the content and / or activity of the protein of claim 1 in a target plant, thereby obtaining a salt-tolerant plant having higher salt tolerance than the target plant, wherein the plant is rice.

5. The method according to claim 4, characterized in that The reduction of the content and / or activity of the protein according to claim 1 in the target plant is achieved by reducing the expression level of the gene encoding the protein in the target plant.

6. The method according to claim 5, characterized in that The step of reducing the expression level of the gene encoding the protein in the target plant is to use gene knockout technology to reduce the expression level of the gene encoding the protein in claim 1 in the genome of the target plant.

7. The method according to claim 6, characterized in that The gene knockout technology is used to reduce the expression level of the gene encoding the protein of claim 1 in the target plant genome by using a CRISPR / Cas9 vector, and the CRISPR / Cas9 vector is a recombinant vector constructed based on the dual target sites sgRNA1: GCCAAGCTGGACCCTCAGTATGG and sgRNA2: ACGCCGTCATGGGGACGTCGCGG of the encoding gene.

Citation Information

Patent Citations

  • SULTR sulfate transport protein of soybean and coding gene and application of sulfate transport protein

    CN104087599A

  • A tea tree sulfate transporter CsSULTR1; application of gene 1

    CN116676316A

  • Application of substance for regulating and controlling expression of protein OsRNT in regulation and control of high temperature resistance of rice

    CN119954918A

Cited By

  • Application of OsSTA230 protein and coding gene thereof in regulating and controlling salt tolerance of rice

    CN120944959A

  • Gene OsHAK11 molecular marker for improving salt tolerance of rice as well as detection and identification method and application of gene OsHAK11 molecular marker

    CN120945121A

  • The invention relates to a plant constitutive promoter OsSULTR2. 2pro and application thereof

    CN121555507A

  • A plant constitutive promoter osSULTR2;2pro and application thereof

    CN121555507B

  • SaHKT1 is used as a template; application of gene 8 in salt stress adaptation of plants

    CN121801956A