Application of CsHCT1 gene in increasing content of citrus flavonoids

Abstract

The invention discloses an application of a CsHCT1 gene in increasing the content of citrus flavonoids, belongs to the technical field of agricultural biological genetic engineering, and provides an application of the CsHCT1 gene in increasing the content of citrus flavonoids, and the nucleotide sequence of the CsHCT1 gene is as shown in SEQ ID NO.1. The invention further discloses an application of the CsHCT1 gene in increasing the content of citrus flavonoids. The invention also discloses a method for improving the flavone compound of the citrus peel by using the CsHCT1 gene. The method comprises the following steps: cloning the citrus CsHCT1 gene; a CsHCT1 overexpression vector is constructed; transforming the overexpression vector to agrobacterium tumefaciens to obtain an agrobacterium tumefaciens liquid; and injecting the CsHCT1 gene into the citrus fruit to obtain the CsHCT1 gene overexpressed citrus fruit. A new choice is provided for increasing the flavonoid compounds in the citrus peel, the content of vicenin-2 and / or hesperidin in the citrus peel is effectively increased, and the application has great application value for cultivating new functional citrus varieties and accelerating the breeding process.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biological genetic engineering technology, specifically relates to CsHCT1 Application of genes in increasing the content of flavonoid compounds in citrus. Background Art

[0002] Citrus, China's largest fruit, ranks first in both cultivated area and production worldwide, playing a crucial role in the agricultural economy and food sector. Citrus fruits are rich in a variety of nutritional and functional components and bioactive secondary metabolites. These components not only give citrus its unique flavor and health benefits, but also demonstrate significant antioxidant, anti-inflammatory, and anti-cancer properties. Among them, vetsenin-2 (a flavonoid glycoside) and hesperidin (a flavanone glycoside) are two important bioactive substances with diverse functions. In plant defense, they protect against pathogens and pests, exerting stress resistance. Physiologically, they scavenge reactive oxygen species and free radicals to reduce oxidative damage, exhibiting antioxidant and photoprotective properties, and also exert anti-inflammatory effects by inhibiting pro-inflammatory factors. In terms of human health, these two compounds help reduce the risk of cardiovascular disease mortality and the development of various cancers. They also regulate gut microbial balance, improve metabolism, and combat obesity. In food processing, they can also reduce the use of synthetic chemicals and enhance the health benefits of products.

[0003] However, the molecular mechanisms underlying the biosynthesis of vetamine-2 and hesperidin in citrus remain incompletely elucidated, particularly the key functional genes regulating their content. The existing technology lacks effective targets for genetically engineering the increased content of vetamine-2 and / or hesperidin in citrus peel, making it difficult to efficiently cultivate new citrus varieties rich in these functional ingredients. This has limited the improvement of citrus's comprehensive utilization rate and the development of a functional citrus industry. Therefore, identifying the key genes regulating vetamine-2 and hesperidin synthesis and clarifying their mechanisms of action are crucial for promoting functional citrus breeding. Summary of the Invention

[0004] The present invention aims to provide CsHCT1 The application of genes in increasing the content of flavonoid compounds in citrus provides a new option for increasing the content of flavonoid compounds in citrus peel. CsHCT1 The gene is integrated into citrus through an expression vector, effectively increasing the content of hesperidin-2 and / or hesperidin in citrus peel, which has great application value for cultivating new functional citrus varieties and accelerating the breeding process.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows: CsHCT1 Application of genes in increasing the content of flavonoid compounds in citrus peels, the CsHCT1The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] Preferably, by adjusting citrus CsHCT1 The expression level of genes can be increased, and the content of flavonoid compounds in citrus peel can be improved.

[0007] Preferably, the citrus peel flavonoids include vinblastine-2 and / or hesperidin.

[0008] The present invention also provides an overexpression vector for increasing the content of flavonoid compounds in citrus peel, the overexpression vector comprising the CsHCT1 Gene.

[0009] The present invention also provides a strain for increasing the content of flavonoid compounds in citrus peels, wherein the strain comprises the overexpression vector.

[0010] The present invention also provides a method for utilizing the CsHCT1 A method for genetically increasing flavonoids in citrus peel comprises the following steps: S1. Cloned citrus CsHCT1 Gene; S2. Build CsHCT1 Overexpression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial solution; injecting the Agrobacterium bacterial solution into citrus fruits to obtain CsHCT1 Gene overexpression in citrus fruit.

[0011] Preferably, in S1, the cloned citrus CsHCT1 The genes are: Total RNA was extracted from citrus and reverse transcribed into cDNA as template. CsHCT1 -F and OE- CsHCT1 -R was used for PCR amplification to obtain citrus CsHCT1 Gene.

[0012] Preferably, the primer OE- CsHCT1 -F nucleotide sequence is shown in SEQ ID NO.2, the primer OE- CsHCT1 The nucleotide sequence of -R is shown in SEQ ID NO.3.

[0013] Preferably, in S2, the construction CsHCT1 The specific overexpression vector is: CsHCT1 The gene was connected to the pLGNe vector recovered by KpnⅠ and EcoRⅠ digestion and transformed into Escherichia coli DH5α to construct the overexpression vector pLGNe- CsHCT1 .

[0014] Preferably, S3 further includes performing PCR identification and qRT-PCR identification after the Agrobacterium liquid is injected into the citrus fruit.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects: The present invention provides a CsHCT1 The application of genes in increasing the content of citrus flavonoid compounds was first discovered in this invention. CsHCT1 The gene expression level was positively correlated with the content of citrus venetianine-2 and / or hesperidin. CsHCT1 The higher the gene expression level, the higher the content of vetlanin-2 and / or hesperidin in citrus peel. CsHCT1 The gene was expressed in a vector, and then transformed into citrus fruit. The flavonoid content of the transgenic material was as high as 22.65% higher than that of the citrus fruit transformed with the empty vector. CsHCT1 The gene can be used as a candidate gene for the selection of new citrus varieties with increased content of vetamine-2 and / or hesperidin, and is of great significance for the use of genetic engineering methods to cultivate new functional citrus varieties, accelerate the breeding process, reduce the breeding workload and improve the comprehensive utilization rate of citrus.

[0016] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In Example 1 of the present invention CsHCT1 Bioinformatics analysis results of genes; among them, Figure 1 The A in the sentence stands for Late Jincheng CsHCT1 Chromosomal location of the gene, bp is base; Figure 1 B in the sentence stands for Wanjincheng CsHCT1 The structure of the gene, Exon1-2 are exons; Figure 1 The C in it stands for Late Jincheng Orange CsHCT1 Conserved domain of the gene, aa represents amino acid; Figure 2 The cloned CsHCT1 Electrophoresis of PCR amplification products of gene coding sequences; CDS stands for CsHCT1 gene coding sequence; M represents DNA molecular weight standard; Figure 3 For the present invention CsHCT1 The structure of the gene overexpression vector; GUS:NPTII represents the β-glucosidase gene; P 35S T represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the opine synthase gene terminator; Figure 4These are photos of fruits on the day of transient transformation and 5 days after transient transformation; wherein, Figure 4 A in the figure is a photo of the fruit on the day of instantaneous transformation; Figure 4 Panel B is a photograph of the fruit cultured 5 days after transient transformation; Figure 4 C in the figure is a photo of some samples when total RNA was extracted; Figure 5 For the present invention CsHCT1 Gene relative expression analysis results; Figure 6 The results of the detection of the content of vecinin-2 and / or hesperidin in the peel of the Wanjin orange of the present invention are as follows: Figure 6 A in the table is the test result of the content of Vetsenin-2. Figure 6 B in the figure is the result of hesperidin content test. DETAILED DESCRIPTION

[0018] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0019] Unless otherwise defined, technical or scientific terms used in the present invention shall have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention belongs.

[0020] Source of test materials: In this example, Wanjin Orange was used as the experimental object.

[0021] In the present invention, unless otherwise specified, other test materials and instruments and equipment are conventional test materials in this field and can be purchased through commercial channels.

[0022] Example 1 1. Late Jincheng Orange CsHCT1 Bioinformatics analysis results of genes Late Golden Orange CsHCT1 The structure of genes Figure 1 As shown, it is located between 21,575,941bp and 21,578,124bp on chromosome 5 of Wanjincheng, contains 2 exons, and encodes 435 amino acids.

[0023] CsHCT1 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0024] SEQ ID NO.1:

[0025] 2. Late Jincheng Orange CsHCT1 Cloning of gene coding sequences 1. RNA Extraction and cDNA Synthesis Total RNA was extracted from citrus (Wanjincheng) leaves using a plant total RNA extraction kit (Adlai, Cat: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was measured using a concentration meter. cDNA was synthesized using the reverse transcription kit PrimeScript RTMaster Mix (TaKaRa, Cat: RR036A).

[0026] 2. CsHCT1 PCR amplification of coding sequences Using primers OE- CsHCT1 -F (SEQ ID No. 2), OE- CsHCT1 -R (SEQ ID No. 3) and high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045A), with the obtained Wanjin orange cDNA as the template, and the amplification system was configured according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase.

[0027] The PCR amplification program was as follows: 98°C, 5 min; 98°C, 30 s, 56°C, 30 s, 72°C, 1.5 min, 35 cycles; and 72°C extension for 10 min. CsHCT1 The DNA fragment of the coding sequence has a length of 1314bp (CDS sequence 1305bp-terminator 3bp+previous and next restriction enzyme cutting site bases, a total of 12bp).

[0028] Agarose gel electrophoresis results Figure 2 As shown, the amplified fragment size results were consistent with expectations. Under ultraviolet light, a clean blade was used to cut the agarose gel containing the target fragment, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1). Part of the recovered product was sent to the company for sequencing. After comparison and analysis of the sequencing results, it was determined that the obtained DNA fragment was Late Jin Orange CsHCT1 Gene coding sequence (SEQ ID NO.1).

[0029] SEQ ID No. 2: GGTACCATGGAAATTCACATAAAAGAGTCAACACTG.

[0030] SEQ ID No.3: GAATTCATGTTGAAGAAAAATATCATAAAATAACTTC.

[0031] 3. Construction CsHCT1 Overexpression vector and transformation of Agrobacterium 1. Construction of overexpression vector The recovered DNA fragments and the overexpression vector pLGNe were double-digested with restriction endonucleases KpnⅠ and EcoRI (ThermoFisher), recovered on gel, and ligated overnight at 16°C. The enzyme digestion system and reaction conditions were configured according to the attached instructions. The ligation was performed using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation system and reaction conditions were configured according to the instructions attached to the T4 DNA Ligase kit.

[0032] The obtained ligation product was transformed into E. coli DH5α using the method described in the instructions attached to E. coli DH5α. The plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain CsHCT1 The overexpression vector pLGNe- CsHCT1 , the carrier structure is as follows Figure 3 shown.

[0033] 2. Transformation of Agrobacterium with Overexpression Vector Take the frozen Agrobacterium competent cells EHA105 (50μL) in a 2mL centrifuge tube in advance and thaw on ice; add 2μL of the plasmid of the overexpression vector to the competent cells, pipette to mix, and then place the mixture on ice for 5 minutes, quick-freeze with liquid nitrogen for 5 minutes, incubate at 37℃ for 5 minutes, and place on ice for 5 minutes. Then add 800μL LB liquid culture medium to a 2mL centrifuge tube, pipette to mix, and shake at 260r / min at 28℃ for 2 hours. After the time is up, centrifuge the bacterial solution at 6000r / min for 1 minute, discard the supernatant, resuspend the bacteria in 50μL LB liquid culture medium, spread the resuspended bacteria on LB solid culture medium containing 50mg / L kanamycin, and invert and culture in the dark at 28℃ for 2 days; after plaques grow, pick the colonies and use primers ID- CsHCT1 -F (SEQ ID NO. 4) and ID- CsHCT1 -R (SEQ ID NO. 5) and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q) were used to verify the presence of a single colony by PCR. The amplification system was configured according to the instructions provided with the high-fidelity PrimeSTAR Max DNA Polymerase. PCR amplification conditions were: 94°C for 3 min, followed by 30 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s, and finally 72°C for 10 min.

[0034] SEQ ID NO. 4: TCGTTGAAGATGCCTCTGCCGACAG.

[0035] SEQ ID NO. 5: ATGTTGAAGAAAAATATCATAAAATAACTTC.

[0036] 4. CsHCT1 The overexpression vector pLGNe- CsHCT1 Perform instant conversion 1. Agrobacterium infection Select Wanjin orange fruits with the same growth status, disinfect them with 75% alcohol in a clean bench and set aside; take 500 μL of pLGNe and pLGNe- CsHCT1 Add the plasmid-containing Agrobacterium to 50 mL of liquid LB medium (containing 50 mg / L kanamycin) and incubate at 28°C and 200 rpm until OD600 = 0.5. Centrifuge the precipitate and resuspend the Agrobacterium in 1 / 2 MS liquid medium. Then, randomly select four injection points on the diagonal line of the equatorial plane of the disinfected Wanjin orange fruit and mark them. Use a 1 mL syringe to inject the plasmid containing pLGNe- CsHCT1 The plasmid-containing Agrobacterium resuspension was injected into the peel of the Wanjin orange, with 1 mL injected into each area, which was recorded as the experimental group. The Wanjin orange, which was injected with the same amount of Agrobacterium resuspension containing the pLGNe plasmid using the same method, served as the control group. The experimental group and the control group were repeated three times. The Wanjin orange fruits injected with the Agrobacterium resuspension were placed in a dark incubator at 28°C for 5 days. The photos of the fruits on the day of transient transformation and after 5 days of incubation are shown in the figure below. Figure 4 shown.

[0037] 2. qRT-PCR analysis of 5-day-old Wanjin orange fruits Total RNA (Adlai, CAT No: RN09) was extracted from the peel of the injected area of ​​the Wanjin orange cultured in the dark at 28°C for 5 days, and cDNA was synthesized using the reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT- CsHCT1 -F (SEQ ID NO. 6) and RT- CsHCT1 -R (SEQ ID NO.7). The experimental group and the control group were calculated by CsHCT1 Relative expression of genes: define the control group samples as the reference factor, that is, CsHCT1 The expression level of the reference factor gene is 1, and then the expression of the experimental group samples relative to the reference factor gene is calculated. , which is the relative expression level. Figure 5 As shown, in the experimental group CsHCT1 The gene expression level was significantly higher than that of the control group, with the highest being more than 10 times that of the control.

[0038] qRT-PCR reaction conditions: 95°C for 3 min, 94°C for 10 s; 56°C for 10 s, 72°C for 10 s, 40 cycles; 72°C for 10 min.

[0039] SEQ ID NO.6: CCCTTTCTTCATGATGGCGTAGTA; SEQ ID NO.7: AACTTCTTAAAGAGCTGCAAGTG.

[0040] five, CsHCT1 Evaluation of flavonoid content in the peel of overexpression materials The content of vetamine-2 and / or hesperidin components in the peels of the experimental group and the control group after 5 days of culture in the above experiment was determined by UPLC-MS. The statistical results are as follows Figure 6 As shown, compared with the control group of pLGNe cultured for 5 days, the fruits of pLGNe- CsHCT1 The contents of vecinin-2 and / or hesperidin in the peel of CsHCT1 Transient overexpression of the gene can significantly increase the content of vetacnin-2 and / or hesperidin in Wanjin orange fruit.

[0041] Therefore, the present invention first discovered CsHCT1 The gene expression level was positively correlated with the content of citrus venetianine-2 and / or hesperidin. CsHCT1 The higher the gene expression level, the higher the content of vetamine-2 and / or hesperidin in citrus peel. CsHCT1 The highest expression level of citrus with gene overexpression vector was 22.65% higher than that of citrus with empty vector; CsHCT1 The gene can be used as a candidate gene for the breeding of new citrus varieties with high vesperidin-2 and / or hesperidin content, and is of great significance for the use of genetic engineering methods to cultivate new functional citrus varieties, accelerate the breeding process, reduce the breeding workload and improve the comprehensive utilization rate of citrus.

[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. CsHCT1 The application of the gene in increasing the content of vetamine-2 and / or hesperidin in citrus peel is characterized in that: described CsHCT1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that Improvement of citrus by overexpression CsHCT1 The expression level of the gene is increased, and the content of hesperidin-2 and / or hesperidin in citrus peel is increased.

3. An overexpression vector for increasing the content of citrus peel vecrin-2 and / or hesperidin, characterized in that: The overexpression vector comprises the CsHCT1 Gene.

4. An Agrobacterium for increasing the content of vetacnin-2 and / or hesperidin in citrus peel, characterized in that: The Agrobacterium comprises the overexpression vector according to claim 3.

5. A method of using the method according to claim 1 CsHCT1 The method for genetically increasing the production of citrus peel hesperidin-2 and / or hesperidin is characterized in that: The following steps are involved: S1. Cloned citrus CsHCT1 Gene; S2. Build CsHCT1 Overexpression vector; S3, transforming the overexpression vector obtained in S2 into Agrobacterium to obtain Agrobacterium bacterial solution; injecting the Agrobacterium bacterial solution into citrus fruits to obtain CsHCT1 Gene overexpression in citrus fruit.

6. The method according to claim 5, characterized in that S1, the cloned citrus CsHCT1 The genes are: Total RNA was extracted from citrus and reverse transcribed into cDNA as template. CsHCT1 -F and OE- CsHCT1 -R was used for PCR amplification to obtain citrus CsHCT1 Gene; the primer OE- CsHCT1 -F nucleotide sequence is shown in SEQ ID NO.2, the primer OE- CsHCT1 The nucleotide sequence of -R is shown in SEQ ID NO.

3.

7. The method according to claim 5, characterized in that In S2, the construction CsHCT1 The specific overexpression vector is: CsHCT1 The gene was connected to the pLGNe vector recovered by KpnⅠ and EcoRⅠ digestion and transformed into Escherichia coli DH5α to construct the overexpression vector pLGNe- CsHCT1 .

8. The method according to claim 5, characterized in that S3 further includes performing PCR identification and qRT-PCR identification after the Agrobacterium liquid is injected into the citrus fruit.

Images