Molecular marker for alveolar rhabdomyosarcoma and application thereof

Abstract

The invention relates to the technical field of biological medicine, in particular to a molecular marker for alveolar rhabdomyosarcoma and application of the molecular marker, the molecular marker is a circFOXO1R-loop site, and a DNA-RNA hybridization region of the molecular marker is located on chr13: 41133915-41134263 of a human genome. According to the invention, the method comprises the following steps: CUTamp; the circFOXO1R-loop site is verified through Tag-qPCR and DRIP-qPCR, it is found that the circFOXO1R-loop can promote combination of the FOXO1 gene and RNAPol II and DNA damage, and the circFOXO1R-loop has important clinical application value for developing a reagent or a kit for diagnosing the alveolar rhabdomyosarcoma, a medicine for preventing and / or treating the alveolar rhabdomyosarcoma or a gene treatment strategy aiming at the target site.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to a molecular marker for alveolar rhabdomyosarcoma and an application thereof. Background Art

[0002] Rhabdomyosarcoma (RMS) is the most common mesenchymal soft tissue malignancy in children and adolescents. The 2020 edition of the WHO divides RMS into four subtypes based on clinical manifestations, pathological morphology, and molecular genetic characteristics: alveolar RMS (ARMS), embryonal RMS (ERMS), spindling cell RMS (SRMS), and pleomorphic RMS (PRMS). The occurrence of rhabdomyosarcoma is closely related to chromosomal abnormalities. ARMS has specific chromosomal translocations t(2;13)(q35;q14) and t(1;13)(q36;q14), forming fusion genes such as PAX3 / 7-FOXO1, PAX3-NCOA1 / 2, and PAX3-FOXO4. Studies have confirmed that the occurrence and progression of ARMS is closely related to the PAX3-FOXO1 fusion gene and its protein product. These unique biomolecules promote the occurrence and development of ARMS by arresting the cell cycle, inhibiting cell differentiation, increasing cell proliferation, invasion, and migration, and enhancing the expression of downstream target genes and specific miRNAs. Therefore, clarifying the molecular mechanism of fusion gene formation is a key issue that urgently needs to be addressed.

[0003] As a core member of the FOXO transcription factor family, FOXO1 (ForkheadBox O1) also plays a key role in regulating biological processes such as apoptosis, metabolism, oxidative stress response, and cell cycle. Phosphorylation of AKT / PKB is common in tumors, leading to the nuclear export and inactivation of FOXO1. Ubiquitination by SKP2 promotes the degradation of FOXO1 and thus promotes tumor progression. Deacetylation and activation of FOXO1 by SIRIT1 is also associated with lifespan extension. Currently, small molecule inhibitors targeting FOXO1 are being studied in diabetes, lung cancer, and osteoarthritis, and the FOXO1 protein has become a potential target for the development of anti-aging products. However, in alveolar rhabdomyosarcoma, early diagnosis and treatment strategies targeting the FOXO1 gene have not yet been reported.

[0004] R-loops are triple-stranded nucleic acid structures composed of an RNA-DNA hybrid and a free single-stranded DNA. A circR-loop is a specialized circular R-loop structure formed when circRNA base pairs with its cognate genomic DNA site, replacing single-stranded DNA (ssDNA). Exposed single-stranded DNA is a site of genomic instability and prone to mutations, manifesting as double-stranded DNA breaks caused by base excision repair and potentially contributing to the formation of fusion genes.

[0005] Currently, the effects of circR-loop on chromosomal structural stability and the formation of the alveolar rhabdomyosarcoma driver gene PAX3-FOXO1 have not been confirmed. Therefore, screening circFOXO1 R-loops in alveolar rhabdomyosarcoma and exploring their effects on the parental gene FOXO1 will facilitate the early diagnosis and treatment of alveolar rhabdomyosarcoma.

[0006] In view of this, the present invention is proposed. Summary of the Invention

[0007] In order to make up for the deficiencies of the prior art, the object of the present invention is to provide a molecular marker for alveolar rhabdomyosarcoma, which can be used as a biomarker for the diagnosis and / or prevention of alveolar rhabdomyosarcoma.

[0008] In a first aspect of the present invention, a molecular marker for alveolar rhabdomyosarcoma is provided. The molecular marker is a circFOXO1 R-loop site, and its DNA-RNA hybridization region is located at chr13:41133915-41134263 of the human genome (hg19).

[0009] Specifically, the circFOXO1 R-loop site was identified by cross-analyzing CUT&Tag and circRNA sequencing data and aligning the chromosome sequence to identify the specific sequence position as chr13:41133915-41134263, with a length of approximately 349 bp.

[0010] Specifically, the molecular marker is formed by hybridization of circFOXO1 (has_circ_0030042) and the FOXO1 gene.

[0011] Preferably, the circFOXO1 R-loop site is detected by designing primer sets SEQ ID NO: 1 and SEQ ID NO: 2 with reference to the FOXO1 gene sequence in the human genome hg19, and detecting by any of the following methods a)-b):

[0012] a) CUT&Tag was combined with RNase R enzyme digestion, and the protein was purified using S9.6 antibody and detected using primer sets SEQ ID NO: 1 and SEQ ID NO: 2.

[0013] Specifically, the circFOXO1 R-loop site was identified by CUT&TAG-qPCR. Based on the original experiment, restriction exonuclease RNase R treatment was added to the overnight incubation with the primary antibody S9.6 before cell lysis to degrade the linear R-loop and achieve the purpose of directly immunoprecipitating circR-loops.

[0014] b) DRIP combined with RNase R enzymatic digestion, purified using S9.6 antibody, and detected using primer sets SEQ ID NO: 1 and SEQ ID NO: 2.

[0015] Specifically, the circFOXO1 R-loop site was identified by DRIP-qPCR. Based on the original experiment, after cell lysis, RNase R treatment was added before overnight incubation with the primary antibody S9.6 to degrade the linear R-loop and achieve the purpose of direct immunoprecipitation of circR-loops.

[0016] In a second aspect of the present invention, a primer set for detecting the molecular markers of the alveolar rhabdomyosarcoma is provided. The sequences of the primer set are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0017] In a third aspect of the present invention, a primer set for specifically detecting circFOXO1 (has_circ_0030042) is provided, which is used to amplify the circFOXO1 junction. The sequences of the primer set are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0018] In a fourth aspect of the present invention, a probe for specifically detecting circFOXO1 (has_circ_0030042) is provided. The probe is used for RNA FISH labeling of circFOXO. By designing a biotin indicator probe carrying Cy3, the distribution of circFOXO1 (has_circ_0030042) in cells is detected. The sequence of the probe is shown in SEQ ID NO: 5.

[0019] The fifth aspect of the present invention provides an application of the above-mentioned molecular marker for alveolar rhabdomyosarcoma, and the application of the molecular marker in the preparation of products for diagnosing and / or preventing and treating alveolar rhabdomyosarcoma.

[0020] Preferably, the molecular marker is used in the preparation of products related to DNA damage and RNA polymerase II regulation in alveolar rhabdomyosarcoma.

[0021] Preferably, the product is a reagent or kit for diagnosing alveolar rhabdomyosarcoma.

[0022] Preferably, the product is a drug for preventing and / or treating alveolar rhabdomyosarcoma; more preferably, the drug is siRNA, a vector, a biological inhibitor, etc.

[0023] Specifically, the drug works through the following mechanisms:

[0024] a) Inhibit the circularization of circFOXO1 (e.g., siRNA targeting the backsplicing site);

[0025] b) Degradation of circR-loop structures (e.g., RNase H1 overexpression vectors);

[0026] c) Blocking circR-loop-mediated DNA damage (e.g., biological inhibitors).

[0027] In a sixth aspect, the present invention provides a kit for diagnosing alveolar rhabdomyosarcoma, comprising a primer set for detecting the molecular markers of the above-mentioned alveolar rhabdomyosarcoma, wherein the sequences of the primer set are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0028] Specifically, the kit also includes a positive control, a negative control, reagents, and the like.

[0029] In a seventh aspect, the present invention provides a drug screening system comprising: an ARMS cell line stably expressing circFOXO1, a primer set for detecting molecular markers of alveolar rhabdomyosarcoma, a γH2AX detection kit, and reagents for evaluating the effects of candidate compounds on R-loop levels.

[0030] The eighth aspect of the present invention provides an application of the above-mentioned molecular marker for alveolar rhabdomyosarcoma, and the application of the molecular marker in screening drugs for preventing and / or treating alveolar rhabdomyosarcoma.

[0031] A ninth aspect of the present invention provides a method for detecting circFOXO1 R-loop sites for non-diagnostic purposes, comprising the following steps:

[0032] In CUT&Tag or DRIP experiments, samples are treated with RNase R to degrade linear RNA for the purpose of directly detecting circR-loops;

[0033] qPCR quantification was performed using the above primer set for detecting molecular markers of alveolar rhabdomyosarcoma;

[0034] The DNA damage-inducing function of circFOXO1 R-loop was verified by comet assay and γH2AX immunofluorescence.

[0035] RNA polymerase II stalling at the FOXO1 locus was detected by ChIP-qPCR.

[0036] In the present invention, the DNA damage of circFOXO1 R-loop was mainly detected by comet assay, immunofluorescence, and western blot labeling of DNA damage marker γH2Ax, and ChIP-qPCR was used to determine the damage sites of the parent gene FOXO1. To detect the damage sites of FOXO1, primers were designed for the Exon1, Intron1, Exon2, Intron2, and Exon3 regions of the FOXO1 gene, respectively. Among them, the Intron1 sequence is longer, and four pairs of primers were designed. The specific sequences are shown in Table 6.

[0037] Preferably, the sample types include: tumor tissue biopsy samples, peripheral blood circulating tumor DNA / RNA, primary cultured ARMS cells, etc.

[0038] The present invention has at least the following beneficial effects:

[0039] This study identified a target associated with FOXO1 fusion gene formation in alveolar rhabdomyosarcoma: an R-loop site where circFOXO1 (has_circ_0030042) hybridizes with FOXO1. Using CUT&TAG-seq and circRNA sequencing, the present study revealed the presence of a circFOXO1 R-loop in alveolar rhabdomyosarcoma cells. Furthermore, the finding suggests that this structure promotes FOXO1 gene breakage and RNApol II arrest. This discovery holds important clinical application value for the development of diagnostic reagents or kits, as well as drugs or gene therapy strategies for the prevention and / or treatment of alveolar rhabdomyosarcoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0041] Figure 1Figure 3. Gene distribution and staining localization of 29,457 R-loops detected by CUT&TAG-seq in alveolar rhabdomyosarcoma cells. Figure A is the length distribution of CUT&TAG products. Figure B is a pie chart showing the distribution of 29,457 R-loops in different gene regions in RH30 cells. Figure C is the read distribution of CUT&TAG products in the start sequence (TSS) and end sequence (TES) of genes. Figure D is the gene distribution of 29,457 R-loops on 23 chromosomes.

[0042] Figure 2 CircRNA sequencing detected 13,067 circRNAs in alveolar rhabdomyosarcoma cells; A shows the circos diagram of the genome-wide distribution of circRNAs in RH30 and RD, with the outermost track representing different chromosomes and the inner track showing the expression level of circRNAs (red / blue), where red indicates circRNAs that are more highly expressed than in embryonal rhabdomyosarcoma and blue indicates circRNAs that are less expressed than in embryonal rhabdomyosarcoma; B shows the metagene diagram of circRNAs in RH30 cells across the genome; C is a heat map of the relative expression levels of circRNAs in different genomic regions in RH30 samples; D shows the gene location map of circRNAs on 23 chromosomes.

[0043] Figure 3 Cross-analysis of CUT&TAG and circRNA sequencing to determine the circFOXO1 R-loop site; A shows the signal distribution of R-loop in the FOXO1 gene region (chr13:41,129,804-41,240,778), and the relevant areas of R-loop are marked in the figure; B is the RT-PCR results of circFOXO1 (has_circ_030042) (left) and circFOXO1 (has_circ_0000476) (right), which verified the presence of circFOXO1 in alveolar rhabdomyosarcoma cells; C is a diagram of circFOXO1 R-loop, in which the gene position with circFOXO1 (has_circ0030042) is marked.

[0044] Figure 4Figure 3 shows the identification, circularization, and stability of circFOXO1. Figure A shows the RT-PCR and Sanger sequencing of circFOXO1, with the yellow arrow indicating the junction site of circFOXO1. Figure B shows the FISH results of circFOXO1, with 18S rRNA as the cytoplasmic control. Figure C shows the cytoplasmic-nuclear separation experiment, which shows that circFOXO1 is mainly located in the cytoplasm of RH30 cells, with a small part located in the nucleus. Figure D shows the RNA of RH30 cells treated with actinomycin D, showing that circFOXO1 is more stably expressed than FOXO1 mRNA. Figure E shows that circFOXO1 still maintains high expression after RNase R treatment, indicating that circFOXO1 has a circular structure.

[0045] Figure 5 One-step RT-PCR was used to amplify the expression of circFOXO1 in paraffin-embedded ARMS tissue. RNase R digestion was used to remove linear RNA molecules, and the amplified product was subjected to anger sequencing to confirm that it contained the junction site of circFOXO1.

[0046] Figure 6 Figure 3. Identification of circR-loops formed near FOXO1 by CUT&Tag-qPCR and DRIP-qPCR. Figure A is a schematic diagram of the R-loop and circR-loop structures and the degradation of R-loop and circR-loop after RNase H and RNase R digestion. Figure B is a statistical graph of the DRIP-qPCR results. Figure C is a statistical graph of the CUT&Tag-qPCR results.

[0047] Figure 7 Figure 3: circFOXO1 promotes the formation of R-loops. Figure A shows embryonic rhabdomyosarcoma (RD) cells successfully overexpressing circFOXO1. Figure B shows human embryonic kidney (HEK293T) cells successfully overexpressing circFOXO1. Figure C shows that overexpression of circFOXO1 promotes the formation of R-loops in RD cells, and the structure is more stable. Figure D shows that overexpression of circFOXO1 promotes the formation of R-loops in 293T cells, and the structure is more stable.

[0048] Figure 8 The circFOXO1 R-loop promotes the binding of RNA pol II to FOXO1 Exon2 and Intron 1 fragments, and the position is consistent with the circFOXO1 R-loop site.

[0049] Figure 9The circFOXO1 R-loop promotes the occurrence of FOXO1 gene damage and breakage; A is a comet assay showing that the frequency of DSBs is higher in cells overexpressing circFOXO1; B is immunofluorescence detection of increased expression of the DSB marker γH2Ax protein in cells overexpressing circFOXO1; C shows western blot detection of increased expression of γH2Ax protein after overexpression of circFOXO1; D is ChIP-qPCR detection that circFOXO1 R-loop can promote DNA damage in the front part of intron 1 and intron 2 of the FOXO1 gene. DETAILED DESCRIPTION

[0050] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.

[0051] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular also includes the plural. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0052] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0053] Example 1: 29,457 R-loops were screened in alveolar rhabdomyosarcoma cells using CUT&Tag-seq technology

[0054] Based on the importance of circR-loop in regulating genome stability and participating in transcription, this example studies the potential mechanism by which circFOXO1 R-loop may be involved in the formation of FOXO1 fusion genes (PAX3 / 7-FOXO1, etc.) in alveolar rhabdomyosarcoma and screens circFOXO1 R-loop sites. To this end, this example first analyzed the R-loops formed in alveolar rhabdomyosarcoma cells (RH30) by CUT&Tag combined with high-throughput sequencing. The S9.6 antibody specifically binds to the DNA:RNA hybrid chain in the R-loops structure. The fragments forming R-loops in the whole genome of RH30 cells were immunoprecipitated by CUT&Tag experiment, and the DNA fragments in the RNA:DNA hybrid chain were extracted to build a library and sequenced. The length of the isolated and extracted DNA fragments is mainly 0 to 400bp ( Figure 1 A in the figure shows that 47.18% of the regions where R-loops are formed in RH30 cells are located in gene promoter regions, 32.31% are located in gene coding regions, and 20.51% are located in intergenic regions ( Figure 1 B in the figure); a heat map of the gene regions where R-loops are formed was drawn, and it was found that they were mainly distributed in the transcription start site (TSS) ( Figure 1 C in the figure); A total of 16,732 genes were detected in RH30 cells to form 29,457 R-loops, and these genes are distributed on all 23 human chromosomes ( Figure 1 D) in.

[0055] Example 2 Sequencing detected 13067 circRNAs in alveolar rhabdomyosarcoma cells

[0056] Based on the screening of R-loops sites in alveolar rhabdomyosarcoma cells in Example 1 above, this example further sequenced circRNAs in alveolar rhabdomyosarcoma cells. Total RNA was extracted from RH30 cells and embryonic rhabdomyosarcoma cells (RD, PAX3-FOXO1 negative) using the Trizol method. After the samples passed the quality inspection, they were first digested with RNase R to remove linear RNA, and then the KAPA RNA HyperPrep Kit with RiboErase (HMR) was used for The library is constructed using a library construction kit. Designed DNA probes are hybridized with RNA samples to remove rRNA from the RNA. The RNA is then fragmented to synthesize first-strand cDNA. Second-strand cDNA is labeled with dUTP using a strand-specific method during synthesis, and end-repair is also performed at this step. Next, A-tailing, adapter ligation, ligation product purification, fragment size sorting, and library amplification are performed. After amplification, the circRNA-Seq library is purified and recovered using magnetic beads. After library construction, preliminary quantification is performed using Qubit 3.0, followed by library size range verification using an Agilent 2100 Bioanalyzer. Once the inserted target fragment size meets the expected size, the effective concentration of the library is accurately quantified using q-PCR (>3 nM) to ensure library quality. Off-line data are counted using CIRCexplorer 2 to quantify circRNA expression using backsplice junction reads.

[0057] A total of 13,067 circRNAs were detected in RH30 cells and 21,048 circRNAs were detected in RD cells. Differential analysis of circRNAs in the two groups of cells showed that 2,014 circRNAs were upregulated and 1,983 circRNAs were downregulated ( Figure 2 A in RH30); circRNAs in RH30 are mainly distributed in the gene region between TSS and transcription end site (TES) ( Figure 2 B); the heat map of the relative expression levels of circRNAs in different gene regions of RH30 cells showed that the expression level of circRNAs formed in the TSS region was higher ( Figure 2 C in RH30 cells); circRNAs are scattered on 23 chromosomes ( Figure 2 D) in.

[0058] Example 3 Cross-analysis of CUT&Tag and circRNA sequencing revealed that a circFOXO1 was formed near the FOXO1 gene in alveolar rhabdomyosarcoma cells

[0059] Based on the above-mentioned findings that a large number of R-loop structures are enriched in alveolar rhabdomyosarcoma cells and that they contain 13,067 circRNAs, this example further explored the potential circR-loops associated with the FOXO1 gene in alveolar rhabdomyosarcoma cells. First, the R-loops formed near the FOXO1 gene in the CUT&Tag data were analyzed. The R-loop signals in the CUT&Tag sequencing were visualized using the Integrative Genomics Viewer. As shown in Table 1, three significant R-loop peaks were observed near the FOXO1 gene ( Figure 3 A in Figure 3); circFOXO1 identified by RH30 circRNA sequencing was further analyzed. As shown in Table 2, two circFOXO1 variants were detected, one of which was an all-exon circFOXO1 (has_circ_0030042) and the other was an all-intron circFOXO1 (has_circ_00000476). Primers were designed for their junction sites (see Table 3) and amplified by one-step RT-PCR. The presence of two circFOXO1 variants was successfully verified in RH30 cells ( Figure 3 B) in.

[0060] Table 1 List of R-loops information near FOXO1 gene

[0061] R-loops location length Genetic characteristics Foldchange log10(pvalue) chr13:41133915-41134263 349 gene_body 4.77863 2.37145 chr13:41136794-41137791 998 gene_body 7.18604 2.75082 chr13:41240791-41241165 375 gene_body 6.77343 3.46466

[0062] Table 2 List of circRNA information related to FOXO1 gene

[0063] circRNA location circbaseID area Cutting length chr13_41133645_41134997 hsa_circ_0030042 Exon2 1352 chr13_41207283_41219635 hsa_circ_0000476 Intron1 12352

[0064] Table 3 circFOXO1 PCR primer sequences

[0065]

[0066] The sequence positions of R-loops near FOXO1 were compared with the sequence positions of circFOXO1, and a circFOXO1 R-loop region that may be formed near the FOXO1 gene was screened, namely chr13:41133915-41134263, with a length of 349 bp and the sequence is:

[0067] GCTCTCACAGCAATGATGACTTTGATAACTGGAGTACATTTCGCCCTCGAACTAGCTCAAATGCTAGTACTATTAGTGGGAGACTCTCACCCATTATGACCGAACAGGATGATCTTGGAGAAGGGGATGTGCATTCTATGGTGTACCCGCCATCTGCCGCAAAGATGGCCTCTACT TTCCCAGTCTGTCTGAGATAAGCAATCCCGAAAACATGGAAAATCTTTTGGATAATCTCAACCTTCTCTCATCACCACATCATTAACTGTTTCGACCCAGTCCTCACCTGGCACCATGATGCAGCAGACGCCGTGCTACTCGTTTGCGCCACCAAACACCAGTTTGAATTC(SEQ ID NO:8).

[0068] Example 4 Successful Validation of circFOXO1 R-loop in Alveolar Rhabdomyosarcoma Cells

[0069] In the above Example 3, the circFOXO1 R-loop site was screened, and the circFOXO1 that may hybridize with FOXO1 to form a circR-loop is has_circ_0030042 ( Figure 3 C in the figure), so circFOXO1 mentioned in the following text refers to this circRNA. Total RNA from RH30 cells was extracted using Trizol, and has_circ_0030042 of the human genome hg19 was amplified by one-step RT-PCR. The product was then subjected to Sanger sequencing, and the junction site of circFOXO1 was successfully identified ( Figure 4 A in Figure 4); Probes were designed based on the junction site of circFOXO1 (see Table 4), and RNA FISH was performed to detect the distribution of the circRNA in RH30 cells. 18s rRNA was used as a cytoplasmic positive control. The results showed that circFOXO1 was mainly distributed in the cytoplasm, with a small amount distributed in the nucleus ( Figure 4 B) in.

[0070] Table 4 RNA FISH probe sequence information

[0071]

[0072] The nuclear and cytoplasmic protein extraction kit (P0027) was used to separate the nuclear and cytoplasmic proteins of RH30 cells. α-tublin and actin were used as cytoplasmic positive controls, and LaminB and U6 were used as nuclear positive controls. It was confirmed that circFOXO1 was mainly distributed in the cytoplasm, with a small amount distributed in the nucleus ( Figure 4 C); Further experiments were conducted to investigate the circular structure and stability of circFOXO1. RH30 cells were treated with actinomycin D, and RNA was extracted at 4h, 8h, 12h, and 24h, respectively. qPCR amplification of circFOXO1 and FOXO1 was performed to detect their expression. The results showed that circFOXO1 was not easily degraded and was more stable than FOXO1 ( Figure 4 D in Figure 3); qPCR was performed after degradation of linear RNA using restriction enzyme RNase R, and the circular structure of circFOXO1 was successfully verified ( Figure 4 E).

[0073] Four ARMS tissues were selected, and RNA was extracted from paraffin tissues and RT-PCR was performed to detect the expression of circPAX3 and circFOXO1 in ARMS tissues. RNase R digestion was used to remove linear RNA molecules. The results showed that circFOXO1 was successfully amplified in the four ARMS tissues. The amplified products were the junction sites of circFOXO1 by Sanger sequencing. Among them, R34 and R35 could still be detected after RNase R treatment ( Figure 5 ).

[0074] R-loop and circR-loop have natural structural differences. The restriction endonuclease RNase H can specifically degrade DNA:RNA hybrid chains, while RNase R only degrades R-loop by degrading linear RNA and has no effect on circR-loops ( Figure 6 A in Figure 5); DRIP and CUT&Tag experiments were performed. Both techniques used S9.6 antibody to immunoprecipitate DNA:RNA hybrid chains, and then extracted the DNA single strands in the hybrid chains. During the experiment, RNase H and RNase R treatment groups were added. Primers related to the FOXO1 gene were designed based on the circFOXO1 R-loop sequence (see Table 5). qPCR was performed on the DRIP and CUT&Tag products, respectively, and it was successfully confirmed that this fragment region of the FOXO1 gene can form circR-loops ( Figure 6 BC in).

[0075] Table 5 FOXO1 R-loop PCR primer sequence list

[0076]

[0077] To explore the potential mechanism of circFOXO1 R-loop in the formation of FOXO1 fusion gene, a circFOXO1 overexpression lentiviral plasmid and an empty control plasmid were constructed. The circular plasmid carries an RFP tag, and the overexpression plasmid contains a circFOXO1 junction site. The full-length sequence is as follows:

[0078]

[0079] Lentiviral plasmids were transfected into PAX3-FOXO1 fusion gene-negative RD cells and human embryonic kidney 293T cells, respectively. 72 hours after transfection, the transfection efficiency of the lentivirus overexpressing circFOXO1 reached more than 95% under a fluorescence microscope. qPCR was used to detect the expression of circFOXO1 in the overexpression group and the control group. The results showed that RD cells overexpressing circFOXO1 were successfully constructed ( Figure 7 A) and 293T cells overexpressing circFOXO1 ( Figure 7 B); genomic DNA of the above four cells was extracted, and dotblot experiments were performed with S9.6 antibody to detect the effect of overexpression of circFOXO1 on intracellular R-loop formation. The results showed that circFOXO1 significantly promoted the formation of R-loop structures in RD cells and 293T cells. Because high salt can destroy RNA-DNA hybrid structures and accelerate their dissociation, different concentrations of NaCl treatment groups were added in this experiment. The results showed that overexpression of circFOXO1 increased the stability of the R-loop structure ( Figure 7 CD in the ).

[0080] Example 5: circFOXO1 R-loop promotes RNA polymerase arrest and DSB formation in alveolar rhabdomyosarcoma cells

[0081] To determine the role of the circFOXO1 R-loop in gene transcription and genome stability, this example conducted a series of experiments in overexpression cell lines to explore its effects on RNA polymerase II (RNAPol II) and DSBs.

[0082] ChIP experiments were performed using RNA Pol II-specific antibodies in cell lines overexpressing circFOXO1 to pull down DNA fragments bound to RNA Pol II. Primers were designed near exon 1, intron 1, exon 2, and exon 3 of the FOXO1 gene based on the location of the circFOXO1 R-loop (Exon 2) (see Table 6), and the DNA products obtained by ChIP were amplified by qPCR. The results showed that in 293T and RD cell lines, circFOXO1 promoted the binding of RNA Pol II to FOXO1 intron 1 and exon 2, with the highest binding to the circFOXO1 R-loop region ( Figure 8 ).

[0083] Table 6 PCR primer sequences for different regions of FOXO1 gene

[0084]

[0085] Comet assays are commonly used to detect single-cell DNA damage, especially double-strand breaks (DSBs). The extent of DNA damage can be assessed by observing the migration of DNA fragments within the cell nucleus. Comet assays were performed on RD and 293T cells overexpressing circFOXO1. The results showed that most cells in the overexpression group exhibited distinct comet tails with longer tails, indicating that circFOXO1 promoted the occurrence of DSBs in cells. Figure 9 A in the figure); γH2AX (phosphorylated H2AX, used to study DNA damage, repair, and genomic stability) is a hallmark molecule for DSBs. Subsequent experiments used γH2AX labeling to detect the effect of circFOXO1 on DNA breakage. Cell immunofluorescence experiments showed that in cells overexpressing circFOXO1, the expression of γH2AX in the nucleus was significantly increased, indicating that there was more DNA damage ( Figure 9 B); Western Blot analysis of γH2AX expression in the two groups of cells showed that the expression of γH2AX protein in cells overexpressing circFOXO1 was significantly increased compared with that in the control group ( Figure 9 C in the figure); Based on the fact that γH2AX can mark the location of DNA breaks, a Chip experiment was conducted using this protein antibody to explore the effect of circFOXO1 R-loop on DSB occurrence. DNA fragments bound to γH2AX were pulled down, and qRT-PCR was performed to amplify the DNA products obtained by the Chip experiment in different introns, exons and circR-loop regions of the FOXO1 gene. The results showed that overexpression of circFOXO1 promoted the binding of γH2AX to FOXO1 intron 1, intron 2 and exon 3, and DNA damage was mainly distributed before and after the circFOXO1 R-loop ( Figure 9 D) in.

[0086] In summary, the present invention provides the site of the circFOXO1 R-loop in alveolar rhabdomyosarcoma and its effects on RNA Pol II and DSBs. This site can be used to develop reagents or kits for diagnosing alveolar rhabdomyosarcoma, as well as drugs for preventing and / or treating alveolar rhabdomyosarcoma. For example, siRNA targeting the reverse splicing site can inhibit circFOXO1 circularization, RNase H1 overexpression vectors can degrade the circR-loop structure, and biological inhibitors can block circR-loop-mediated DNA damage. Furthermore, a drug screening system targeting this site can be constructed, including: an ARMS cell line stably expressing circFOXO1, a primer set for detecting molecular markers of alveolar rhabdomyosarcoma, a γH2AX detection kit, and reagents for evaluating the effects of candidate compounds on R-loop levels, which has important clinical application value.

[0087] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A molecular marker for alveolar rhabdomyosarcoma, characterized in that: The molecular marker is the circFOXO1R-loop site, and its DNA-RNA hybridization region is located at chr13:41133915-41134263 of the human genome.

2. The molecular marker for alveolar rhabdomyosarcoma according to claim 1, characterized in that It is formed by hybridization of circFOXO1 (has_circ_0030042) and FOXO1 gene.

3. A primer set for detecting the molecular marker of alveolar rhabdomyosarcoma according to claim 1, characterized in that: The sequences of the primer set are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

4. A primer set for detecting circFOXO1 (has_circ_0030042), characterized in that: The sequences of the primer set are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

5. A probe for detecting circFOXO1 (has_circ_0030042), characterized in that The sequence of the probe is shown in SEQ ID NO:

5.

6. Use of the molecular marker for alveolar rhabdomyosarcoma according to any one of claims 1 to 2, characterized in that: The molecular marker is used in the preparation of products for diagnosing and / or preventing and treating alveolar rhabdomyosarcoma.

7. The use according to claim 6, characterized in that The product is a reagent or kit for diagnosing alveolar rhabdomyosarcoma, or a drug for preventing and / or treating alveolar rhabdomyosarcoma.

8. Use of the molecular marker for alveolar rhabdomyosarcoma according to any one of claims 1 to 2, characterized in that: The molecular marker is used in screening drugs for preventing and / or treating alveolar rhabdomyosarcoma.

9. A kit for diagnosing alveolar rhabdomyosarcoma, characterized in that: A primer set comprising the molecular marker for detecting alveolar rhabdomyosarcoma according to claim 3.

10. A method for detecting circFOXO1 R-loop sites for non-diagnostic purposes, characterized in that: The steps include: In CUT&Tag or DRIP experiments, samples are treated with RNase R to degrade linear RNA for the purpose of directly detecting circR-loops; Performing qPCR quantification using the primer set of claim 3; The DNA damage-inducing function of circFOXO1 R-loop was verified by comet assay and γH2AX immunofluorescence. RNA polymerase II stalling at the FOXO1 locus was detected by ChIP-qPCR.

Images