SNP (Single Nucleotide Polymorphism) site and application thereof in detecting morphological characters of bees

Abstract

The invention relates to the technical field of bee breeding, in particular to an SNP (Single Nucleotide Polymorphism) site and application thereof in detecting morphological characters of bees. The SNP site is located at the 3465613th site of a bee chromosome 3, and the polymorphism is C / T. The application comprises the following steps: i) detecting morphological characters of bees, ii) cultivating transgenic bees, iii) improving the honey collecting capacity of the bees, iv) improving germplasm resources of the bees, and v) carrying out molecular marker-assisted breeding on the bees. The SNP sites related to the bee morphological characters are obtained through research, identification of the bee morphological characters can be achieved, and then the SNP sites are used for breeding bees and improving germplasm resources of the bees.

Description

Technical Field

[0001] The present invention relates to the technical field of bee breeding, and in particular to a SNP site and an application thereof in detecting the morphological traits of bees. Background Art

[0002] Chinese honey bee ( Apis cerana The Chinese honey bee (Apis cerana) is a subspecies of the Oriental honey bee, divided into three types: queen bee, drone, and worker bee. The Chinese honey bee is widely distributed and possesses strong adaptability, foraging ability, disease resistance, and reproductive capacity. Furthermore, the Chinese honey bee plays a vital role in protecting plant species and maintaining the balance and development of natural ecosystems.

[0003] The morphological characteristics of honeybees are crucial for their survival and reproduction, determining their flight ability and collection efficiency, which in turn influences the efficiency and quality of honey production. The fourth dorsal plate, located on the bee's abdomen, is related to the size of its honey sac. The honey sac is the organ where bees store nectar and determines the volume of nectar they can collect in a single trip. Therefore, determining the length of the fourth dorsal plate can indirectly determine the size of the honey sac and can also assist in bee breeding. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker associated with the length of the fourth dorsal plate of honey bees.

[0005] In a first aspect, the present invention provides a SNP site, which is located at position 3465613 of honeybee chromosome 3 and has a polymorphism of C / T.

[0006] Furthermore, the SNP site includes the nucleic acid shown in SEQ ID NO.1, and the 167th position of the nucleic acid is a polymorphic site, and the polymorphism is C / T.

[0007] The nucleotide sequence shown in SEQ ID NO.1: TGCCACCGTATCAAAGAAGGGGTTACGGAAAATTATTAATAGAATTTTCATACGAATTATCCAAATTCGAAGGTAAAACAGGTTCACCTGAAAAACCATTGTCGGATTTGGGATTATTATCTTATAGAAGTTATTGGGCTCATACTATATTGGATATTCTATTGAACGTAA AGCCATTAGTAGAAAATGAAAAACCACAAATCACGATAAGTGAGATATGTGAGCTGACGTCGATTAAGAAAGAAGACGTGATATCGACGCTACAAAATTTGAATCTTATTAATTACTACAAAGGACAATATATTGTGACATTGAATAGGTAATTGGCTAGTCTATGCGTC.

[0008] In a second aspect, the present invention provides a KASP primer combination, comprising: F1: TGGGCTCATACTATATTGGATATTCTATTGAAC, F2: TGGGCTCATACTATATTGGATATTCTATTGAAT, R: TGTGGTTTTTCATTTTCTACTAATGGCT.

[0009] Furthermore, F1 and F2 in the KASP primer combination carry different fluorescent labels, including one or more of FAM, TET, HEX, ROX, Cy3, Cy5, Alexa Fluor, SYBR Green, DAPI, FITC or Texas Red.

[0010] For example, GAAGGTGACCAAGTTCATGCT (FAM) was linked to the 5' end of F1, and GAAGGTCGGAGTCAACGGATT (HEX) was linked to the 5' end of F2.

[0011] In a third aspect, the present invention provides a kit comprising the SNP site or the KASP primer combination.

[0012] In a fourth aspect, the present invention provides the use of the aforementioned SNP site, or the aforementioned KASP primer combination, or the aforementioned kit in any of the following: i) Detection of bee morphological traits, ii) breeding of genetically modified bees, iii) Improve the honey-collecting ability of bees, iv) improving bee germplasm resources, v) Molecular marker-assisted breeding of honey bees.

[0013] Furthermore, the detection of bee morphological traits includes: The genomic DNA of the bees to be tested is extracted, and the polymorphism of the SNP sites as described above is detected. The morphological traits of the bees to be tested are determined based on the detection results.

[0014] Furthermore, the detection method includes: gene sequencing, or PCR detection; the PCR detection adopts the aforementioned KASP primer combination, or the aforementioned kit for detection.

[0015] Furthermore, judging the morphological characteristics of the bees to be tested according to the test results includes: The bees with the T / T genotype as a result of the polymorphism detection have a shorter fourth dorsal plate length than the bees with the C / T detection result.

[0016] Furthermore, the bee is an oriental honey bee, preferably a cerana cerana cerana cerana.

[0017] The present invention has the following beneficial effects: The present invention provides a single nucleotide polymorphism (SNP) locus (Chr3_3465613), located at position 3465613 on chromosome 3. This SNP locus is associated with honeybee morphological traits. By detecting the polymorphism of this SNP locus, a honeybee morphological trait (length of the fourth dorsal plate) can be indirectly detected. The SNP locus provided by the present invention can be used in molecular marker-assisted breeding of honeybees. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 This is a comparison chart of the fourth dorsal plate length trait of individuals with different genotypes at the Chr3_3465613 locus provided in Example 2 of the present invention.

[0020] Figure 2 The electrophoresis diagram of the amplified Chr3_3465613 site provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0021] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0022] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0023] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0024] Example 1 1. The present invention measured the length of the fourth anterior dorsal plate of 110 colonies of Apis cerana cerana. Genomic DNA was extracted from the thorax tissue of the dissected worker bees. Library construction was then performed using the Truseq Nano DNA HT Kit (Illumina, USA). The DNA was randomly fragmented into 350 bp fragments. DNA libraries were obtained through end-repair, PloyA tailing, sequencing adapter addition, amplification, and purification. Insert size was quality-checked using an Agilent 2100, and the effective concentration of the library was accurately quantified using qPCR. Once the quality met the standards, DNA library construction was completed.

[0025] 2. Genome Sequencing, Alignment, and SNP Identification: After successful sample library construction, genome sequencing was performed on the Illumina HiseqPE150 platform (Illumina, USA). Low-quality reads were removed during sequencing to ensure quality [quality control criteria: reads containing more than 10% unknown nucleotides, reads containing adapter sequences, and reads with low-quality (phred quality < 5) bases exceeding 50% of the sequence length]. Finally, high-quality paired-end clean reads of at least 4.5G were generated for each honey bee sample, with Q20 and Q30 values ​​exceeding 90% and 85%, respectively.

[0026] 3. High-quality paired-end clean reads were aligned to the reference genome, Apis cerana (Genbank accession number: PRJNA738447), using BWA 0.7.8 software. Alignment results were deduplicated using SAMTOOLS 1.15 software. The average alignment rate for the population samples was maintained at over 95%, and the average sequencing depth across the genome was over 20X.

[0027] 4. A Bayesian model in SAMTOOLS 1.15 software was used to detect cluster SNPs. High-quality SNPs were screened based on quality control criteria (removing SNPs with a sequencing error rate >1% (Q20 quality control), removing SNPs with a base spacing of <5 between adjacent SNPs, and removing SNPs with a coverage depth exceeding 1 / 3 to 5 times the average). Detected SNPs were annotated using ANNOVAR 20130520 software to identify exons, introns, alternative splice sites, upstream and downstream regions, and intergenic regions, and to distinguish between synonymous and nonsynonymous SNPs.

[0028] 5. Genome-wide association analysis: Genome-wide association studies (GWAS) were conducted using mrMLM 1.3 software to clarify the association between the fourth dorsal plate length trait and SNPs. The SNP quality control standard was MAF>5%, and the multilocus random mixed linear model was selected as the model.

[0029] 6. Finally, the following SNP sites (partial) were obtained Table 1 SNP sites obtained by genome-wide association analysis

[0030] Among these SNP sites, experimental verification shows that Chr3_3465613 is closely related to the length of the fourth dorsal plate of honey bees. It is located at position 3465613 on chromosome 3 of honey bees, and the polymorphism is C / T, which means there are three genotypes: CC, CT and TT.

[0031] Example 2 The present invention selected 107 Chinese honey bee samples to carry out verification work to verify the correlation between the SNP site and the morphological trait (fourth dorsal plate length) of the Chinese honey bee involved in Example 1. Specifically, sequencing was performed on these 107 Chinese honey bees, and the fourth dorsal plate lengths of the 107 honey bees were measured using a microscopic measurement system to obtain the fourth dorsal plate length data and SNP data of the 107 honey bees; the honey bees were grouped according to the genotype type at the SNP site, and the fourth dorsal plate length data of different groups were analyzed for significance of differences using SPSS 16.0 software to compare whether there were differences in the fourth dorsal plate lengths among different genotypes.

[0032] Finally, we get Figure 1 The results shown in Table 1 show that Figure 1 The results showed that 54 Chinese bees showed C / C genotype, 40 Chinese bees showed C / T genotype, and 13 Chinese bees showed T / T genotype. According to Duncan data analysis (Table 1), the C / T genotype and the T / T genotype showed significant differences ( P <0.05), the length of the fourth dorsal plate of the T / T genotype Chinese honey bee was significantly smaller than that of the C / T genotype Chinese honey bee.

[0033] Table 1 Comparison of the length of the fourth dorsal plate in individuals with different genotypes at Ch3_3465613 locus in the Chinese honey bee

[0034] Example 3 The present invention further verifies the effects of the SNP sites in Example 1, specifically including: 1. Primer pairs are as follows: Upstream primer: 5'-TGCCACCGTATCAAAGAAGG-3', Downstream primer: 5′-GACGCATAGACTAGCCAATTACC-3′.

[0035] 2. The PCR system is as follows: Table 2 PCR system

[0036] The PCR procedure is as follows: Table 3 PCR program

[0037] 3. Test results The results are as follows Figure 2 As shown in the results, it can be seen that the electrophoresis bands of the amplified DNA fragments are clear and bright, without any mixed bands, indicating that the primers, amplification system and program have strong specificity and can amplify the bands carrying the target SNP sites.

[0038] Based on the amplified product, gene sequencing can be further used to detect the nucleotide sequence of the amplified product. The 167th nucleotide is the polymorphism of the SNP site (Chr3_3465613).

[0039] 4. The present invention further develops a KASP primer combination for the SNP molecular marker, as follows: F1: GAAGGTGACCAAGTTCATGCTTGGGCTCATACTATATTGGATATTCTATTGAAC, F2: GAAGGTCGGAGTCAACGGATTTGGGCTCATACTATATTGGATATTCTATTGAAT, R: TGTGGTTTTTCATTTTCTACTAATGGCT.

[0040] Among them, F1 carries FAM and F2 carries HEX. In actual situations, the KASP primer combination can be used to detect the sample to be tested. At the same time, the detection can be carried out using existing fluorescence equipment in the existing technology. The detection results of the FAM and HEX fluorescence channels can be used to determine whether the genotype of the sample to be tested is T / T (HEX fluorescence signal exceeds the threshold), C / T (both FAM and HEX fluorescence signals exceed the threshold), or C / C (FAM fluorescence signal exceeds the threshold).

[0041] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A SNP site, characterized in that: Based on the genome version PRJNA738447, the SNP site is located at position 3465613 of honey bee chromosome 3, and the polymorphism is C / T.

2. A SNP site, characterized in that: The SNP site includes the nucleic acid shown in SEQ ID NO.1, and the 167th position of the nucleic acid is a polymorphic site, and the polymorphism is C / T.

3. A KASP primer combination, characterized in that: The KASP primer combination includes: F1: TGGGCTCATACTATATTGGATATTCTATTGAAC, F2: TGGGCTCATACTATATTGGATATTCTATTGAAT, R: TGTGGTTTTTCATTTTCTACTAATGGCT.

4. A kit, characterized in that The kit comprises the SNP site according to claim 1 or 2, or the KASP primer combination according to claim 3.

5. Use of the SNP site according to claim 1 or 2, or the KASP primer combination according to claim 3, or the kit according to claim 4 in any of the following: i) Detection of bee morphological traits, ii) breeding of genetically modified bees, iii) Improve the honey-collecting ability of bees, iv) improving bee germplasm resources, v) Molecular marker-assisted breeding of honey bees.

6. The use according to claim 5, characterized in that The morphological traits of the bees detected include: Extract the genomic DNA of the bee to be tested, detect the polymorphism of the SNP site as claimed in claim 1 or 2, and determine the morphological characteristics of the bee to be tested based on the test results.

7. The use according to claim 6, characterized in that The detection method includes: gene sequencing, or PCR detection; the PCR detection adopts the KASP primer combination described in claim 3, or the kit described in claim 4 for detection.

8. The use according to any one of claims 5 to 7, characterized in that: Determining the morphological characteristics of the bees to be tested according to the test results includes: The bees with the T / T genotype as a result of the polymorphism detection have a shorter fourth dorsal plate length than the bees with the C / T detection result.

9. The use according to any one of claims 5 to 8, characterized in that: The honey bee is an oriental honey bee, preferably a cerana ....

Images