Primer group, kit and detection method for simultaneously realizing species identification and individual identification

Abstract

The invention discloses a primer group, a kit and a detection method for simultaneously realizing species identification and individual identification, and belongs to the technical field of forensic identification. The invention discloses a primer group for simultaneously realizing species identification and individual identification. The primer group comprises a primer sequence for amplifying 11 animal characteristic sequences and a primer sequence for amplifying 30 individual genetic markers STR. The invention also discloses a kit comprising the primer group, and a detection method for species identification and individual recognition by adopting the primer group. The method is suitable for trace detection materials, and is high in detection speed, low in detection cost and high in accuracy.

Description

Technical Field

[0001] The present invention belongs to the technical field of forensic evidence detection, and specifically relates to a primer set, a kit and a detection method for simultaneously realizing species identification and individual recognition. Background Art

[0002] In forensic evidence examination, the routine analysis process of biological samples at the crime scene usually includes two key steps: first, species identification to confirm the biological source of the sample, and then individual identification to determine the individual's identity. Species identification currently relies mainly on two molecular methods: (1) DNA barcoding technology: PCR amplification of specific gene fragments (such as Cytb, COI), first-generation sequencing, and sequence comparison of the obtained base sequence with the DNA barcode database to achieve species identification of the sample; (2) Multiplex fluorescence multiplex amplification-capillary electrophoresis method: Utilizing multiplex PCR to amplify specific markers, the product peaks are analyzed by capillary electrophoresis and compared with the known species map to achieve species identification.

[0003] Individual identification is also mainly based on two technologies: (1) Multiplex fluorescence composite amplification-capillary electrophoresis: multiplex PCR amplifies genetic markers such as STR, and uses capillary electrophoresis to analyze the amplified products to determine the number of STR marker repeats to achieve individual identification of samples; (2) Amplicon sequencing-based methods: multiplex PCR amplifies genetic markers such as SNPs, Indels, or STRs, constructs an amplicon library, and then performs second-generation sequencing. Subsequently, through bioinformatics analysis, the sequence information of the genetic markers is obtained and typing is completed, thereby achieving accurate identification of individual identity.

[0004] While the aforementioned methods can accurately perform both species and individual identification for routine specimens, the entire two-step process is cumbersome, costly, and time-consuming, making it difficult to rapidly generate analytical reports for critical physical evidence in emergency cases. For trace specimens with extremely low nucleic acid content, the limited amount of nucleic acid makes it difficult to simultaneously perform both identifications. Skipping species identification and proceeding directly to individual identification significantly reduces the accuracy and credibility of the results, potentially leading to erroneous conclusions and seriously misleading the direction of investigation.

[0005] Therefore, there is an urgent need to develop a new identification method that can integrate species identification and individual recognition, significantly shorten the detection cycle, and be effectively applicable to trace biological samples, so as to improve the efficiency and reliability of forensic evidence identification. Summary of the Invention

[0006] One of the objectives of the present invention is to provide a primer set that can simultaneously achieve species identification and individual recognition, which is suitable for trace samples, has a fast detection speed, low detection cost and high accuracy.

[0007] A second object of the present invention is to provide a detection kit.

[0008] A third object of the present invention is to provide a detection method that can simultaneously achieve species identification and individual recognition.

[0009] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0010] The first aspect of the present invention discloses a primer set for simultaneously achieving species identification and individual recognition, comprising primer sequences for amplifying 11 animal characteristic sequences and primer sequences for amplifying 30 human genetic markers (STRs). The nucleotide sequences of the primer sequences for amplifying the 11 animal characteristic sequences are as follows:

[0011] A primer pair for amplifying the region from sites 52374846 to 52375089 on mouse chr11, the nucleotide sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively;

[0012] The primer pair for amplifying the region from position 143228785 to position 143228954 on porcine chr2 has nucleotide sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively;

[0013] The primer pair for amplifying the region from positions 51173957 to 51174216 on bovine chr18 has nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively;

[0014] The primer pair for amplifying the region from sites 61862557 to 61862724 on sheep 1 has nucleotide sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively;

[0015] The primer pair for amplifying the region from position 6783635 to position 6783891 on chicken chr19 has the nucleotide sequences shown in SEQ ID NO.9 and SEQ ID NO.10, respectively;

[0016] The primer pair for amplifying the region from position 412474 to position 412727 on rabbit chr3 has the nucleotide sequences shown in SEQ ID NO.11 and SEQ ID NO.12, respectively;

[0017] A primer pair for amplifying the region from positions 16596472 to 16596638 on dog chr7, the nucleotide sequences of which are shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively;

[0018] The primer pair for amplifying the region from positions 38934601 to 38934793 on monkey NC_041754.1, whose nucleotide sequences are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively;

[0019] The primer pair amplified the region from position 77898948 to position 77899168 on duck NC_051804.1, and the nucleotide sequences thereof are shown in SEQ ID NO. 17 and SEQ ID NO. 18, respectively;

[0020] The primer pair amplifying the region from position 34505780 to position 34506035 on fish NC_035916.1, the nucleotide sequences of which are shown in SEQ ID NO. 19 and SEQ ID NO. 20, respectively;

[0021] A primer pair for amplifying the region from positions 123643 to 123901 on frog NW_017307550.1, the nucleotide sequences of which are shown in SEQ ID NO. 21 and SEQ ID NO. 22, respectively;

[0022] The nucleotide sequences of the primer sequences for amplifying 30 human genetic markers STR are as follows:

[0023] The primer pair for amplifying the locus DYS385a has the nucleotide sequences of SEQ ID NO. 23 and SEQ ID NO. 24, respectively.

[0024] As shown;

[0025] The primer pair for amplifying the locus DYS392 has the nucleotide sequences shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively;

[0026] The primer pair for amplifying the locus DYS635 has the nucleotide sequences shown in SEQ ID NO. 27 and SEQ ID NO. 28, respectively;

[0027] The primer pair for amplifying the locus DYS19, whose nucleotide sequences are shown in SEQ ID NO. 29 and SEQ ID NO. 30 respectively;

[0028] The primer pair for amplifying the locus DYS389I has the nucleotide sequences shown in SEQ ID NO. 31 and SEQ ID NO. 32, respectively;

[0029] The primer pair for amplifying the locus DYS389II has the nucleotide sequences shown in SEQ ID NO. 33 and SEQ ID NO. 34, respectively;

[0030] The primer pair for amplifying the locus DYS439, whose nucleotide sequences are shown in SEQ ID NO. 35 and SEQ ID NO. 36, respectively;

[0031] The primer pair for amplifying the Y-GATA-H4 locus has the nucleotide sequences shown in SEQ ID NO. 37 and SEQ ID NO. 38, respectively;

[0032] The primer pair for amplifying the locus DYS458 has the nucleotide sequences shown in SEQ ID NO. 39 and SEQ ID NO. 40, respectively;

[0033] The primer pair for amplifying the locus DYS481 has the nucleotide sequences shown in SEQ ID NO. 41 and SEQ ID NO. 42, respectively;

[0034] The primer pair for amplifying the locus DYS391, whose nucleotide sequences are shown in SEQ ID NO. 43 and SEQ ID NO. 44, respectively;

[0035] The primer pair for amplifying the locus DYS576 has the nucleotide sequences shown in SEQ ID NO. 45 and SEQ ID NO. 46, respectively;

[0036] The primer pair for amplifying the locus DYS533 has the nucleotide sequences shown in SEQ ID NO. 47 and SEQ ID NO. 48, respectively;

[0037] The primer pair for amplifying the locus DYS393 has the nucleotide sequences shown in SEQ ID NO. 49 and SEQ ID NO. 50, respectively;

[0038] The primer pair for amplifying the locus DYS437 has the nucleotide sequences shown in SEQ ID NO. 51 and SEQ ID NO. 52, respectively;

[0039] The primer pair for amplifying the locus DYS456 has the nucleotide sequences shown in SEQ ID NO. 53 and SEQ ID NO. 54, respectively;

[0040] The primer pair for amplifying the locus DYS448 has the nucleotide sequences shown in SEQ ID NO. 55 and SEQ ID NO. 56, respectively;

[0041] The primer pair for amplifying the locus DYS390 has the nucleotide sequences shown in SEQ ID NO. 57 and SEQ ID NO. 58, respectively;

[0042] The primer pair for amplifying the locus D8S1179 has the nucleotide sequences shown in SEQ ID NO. 59 and SEQ ID NO. 60, respectively;

[0043] The primer pair for amplifying the locus D7S820 has the nucleotide sequences shown in SEQ ID NO. 61 and SEQ ID NO. 62, respectively;

[0044] The primer pair for amplifying locus D1S1656 has the nucleotide sequences shown in SEQ ID NO. 63 and SEQ ID NO. 64, respectively;

[0045] The primer pair for amplifying the locus TPOX, whose nucleotide sequences are shown in SEQ ID NO. 65 and SEQ ID NO. 66 respectively;

[0046] The primer pair for amplifying the locus D16S539 has the nucleotide sequences shown in SEQ ID NO. 67 and SEQ ID NO. 68, respectively;

[0047] The primer pair for amplifying the locus FGA, whose nucleotide sequences are shown in SEQ ID NO. 69 and SEQ ID NO. 70 respectively;

[0048] The primer pair for amplifying locus D3S1358 has the nucleotide sequences shown in SEQ ID NO. 71 and SEQ ID NO. 72, respectively;

[0049] The primer pair for amplifying the locus D13S317, whose nucleotide sequences are shown in SEQ ID NO. 73 and SEQ ID NO. 74, respectively;

[0050] The primer pair for amplifying the locus D19S433 has the nucleotide sequences shown in SEQ ID NO. 75 and SEQ ID NO. 76, respectively;

[0051] The primer pair for amplifying locus D5S818 has the nucleotide sequences shown in SEQ ID NO. 77 and SEQ ID NO. 78, respectively;

[0052] The primer pair for amplifying the CSF1PO locus has the nucleotide sequences shown in SEQ ID NO. 79 and SEQ ID NO. 80, respectively;

[0053] The nucleotide sequences of the primer pair for amplifying the locus D18S51 are shown in SEQ ID NO.81 and SEQ ID NO.82, respectively.

[0054] An upstream universal sequence was added to the 5' end of all upstream primers. The upstream universal sequence was 5'ACACGACGCTCTTCCGATCT3', as shown in SEQ ID NO.83. This upstream universal sequence is a partial sequence at the 3' end of the Illumina upstream adapter sequence. A downstream universal sequence was added to the 5' end of all downstream primers. The downstream universal sequence was 5'CTTGGCACCCGAGAATTCCA3', as shown in SEQ ID NO.84. This downstream universal sequence is a partial sequence at the 3' end of the Illumina downstream adapter sequence.

[0055] The second aspect of the present invention discloses a kit for simultaneously achieving species identification and individual recognition, comprising the above-mentioned primer set.

[0056] A third aspect of the present invention discloses a detection method for simultaneously achieving species identification and individual recognition, comprising the following steps:

[0057] S1. Extract DNA from the sample to be tested to obtain a DNA sample;

[0058] S2. The primers of SEQ ID NO.1-82 with the addition of the universal sequence were mixed to obtain a multiple primer mixture solution, and then the DNA extracted in step S1 was subjected to a multiplex PCR reaction;

[0059] S3. Purify the multiplex PCR reaction product of step S2;

[0060] S4. Using an adapter PCR reaction, the next-generation sequencing adapter sequences are introduced onto both sides of the PCR reaction product to generate an amplicon library;

[0061] S5. Purify the amplicon library;

[0062] S6. Perform quality control on the amplicon library, followed by sequencing and data analysis to determine the species and / or individual of the sample.

[0063] In some embodiments of the present invention, the starting amount of gDNA required for the multiplex PCR reaction in step S2 is greater than or equal to 500 pg.

[0064] In some embodiments of the present invention, the amplification reaction system of the multiplex PCR reaction in step S2 is as follows:

[0065]

[0066] The multiple primer mixture solution contains the primer set described in SEQ ID NO. 1 to 82; the total concentration of the primer set is 10 to 40 μM, preferably 20 μM; and the concentration of each primer is the same.

[0067] In some embodiments of the present invention, the reaction conditions of the multiplex PCR in step S2 are as follows: incubation at 95°C for 3 minutes and 30 seconds; followed by 19 cycles of amplification, each cycle first maintaining at 95°C for 20 seconds and then maintaining at 60°C for 4 minutes; after the cycle is completed, a final incubation at 72°C for 5 minutes.

[0068] In some embodiments of the present invention, in step S4, the linker sequence used for the upstream primer is shown as SEQ ID NO. 85, and the linker sequence used for the downstream primer is shown as SEQ ID NO. 86.

[0069] In some embodiments of the present invention, the amplification system of the linker PCR reaction in step S4 is as follows:

[0070]

[0071] The concentration of the adapter sequence premix is ​​5-20 μM, preferably 10 μM; the concentration of each primer is the same.

[0072] In some embodiments of the present invention, the linker PCR reaction conditions in step S4 are as follows: first, react at 95°C for 3 minutes and 30 seconds for initial denaturation; then enter the cycling stage, and repeat 9 rounds of the following operations: the temperature is raised to 95°C and maintained for 20 seconds to achieve denaturation, then dropped to 60°C and maintained for 1 minute to complete annealing, and then raised to 72°C and maintained for 30 seconds for extension; after the cycle is completed, the reaction system is transferred to a 72°C environment and incubated for 5 minutes to ensure final extension; finally, the temperature is set to 4°C and maintained continuously, waiting for subsequent processing.

[0073] In some embodiments of the present invention, steps S3 and S5 are both purified using purification magnetic beads.

[0074] In some embodiments of the present invention, in step S6, the sequencing data is subjected to bioinformatics analysis. First, characteristic sequences related to the identification of 11 animal species are compared and analyzed to achieve species identification of the sample; then, the sequences of 30 STRs are analyzed to determine the number of repeats to achieve individual identification of the sample.

[0075] The characteristic sequence coordinate information for the identification of 11 animal species described in the present invention is shown in Table 1:

[0076] Table 1 Characteristic sequence coordinate information for species identification of 11 animals

[0077] Species name Chromosome number Start site Termination site Length (bp) mice chr11 52374846 52375089 243 pig chr2 143228785 143228954 169 ox chr18 51173957 51174216 259 sheep 1 61862557 61862724 167 chicken chr19 6783635 6783891 256 rabbit chr3 412474 412727 253 dog chr7 16596472 16596638 166 monkey NC_041754.1 38934601 38934793 192 duck NC_051804.1 77898948 77899168 220 fish NC_035916.1 34505780 34506035 255 frog NW_017307550.1 123643 123901 258

[0078] The primer sequences for amplifying characteristic sequences of 11 animals are shown in Table 2.

[0079] Table 2 Primer sequences for amplifying characteristic sequences of 11 species of animals

[0080]

[0081]

[0082] The STR names and coordinate information of the 30 individuals identified are shown in Table 3:

[0083] Table 3 STR names and coordinate information for identification of 30 individuals

[0084]

[0085]

[0086] Table 4 Primer sequence information for amplifying 30 STRs

[0087]

[0088] Table 5 Base information of upstream and downstream adapter sequences on the Illumina sequencing platform

[0089]

[0090] Compared with the prior art, the present invention has the following beneficial effects:

[0091] The present invention is scientifically designed and ingeniously conceived. For conventional specimens, the present invention can simultaneously complete biological species identification and human individual identity identification through a single experimental process. Compared with traditional step-by-step detection methods, it significantly shortens the detection cycle and reduces the cost of reagents and consumables. For trace specimens, this method can simultaneously obtain species identification conclusions and individual identity identification data under trace nucleic acid conditions. Compared with the existing two-step method, it effectively reduces the risk of information loss in step-by-step detection, significantly improves the accuracy of test results and the credibility of judicial evidence, thereby providing more convincing key physical evidence support for case detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Attachment Figure 1 Flow chart of the detection method of the present invention; Figure 1 The test results in the table are only examples;

[0093] Attachment Figure 2 This is the quality control result of the amplicon library fragment range. DETAILED DESCRIPTION

[0094] In order to make the purpose, technical solutions and advantages of the present invention clearer, the present invention is further described in detail below with reference to specific examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0095] The reagent information used in the examples of the present invention is as follows:

[0096] DNA polymerase premix was purchased from Aigitaikang Biotechnology (Beijing) Co., Ltd., catalog number M61022;

[0097] The template for the multiplex PCR reaction was artificially mixed gDNA, including gDNA from 11 species of animals and human gDNA, with an initial amount of 500 pg. Human gDNA was a standard (2800 M) used in forensic evidence identification and was purchased from Promega Corporation in the United States (catalog number DD7101).

[0098] Purification magnetic beads were purchased from Beijing Aijitaikang, catalog number C80661;

[0099] The adapter sequence premix was purchased from Aigitaikang Biotechnology (Beijing) Co., Ltd., catalog number M70062.

[0100] Example 1

[0101] This embodiment discloses a novel method for simultaneously performing species identification and individual identification on trace specimens, comprising the following steps:

[0102] Step 1: Multiplex PCR using primer mixes on trace amounts of gDNA

[0103] This example uses artificially mixed gDNA as the DNA sample to be tested. The artificially mixed gDNA in this example includes gDNA from 11 animals and human gDNA, with a starting amount of 500 pg. The 11 animals are mice, pigs, cattle, sheep, chickens, rabbits, dogs, monkeys, ducks, fish, and frogs. The amplification system of the multiplex PCR reaction is shown in Table 6, and the reaction conditions of the multiplex PCR are shown in Table 7. The multiplex primer mixture solution contains a primer set (SEQ ID NO.1-82) pre-added with a universal sequence, and the total concentration of the primer set is 20 μM; the concentration of each primer is the same. Among them: the universal sequence 5'ACACGACGCTCTTCCGATCT3' (SEQ ID NO.83) is added to the 5' end of all upstream primers; the universal sequence 5'CTTGGCACCCGAGAATTCCA3' (SEQ ID NO.84) is added to the 5' end of all downstream primers.

[0104] Table 6 Amplification system for multiplex PCR reaction

[0105] Reagents Volume (μl) <![CDATA[ddH2O]]> 10 Multiple primer mixture solution (20 μM) 5 Mixed gDNA 5 DNA polymerase premix (3X) 10

[0106] Table 7 Reaction conditions for multiplex PCR

[0107]

[0108] Step 2: Purify the multiplex PCR reaction products from step 1 using purification magnetic beads

[0109] 2.1 Add 27 μl (0.9X) purified magnetic beads equilibrated at room temperature to 30 μl of multiplex PCR reaction product, pipette up and down 20 times to mix, and incubate at room temperature for 5 min.

[0110] 2.2 Place the PCR tube on the magnetic stand and let it stand for 3 minutes. After all the magnetic beads are adsorbed to the wall of the PCR tube, remove the supernatant with a pipette;

[0111] 2.3 Add 180 μl of 80% ethanol to the PCR reaction tube, let it stand for 30 seconds, and then remove the supernatant with a pipette;

[0112] 2.4 Add 180 μl of ethanol (80%) to the PCR reaction tube, let it stand for 30 seconds, and then discard the supernatant with a pipette.

[0113] 2.5 After standing for 4 minutes, add 25 μl of ddH2O to the PCR reaction tube, then mix the magnetic beads and ddH2O with a pipette. After standing at room temperature for 2 minutes, transfer to the magnetic rack;

[0114] 2.6 Let the tube stand for 3 minutes. After all the magnetic beads have been adsorbed to the wall of the PCR tube, use a pipette to transfer 20 μl of the supernatant to a new PCR reaction tube. The liquid in the tube is the pure multiplex PCR reaction product.

[0115] Step 3: Use adapter PCR reaction to introduce the second-generation sequencing adapter sequences to both sides of the PCR reaction product to obtain an amplicon library;

[0116] The amplification system for the adapter PCR reaction is shown in Table 8, and the reaction conditions are shown in Table 9. The adapter sequence premix (10 μM) contains the primer set described in SEQ ID NOs. 85-86. The total concentration of the primer set is 10 μM, and the concentration of each primer is the same.

[0117] Table 8 Amplification system of linker PCR reaction

[0118] Reagents Volume (μl) <![CDATA[ddH2O]]> 5 Adapter sequence premix (10 μM) 1 Multiplex PCR products after purification in step 2 14 DNA polymerase premix (3X) 10

[0119] Table 9 Conditions for the linker PCR reaction

[0120]

[0121] Step 4: Purify the amplicon library using purification magnetic beads

[0122] 4.1 Add 27 μl (0.9X) purified magnetic beads equilibrated at room temperature to 30 μl of the adapter PCR reaction product, pipette up and down 20 times to mix, and incubate at room temperature for 5 minutes.

[0123] 4.2 Place the PCR tube on a magnetic stand and let it sit for 3 minutes. After all the magnetic beads have been adsorbed to the wall of the PCR tube, remove the supernatant with a pipette.

[0124] 4.3 Add 180 μl of 80% ethanol to the PCR reaction tube, let it stand for 30 seconds, and then remove the supernatant with a pipette;

[0125] 4.4 Add 180 μl of ethanol (80%) to the PCR reaction tube, let it stand for 30 seconds, and then discard the supernatant with a pipette.

[0126] 4.5 After standing for 4 minutes, add 25 μl of ddH2O to the PCR reaction tube, then mix the magnetic beads and ddH2O using a pipette. After standing at room temperature for 2 minutes, transfer to the magnetic rack.

[0127] 4.6 Let stand for 3 minutes. After all the magnetic beads have been adsorbed to the wall of the PCR tube, use a pipette to transfer 20 μl of the supernatant to a new PCR reaction tube. The liquid in the tube is the pure amplicon library.

[0128] Step 5: Perform quality control on the amplicon library, followed by sequencing and data analysis

[0129] 5.1 The amplicon library was quantified using Qubit 4.0. The library concentration was 24.5 ng / μl, which met the requirements.

[0130] 5.2 Use Qsep capillary electrophoresis instrument to detect the range of library fragments. The quality inspection results are as follows: Figure 2 As shown, the main peak is 370bp, there is no primer dimer peak before the main peak, and there is no non-specific amplified fragment peak after the main peak, and the quality inspection is qualified;

[0131] 5.3 The amplicon library was subjected to second-generation sequencing (Illumina Novaseq6000 sequencing platform, PE250 sequencing mode), and the sequencing data were statistically analyzed: the average sequencing depth was 3240X, the 10X coverage was 100%, and the sequencing uniformity was 97%, indicating that all target regions were covered and the sequencing depth was uniform.

[0132] Table 10 Statistical indicators of mixed gDNA amplicon library sequencing data

[0133] Raw data (Mb) Data effectiveness (%) Average sequencing depth (X) 10X coverage Homogeneity 205 90％ 3240X 100％ 97％

[0134] 5.4 Comparison and analysis of characteristic sequences from 11 animal species accurately identified the species in the mixed gDNA (Table 11). Sequence analysis of 30 STRs determined the STR repeat counts, which were highly consistent with those provided by the 2800M standard, demonstrating the accuracy of the STR identification results.

[0135] Table 11 Species identification results of mixed gDNA

[0136] Species name Chromosome number Start site Termination site Length (bp) Coverage Identification results mice chr11 52374846 52375089 243 100％ mice pig chr2 143228785 143228954 169 100％ pig ox chr18 51173957 51174216 259 100％ ox sheep 1 61862557 61862724 167 100％ sheep chicken chr19 6783635 6783891 256 100％ chicken rabbit chr3 412474 412727 253 100％ rabbit dog chr7 16596472 16596638 166 100％ dog monkey NC_041754.1 38934601 38934793 192 100％ monkey duck NC_051804.1 77898948 77899168 220 100％ duck fish NC_035916.1 34505780 34506035 255 100％ fish frog NW_017307550.1 123643 123901 258 100％ frog

[0137] Table 12 Identification results of 30 STRs

[0138]

[0139]

[0140] The above results show that the method of the present invention can simultaneously realize species identification and individual identification, with fast detection speed, low detection cost and high accuracy.

[0141] The above description is only a preferred embodiment of the present invention, which is merely illustrative and not restrictive of the present invention. A person skilled in the art will understand that many changes, modifications, and even equivalent changes may be made thereto within the spirit and scope defined by the claims of the present invention, but all of these changes will fall within the scope of protection of the present invention.

Claims

1. A primer set for simultaneously achieving species identification and individual identification, characterized in that: The invention comprises primer sequences for amplifying characteristic sequences of 11 kinds of animals and primer sequences for amplifying 30 human genetic markers STR. The nucleotide sequences of the primer sequences for amplifying characteristic sequences of 11 kinds of animals are as follows: A primer pair for amplifying the region from sites 52374846 to 52375089 on mouse chr11, the nucleotide sequences of which are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively; The primer pair for amplifying the region of positions 143228785 to 143228954 on porcine chr2 has nucleotide sequences shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively; The primer pair for amplifying the region from positions 51173957 to 51174216 on bovine chr18 has nucleotide sequences shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively; The primer pair for amplifying the region from sites 61862557 to 61862724 on sheep 1 has nucleotide sequences shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively; The primer pair for amplifying the region from position 6783635 to position 6783891 on chicken chr19 has the nucleotide sequences shown in SEQ ID NO.9 and SEQ ID NO.10, respectively; The primer pair for amplifying the region from positions 412474 to 412727 on rabbit chr3 has nucleotide sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12, respectively; A primer pair for amplifying the region from positions 16596472 to 16596638 on dog chr7, the nucleotide sequences of which are shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively; The primer pair for amplifying the region from positions 38934601 to 38934793 on monkey NC_041754.1, whose nucleotide sequences are shown in SEQ ID NO. 15 and SEQ ID NO. 16, respectively; The primer pair amplified the region from position 77898948 to position 77899168 on duck NC_051804.1, and the nucleotide sequences thereof are shown in SEQ ID NO. 17 and SEQ ID NO. 18, respectively; The primer pair amplifying the region from position 34505780 to position 34506035 on fish NC_035916.1, the nucleotide sequences of which are shown in SEQ ID NO. 19 and SEQ ID NO. 20, respectively; A primer pair for amplifying the region from positions 123643 to 123901 on frog NW_017307550.1, the nucleotide sequences of which are shown in SEQ ID NO. 21 and SEQ ID NO. 22, respectively; The nucleotide sequences of the primer sequences for amplifying 30 human genetic markers STR are as follows: The primer pair for amplifying the locus DYS385a has the nucleotide sequences shown in SEQ ID NO. 23 and SEQ ID NO. 24, respectively; The primer pair for amplifying the locus DYS392 has the nucleotide sequences shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively; The primer pair for amplifying the locus DYS635 has the nucleotide sequences shown in SEQ ID NO. 27 and SEQ ID NO. 28, respectively; The primer pair for amplifying the locus DYS19, whose nucleotide sequences are shown in SEQ ID NO. 29 and SEQ ID NO. 30 respectively; The primer pair for amplifying the locus DYS389I has the nucleotide sequences shown in SEQ ID NO. 31 and SEQ ID NO. 32, respectively; The primer pair for amplifying the locus DYS389II has the nucleotide sequences shown in SEQ ID NO. 33 and SEQ ID NO. 34, respectively; The primer pair for amplifying the locus DYS439 has the nucleotide sequences shown in SEQ ID NO. 35 and SEQ ID NO. 36, respectively; The primer pair for amplifying the Y-GATA-H4 locus has the nucleotide sequences shown in SEQ ID NO. 37 and SEQ ID NO. 38, respectively; The primer pair for amplifying the locus DYS458 has the nucleotide sequences shown in SEQ ID NO. 39 and SEQ ID NO. 40, respectively; The primer pair for amplifying the locus DYS481 has the nucleotide sequences shown in SEQ ID NO. 41 and SEQ ID NO. 42, respectively; The primer pair for amplifying the locus DYS391, whose nucleotide sequences are shown in SEQ ID NO. 43 and SEQ ID NO. 44, respectively; The primer pair for amplifying the locus DYS576 has the nucleotide sequences shown in SEQ ID NO. 45 and SEQ ID NO. 46, respectively; The primer pair for amplifying the locus DYS533 has the nucleotide sequences shown in SEQ ID NO. 47 and SEQ ID NO. 48, respectively; The primer pair for amplifying the locus DYS393 has the nucleotide sequences shown in SEQ ID NO. 49 and SEQ ID NO. 50, respectively; The primer pair for amplifying the locus DYS437 has the nucleotide sequences shown in SEQ ID NO. 51 and SEQ ID NO. 52, respectively; The primer pair for amplifying the locus DYS456 has the nucleotide sequences shown in SEQ ID NO. 53 and SEQ ID NO. 54, respectively; The primer pair for amplifying the locus DYS448 has the nucleotide sequences shown in SEQ ID NO. 55 and SEQ ID NO. 56, respectively; The primer pair for amplifying the locus DYS390 has the nucleotide sequences shown in SEQ ID NO. 57 and SEQ ID NO. 58, respectively; The primer pair for amplifying the locus D8S1179 has the nucleotide sequences shown in SEQ ID NO. 59 and SEQ ID NO. 60, respectively; The primer pair for amplifying the locus D7S820 has the nucleotide sequences shown in SEQ ID NO. 61 and SEQ ID NO. 62, respectively; The primer pair for amplifying locus D1S1656 has the nucleotide sequences shown in SEQ ID NO. 63 and SEQ ID NO. 64, respectively; The primer pair for amplifying the TPOX locus has nucleotide sequences shown in SEQ ID NO. 65 and SEQ ID NO. 66, respectively; The primer pair for amplifying the locus D16S539 has the nucleotide sequences shown in SEQ ID NO. 67 and SEQ ID NO. 68, respectively; The primer pair for amplifying the locus FGA, whose nucleotide sequences are shown in SEQ ID NO. 69 and SEQ ID NO. 70 respectively; The primer pair for amplifying locus D3S1358 has the nucleotide sequences shown in SEQ ID NO. 71 and SEQ ID NO. 72, respectively; The primer pair for amplifying locus D13S317 has the nucleotide sequences shown in SEQ ID NO. 73 and SEQ ID NO. 74, respectively; The primer pair for amplifying the locus D19S433 has the nucleotide sequences shown in SEQ ID NO. 75 and SEQ ID NO. 76, respectively; The primer pair for amplifying locus D5S818 has the nucleotide sequences shown in SEQ ID NO. 77 and SEQ ID NO. 78, respectively; The primer pair for amplifying the CSF1PO locus has the nucleotide sequences shown in SEQ ID NO. 79 and SEQ ID NO. 80, respectively; The nucleotide sequences of the primer pair for amplifying the locus D18S51 are shown in SEQ ID NO.81 and SEQ ID NO.82, respectively.

2. The primer set according to claim 1, characterized in that An upstream universal sequence was added to the 5' end of all upstream primers. The upstream universal sequence was 5'ACACGACGCTCTTCCGATCT3', as shown in SEQ ID NO.83; a downstream universal sequence was added to the 5' end of all downstream primers. The downstream universal sequence was 5'CTTGGCACCCGAGAATTCCA3', as shown in SEQ ID NO.

84.

3. A kit for simultaneously achieving species identification and individual identification, characterized in that: Comprising the primer set according to claim 1 or 2.

4. A detection method for simultaneously achieving species identification and individual recognition, characterized in that: The steps include: S1. Extract DNA from the sample to obtain a DNA sample; S2. performing a multiplex PCR reaction using the primer set according to claim 2; S3. Purify the multiplex PCR reaction product of step S2; S4. Using an adapter PCR reaction, the next-generation sequencing adapter sequences are introduced onto both sides of the PCR reaction product to generate an amplicon library; S5. Purify the amplicon library; S6. Perform quality control on the amplicon library, followed by sequencing and data analysis to determine the species information and / or individual identity information of the sample.

5. The detection method according to claim 4, characterized in that The starting amount of gDNA for the multiplex PCR reaction in step S2 is greater than or equal to 500 pg.

6. The detection method according to claim 4, characterized in that The amplification reaction system of the multiplex PCR reaction in step S2 is as follows: The multiple primer mixture solution contains the primer set according to claim 2; the total concentration of the primer set is 10 to 40 μM, preferably 20 μM; and the concentration of each primer is the same. Preferably, the reaction conditions of the multiplex PCR in step S2 are as follows: incubation at 95°C for 3 minutes and 30 seconds; followed by 19 cycles of amplification, each cycle first maintaining at 95°C for 20 seconds and then maintaining at 60°C for 4 minutes; after the cycle is completed, finally incubating at 72°C for 5 minutes.

7. The detection method according to claim 4, characterized in that In step S4, the linker sequence used for the upstream primer is shown as SEQ ID NO.85, and the linker sequence used for the downstream primer is shown as SEQ ID NO.

86.

8. The detection method according to claim 7, characterized in that The amplification system of the linker PCR reaction in step S4 is as follows: The concentration of the adapter sequence premix is ​​5-20 μM, preferably 10 μM; the concentration of each primer is the same.

9. The detection method according to claim 7, characterized in that The linker PCR reaction conditions in step S4 are as follows: first, react at 95°C for 3 minutes and 30 seconds for initial denaturation; then enter the cycling stage and repeat the following 9 rounds: the temperature is raised to 95°C and maintained for 20 seconds to achieve denaturation, then lowered to 60°C and maintained for 1 minute to complete annealing, and then raised to 72°C and maintained for 30 seconds for extension; after the cycle is completed, the reaction system is transferred to a 72°C environment and incubated for 5 minutes to ensure final extension; finally, the temperature is set to 4°C and maintained continuously for subsequent processing; preferably, purification magnetic beads are used for purification in steps S3 and S5.

10. The detection method according to claim 4, characterized in that: In step S6, the sequencing data is subjected to bioinformatics analysis. First, characteristic sequences related to the identification of 11 animal species are compared and analyzed to achieve species identification of the sample. Then, the sequences of 30 STRs are analyzed to determine the number of repeats and achieve individual identification of the sample.

Images