Application of SNP (Single Nucleotide Polymorphism) molecular marker related to pig total litter size character

Abstract

The invention belongs to the technical field of pig molecular marker-assisted selection, and particularly relates to application of an SNP molecular marker related to the total litter size character of pigs. The SNP molecular marker is located at the basic group of the 33289690th site of the ninth chromosome in a pig genome Sscrofa11.1. 109, the SNP site of the molecular marker has C / T polymorphism, and T is the favorable allelic variation of the pig total litter size character. The dominant alleles of the SNP are preferably selected, the frequency of the dominant alleles can be increased generation by generation, the total litter size of pigs is increased, and the genetic improvement progress of the pigs is accelerated, so that the breeding and production benefits are effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of pig molecular marker assisted selection, and in particular to an application of a SNP molecular marker related to the total litter size trait of pigs. Background Art

[0002] Total number of pigs born (TNB) is one of the most critical reproductive traits in modern swine farming. With global population growth and rising demand for meat, improving pig reproductive efficiency has become a key strategic goal for the sustainable development of the livestock industry. Statistics show that every increase in TNB significantly reduces unit breeding costs, reduces feed and land resource consumption, and improves the economic benefits of pig farms.

[0003] Genetic studies have shown that TNB has moderate to high heritability (heritability of approximately 0.3-0.5), indicating that this trait can be effectively improved through genetic improvement. Traditional phenotypic-based breeding is effective, but it has significant limitations. Phenotypic data on sow reproductive traits can only be obtained after they reach sexual maturity (usually 12-18 months of age), resulting in long generation intervals and low breeding efficiency. In addition, TNB is greatly affected by environmental factors (such as feeding management, stress, etc.), and it is difficult to fully distinguish genetic potential through phenotypic data. Therefore, traditional breeding methods face bottlenecks such as long cycles, high costs, and difficulties in early screening due to their reliance on phenotypic selection. More accurate molecular marker technology is urgently needed to accelerate the breeding process.

[0004] In recent years, genomic technology has developed rapidly, making it possible to explore the core genes and molecular mechanisms that regulate total litter size. Molecular marker-assisted breeding utilizes the characteristics of molecular markers being closely linked to target trait genes. By detecting molecular markers, the presence of target genes can be detected, achieving the purpose of selecting target traits. It has the advantages of being fast, accurate, and not affected by environmental conditions. Single nucleotide polymorphism (SNP) is a type of molecular marker. It refers to a change in DNA sequence caused by a variation of a single nucleotide at the same position in the genome between individuals, which can subsequently affect gene expression, transcriptional activity, and splicing modifications. Screening for genes and genetic markers such as SNPs related to the total litter size trait of pigs, combined with marker-assisted breeding methods, allows for early selection of pigs, providing an efficient tool for rapid screening of high-fertility sows. Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to the total litter size of pigs, so as to provide guidance for the total litter size performance detection of pig reproduction or molecular marker-assisted breeding.

[0006] The technical solutions of the present invention are as follows:

[0007] The present invention provides a pig SNP molecular marker, which is located at the base of position 33289690 of chromosome 9 in the pig genome Sscrofa11.1.109. The SNP site of the molecular marker has a C / T polymorphism, wherein T is a favorable allele variation for increasing the total litter size of pigs.

[0008] Application of the porcine SNP molecular marker and the substance for detecting the porcine SNP molecular marker in any of the following aspects:

[0009] Used to detect or assist in detecting the total litter size trait of pigs;

[0010] Genetic breeding for improving total litter size traits in pigs;

[0011] Preferably, the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO.1.

[0012] In the present invention, the substance for detecting pig SNP molecular markers includes PCR primers for amplifying genomic DNA fragments including the molecular marker SNP site, or a kit containing the primers.

[0013] Preferably, the nucleotide sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3.

[0014] Preferably, the kit further comprises a PCR amplification reagent.

[0015] The present invention also provides a method for detecting the total litter size trait of pigs, comprising: detecting the base type at position 33289690 of chromosome 9 of the pig genome, and the total litter size of TC genotype and CC genotype groups is less than that of TT genotype groups.

[0016] Preferably, the method for detecting the base type at position 33289690 of chromosome 9 of the pig genome includes: designing primers to amplify the nucleotide sequence shown in SEQ ID NO.1, using the primers to perform PCR amplification on pig genomic DNA, and detecting the genotype at position 500 in the gene sequence of the amplified product.

[0017] Further preferably, the genotype of the 9:33289690C>T site is obtained by Sanger sequencing.

[0018] The present invention also provides a genetic breeding method for increasing the total litter size trait of pigs, comprising: determining the base type of position 33289690 of chromosome 9 of pigs in a pig core group, and making corresponding selections based on the base type:

[0019] The successive breeding of breeding pigs selects individuals with TT and TC bases at position 33289690 of chromosome 9, and eliminates CC individuals, so as to increase the frequency of gene T at this position from generation to generation, thereby increasing the total number of piglets born in future generations.

[0020] Preferably, the base at position 33289690 of pig chromosome 9 is as shown in the 500th bp of the sequence shown in SEQ ID NO.1.

[0021] Beneficial effects of the present invention:

[0022] The present invention studies and determines SNP molecular markers that affect the total litter size trait of pigs, and uses the molecular markers for early molecular marker-assisted selection, which can accelerate the pig breed selection process.

[0023] The present invention predicts the total piglet number trait by detecting the base type of the molecular marker SNP site. The total piglet number of the TC genotype and TT genotype groups is greater than that of the CC genotype group. A primer set is used to amplify the molecular marker affecting the total piglet number trait. Using the molecular marker and primer set, an efficient and accurate pig molecular marker-assisted breeding technology is established. This technology is applied to pig breeding, enabling the selection of piglets with a favorable total piglet number trait and the timely elimination of disadvantaged piglets, thereby increasing the number of piglets born and improving the reproductive efficiency of the pig farm. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Manhattan plot (left) and QQ plot (right) of GWAS for total pig litter size.

[0025] Figure 2 This is the result of the association analysis between different genotypes of SNP molecular markers and the total litter size.

[0026] Figure 3 This is the Sanger sequencing result of the 9:33289690C>T site. DETAILED DESCRIPTION

[0027] The present invention performs whole-genome resequencing on pig genomic DNA, compares the resequencing data with the pig reference genome (Sscrofa11.1.109), obtains all high-quality SNPs on the genome, and analyzes the correlation between each site and the total pig litter size trait to obtain a molecular marker associated with the total pig litter size trait. The SNP molecular marker is located at the base 33289690 of chromosome 9 in the pig genome Sscrofa11.1.109. The SNP site of the molecular marker has a C / T polymorphism, wherein T is a favorable allele variation for the total pig litter size trait.

[0028] The nucleotide sequence of the SNP molecular marker of the present invention is shown in SEQ ID NO: 1:

[0029] (SEQ ID NO.1)。

[0030] The 9:33289690C>T site is located at the 500th position from the 5' end of the sequence SEQ ID NO.1. The C / T polymorphism of this site is significantly correlated with the total litter size of pigs. The total litter size of individuals with CC genotype is extremely significantly lower than that of TC genotype (P<0.01), the total litter size of individuals with TC genotype is extremely significantly lower than that of TT genotype (P<0.01), and the total litter size of individuals with CC genotype is extremely significantly lower than that of TT genotype (P<0.001).

[0031] The present invention provides substances for detecting the porcine SNP molecular marker, including PCR primers for amplifying genomic DNA fragments including the SNP site of the molecular marker, or a kit containing the primers. The primers for amplifying the SNP molecular marker of the present invention include upstream primer F: 5'-CTACTTCTGTGGACCTTCCTGTGTG-3' (SEQ ID NO. 2) and downstream primer R: 5'-GTGTGGTGATAGGGTTAATGTTTTG-3' (SEQ ID NO. 3). The kit also includes a PCR amplification reagent.

[0032] In the present invention, the PCR amplification reagent is preferably 2×Taq Master Mix (Dye). 2Taq Master Mix (Dye) is a mixture of Taq DNA polymerase, dNTP mixture, MgCl2 and reaction buffer pre-prepared to a 2-fold concentration and then optimized in proportion. It has good amplification efficiency and high detection sensitivity.

[0033] PCR amplification of porcine genomic DNA was performed using the aforementioned primer set. In one embodiment, the PCR amplification procedure included 34 cycles of initial denaturation at 94°C for 1 minute, denaturation at 98°C for 10 seconds, annealing at 63°C for 15 seconds, and extension at 72°C for 45 seconds, followed by a final extension at 72°C for 5 minutes. The resulting amplified product was sequenced to determine the genotype at the 9:33289690C>T locus.

[0034] The criteria for judging the quality of the total piglet size are:

[0035] If the genotype of the 9:33289690C>T locus is TT, the total number of piglets born is large;

[0036] If the genotype of the 9:33289690C>T locus is TC type, the total litter size of the pig is medium;

[0037] If the genotype of the 9:33289690C>T site is CC, the total number of piglets born will be small.

[0038] The present invention is not particularly limited to the method for sequencing, and sequencing methods known in the art can be used. In an embodiment of the present invention, the DNA sequence obtained by amplification is determined by Sanger sequencing. As an embodiment, DNA sequence sequencing is carried out at Aoke (Wuhan) Biotechnology Co., Ltd., and the gene fragment is measured for both positive and negative reactions. The present invention judges the quality of the total piglet number trait based on the base type at the 500th position from the 5' end in the measured sequence, thereby detecting the total piglet number trait and optimizing the genetic breeding of the total piglet number trait.

[0039] The SNP molecular marker of the present invention can be applied to association analysis of genotypes related to total litter size in pigs or traits related to total litter size in pigs, providing a new molecular marker resource for molecular marker-assisted selection of pig reproductive performance.

[0040] The technical solutions of the present invention will be described in more detail below with reference to the embodiments and accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.

[0041] The reagents and consumables used in the present invention are all common commercial products and can be purchased from the market.

[0042] The following uses the Eqing Black Pig as an example to illustrate the technical solution of the present invention, but this does not limit the technical solution of the present invention. Those skilled in the art can apply the technical solution of the present invention to other pig breeds to detect and optimize the total litter size trait of pigs, which also falls within the scope of protection of the present invention.

[0043] Example 1

[0044] Screening for molecular markers associated with total litter size in pigs

[0045] (1) Data collection on reproductive traits of Eqing black pigs

[0046] A total of 244 female Eqing black pigs were collected from Qingping breeding farm in Dangyang City, Hubei Province, and their total litter size trait data were collected.

[0047] (2) Sample collection and genomic DNA extraction of Eqing black pigs

[0048] Ear or tail tissue from Eqing Black pig sows was collected using ear forceps, placed in a 1.5 mL centrifuge tube filled with 75% ethanol, and stored at -20°C. Genomic DNA was extracted using a Kangwei Century Universal Column-Based Genomic Extraction Kit according to the manufacturer's instructions and stored in a -20°C freezer after passing quality inspection.

[0049] (3) Whole genome resequencing and SNP detection quality control

[0050] Samples that passed quality inspection were used to construct sequencing libraries using the YZSeq Tn5 Library Prep Kit. After library construction, quality inspection was performed. Those that passed the quality inspection were sequenced on the DNBSEQ-T7B platform to generate raw data (RawReads), which were stored in the Fastq file format.

[0051] Fastp software was used to filter the raw data: adapter sequences were removed; reads with an N-base ratio greater than 3% were removed; reads less than 30 bases were removed; and reads with low quality (quality value less than 15) containing a base ratio greater than 40% were removed. Finally, valid data (clean data) that met the requirements for data analysis were obtained.

[0052] Clean reads were aligned to the porcine reference genome (Sscrofa11.1.109) using BWA software. Alignment results were exported as sam files, which were then compressed, sorted, and duplicate reads removed using Sambamba software. SNPs were detected in the sorted and deduplicated bam files using Sentieon software.

[0053] SNPs were filtered using BCFtools software with the following filtering parameters: QUAL < 30.0 | QD < 2.0 | FS > 60.0 | MQ < 40.0 | SOR > 4.0 | ReadPosRankSum < -8.0. Quality control was then performed using VCFtools: variants with a missingness ratio greater than 0.5 were removed; variants with a sequencing depth less than 3 and greater than 100 were removed; and variants with an allele number of 2 were retained. The VCFtools output file was then subjected to more stringent quality control using Plink 2.0. The following quality control criteria were used: autosomal variants were retained; variants with a minimum allele frequency less than 5% were removed; variants with a missingness ratio greater than 10% were removed; and variants not conforming to Hardy-Weinberg equilibrium were removed. A total of 13,899,481 high-quality SNPs were obtained for subsequent analysis.

[0054] (4) GWAS analysis

[0055] The MLM model of rMVP software was used to conduct GWAS analysis on the total litter size (TNB) trait of Eqing Black Pig, and Manhattan plot and QQ plot were generated ( Figure 1 ). Using P = 2.48e-06 as the threshold of significant SNP sites, the SNPs sites significantly associated with the total litter size trait of Eqing black pigs were obtained.

[0056] Example 2

[0057] Association analysis between different genotypes of significant SNPs and total litter size

[0058] For the significant SNPs identified by GWAS, Plink software was used to extract the genotype data for the C>T mutation site at position 33289690 on chromosome 9 for each Eqing Black pig. Individuals with the same genotype were grouped together. Single-factor ANOVA using SPSS 26.0 software was then used to examine the effects of different genotypes on phenotypes. Statistical data are presented as mean ± standard deviation. * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001. GraphPad Prism 8 software was used for plotting.

[0059] The results show that ( Figure 2 Or Table 1), the 9:33289690C>T site variation will lead to an increase in the total litter size of Eqing black pigs. The average total litter size corresponding to the wild CC genotype, heterozygous mutant TC genotype and homozygous mutant TT genotype were 9.35, 10.30 and 11.79, respectively. The TC heterozygous type was extremely significantly higher than the CC wild type (P<0.01), and the TT homozygous type was extremely significantly higher than the CC wild type and TC heterozygous types (P<0.01). Therefore, the variation of this site is beneficial to the total litter size. Both TC and TT mutant types are favorable alleles. The selection of individuals with this mutation should be strengthened during breeding.

[0060] Table 19: Correlation analysis between different genotypes of 33289690C>T locus and total litter size

[0061] genotype Number of individuals Total number of piglets born (head) comparison group P-value CC 106 9.35±2.35 CCvsTC 0.003** TC 95 10.30±2.12 TCvt 0.003** TT 26 11.79±2.46 CCxTT 0.0001***

[0062] Example 3

[0063] Verification of polymorphic sites

[0064] To verify the authenticity and reliability of the SNP sites obtained by high-throughput sequencing and whether they were caused by sequencing errors, six piglets were selected as samples and labeled 1-6 respectively. The total number of piglets born was recorded, and the DNA sequence of the pig samples was extracted. The genotype of the 9:33289690C>T site was sequenced by Sanger sequencing.

[0065] 1. Primer Design: Use the "subseq" parameter of seqtk software to extract sequence information for 500 bp upstream and downstream of site 9:33289690. Based on the extracted 1000 bp DNA sequence, primers were designed using Primer Premier 5.0, a primer design software.

[0066] F: CTACTTCTGTGGACCTTCCTGTGTG;

[0067] R:GTGTGGTGATAGGGTTAATGTTTTG;

[0068] The sequence information of the primer amplification is as follows, where the 9:33289690C>T site is located at the 500th position from the 5' end of the sequence and is marked in bold, and the underlined part is the corresponding sequence of the primer.

[0069]

[0070] 2. PCR amplification: Add 1 μL DNA template, 8 μL double-distilled water, 10 μL 2×Es Taq MasterMix (Dye), and 0.5 μL of each primer to a 20 μL system.

[0071] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 1 min, followed by 34 cycles of denaturation at 98°C for 10 s, annealing at 63°C for 15 s, and extension at 72°C for 45 s, and a final extension at 72°C for 5 min.

[0072] 3. Sanger sequencing: Sequencing of the DNA amplification products was performed at Aoke (Wuhan) Biotechnology Co., Ltd., with both forward and reverse reactions of the gene fragments measured. The resulting sequences were compared with the pig reference genome (Sscrofa11.1.109) in the Ensembl genome to determine the mutation status of the corresponding SNP sites.

[0073] Table 2 Total litter size and genotype of 9:33289690C>T locus of sample pigs

[0074] Sample No. Total litter size (pieces) genotype 1 9.14 CC 2 9.43 CC 3 10 CC 4 10.8 TC 5 11 TC 6 11.67 TC

[0075] The sequencing results are as follows Figure 3 As shown, Figure 3 Among them, A, B and C are CC genotype samples, and D, E and F are TC genotype samples, all of which match the total litter size trait of the tested pigs.

[0076] In summary, the SNP molecular markers related to the average total litter size trait of pigs provided by the present invention can be used to identify the total litter size trait of pigs according to genotype, thereby achieving early selection and accelerating the breeding process.

[0077] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A porcine SNP molecular marker or a substance for detecting the porcine SNP molecular marker in any of the following aspects, characterized in that: Used to detect or assist in detecting the total litter size trait of pigs; Genetic breeding to increase overall pig litter size; The SNP molecular marker is located at the base 33289690 of chromosome 9 in the pig reference genome Sscrofa11.1.

109. The SNP site of the molecular marker has a C / T polymorphism, wherein T is a favorable allele variation for the total litter size of pigs.

2. The use according to claim 1, characterized in that The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that The substance for detecting the pig SNP molecular marker includes a PCR primer for amplifying a genomic DNA fragment including the molecular marker SNP site, or a kit containing the primer.

4. The use according to claim 3, characterized in that The nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.

3.

5. The use according to claim 3, characterized in that The kit also includes PCR amplification reagents.

6. A method for detecting the total litter size trait of pigs, characterized in that: The base type at position 33289690 of chromosome 9 of the pig genome was detected. The total litter size of the TC genotype and CC genotype groups was less than that of the TT genotype group.

7. The method according to claim 6, characterized in that The method for detecting the base type of position 33289690 of chromosome 9 of the pig genome includes: designing primers for amplifying the nucleotide sequence shown in SEQ ID NO.1, performing PCR amplification on pig genomic DNA using the primers, and detecting the genotype at position 500 in the gene sequence of the amplified product.

8. The method according to claim 7, characterized in that The genotype of the 9:33289690C>T site was obtained by Sanger sequencing.

9. A genetic breeding method for increasing the total litter size of pigs, characterized in that: Determine the base type of position 33289690 on chromosome 9 of the pig breeding core group and make corresponding choices based on the base type: The successive breeding of breeding pigs selects individuals with TT and TC bases at position 33289690 of chromosome 9, and eliminates CC individuals to increase the frequency of gene T at this position from generation to generation, thereby increasing the total number of piglets born in future generations.

10. The method according to claim 9, characterized in that The base at position 33289690 of the pig chromosome 9 is shown at 500 bp in the sequence shown in SEQ ID NO.1.

Images