KASP molecular marker for identifying soybean oil content and application

Abstract

The invention discloses a KASP molecular marker for identifying the soybean oil content and application, and relates to the technical field of biology and application of an SNP locus, the SNP locus takes a soybean Wm82. A2. V1 genome sequence as a reference genome, the SNP is the 6562032th SNP on a soybean 20 # chromosome, and the SNP is the 6562032th SNP on the soybean 20 # chromosome. Corresponding to the 20th basic group from the 5'terminal of the sequence shown in SEQ ID NO: 1, when the site is GG homozygosis, the corresponding genotype is A; when the site is AA homozygous, the corresponding genotype is B; according to the application, soybeans with different oil contents are screened or screened in an auxiliary mode, and the different oil contents of the soybeans are as follows: the soybean with the homozygous genotype A is higher than the soybean with the homozygous genotype B or the soybean with the homozygous genotype B in a candidate mode. The invention has important theoretical significance and economic value for molecular marker-assisted selection of soybean germplasm or breeding progeny materials with high oil content.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a KASP molecular marker for identifying soybean oil content and its application. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is a major grain and oilseed crop in my country. With socioeconomic development and the continuous improvement of people's living standards, soybean consumption has increased significantly, leading to a serious imbalance between soybean supply and demand. China is the world's largest soybean consumer. Faced with the huge domestic demand, domestic soybean production is insufficient, forcing it to rely heavily on imports. Since 2000, China has become the world's largest soybean importer, and soybean imports have increased annually, reaching 105.03 million tons in 2024. This massive soybean import volume has led to a significant crisis for the entire domestic soybean industry chain, seriously threatening my country's food security.

[0003] 56% of the fat humans need comes from edible oils. While providing the body with essential calories, edible oils also provide essential fatty acids and fat-soluble vitamins that the human body cannot synthesize. Soybean oil is a significant component of human edible oil intake, accounting for approximately 31%. Studies have shown that since the 21st century, the consumption structure of edible oils in China has shifted from rapeseed oil to soybean oil, with soybean oil consumption showing a sustained upward trend, reaching an annual growth rate of 10.4%. Therefore, cultivating soybean varieties with high oil content is crucial. Molecular-assisted breeding is an important method for accelerating soybean breeding. The development of molecular markers related to soybean oil content is crucial for breeding new soybean varieties with high oil content. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a KASP molecular marker for identifying soybean oil content and its application.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0006] Use of a SNP site, wherein the SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome, the SNP is the 6562032nd SNP on soybean chromosome 20, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1, and when the site is homozygous for GG, the corresponding genotype is A; when the site is homozygous for AA, the corresponding genotype is B;

[0007] The application is to screen or assist in screening soybeans with different oil contents, wherein the oil contents of soybeans with different oil contents are as follows: soybeans with homozygous genotype A are higher or are potentially higher than soybeans with homozygous genotype B.

[0008] A method for screening or assisting in screening soybeans with different oil contents, comprising the following steps: detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA, wherein the oil content of soybeans with genotype GG is greater than the oil content of soybeans with genotype AA;

[0009] The soybean of genotype GG is a soybean of homozygous GG genotype based on the G20A SNP site;

[0010] The soybean of genotype AA is a soybean of homozygous AA genotype based on the G20A SNP site;

[0011] The G20A SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 6562032nd SNP on soybean chromosome 20, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0012] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA is as follows:

[0013] (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0014] The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4;

[0015] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained based on the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-2-FAM, and exhibits orange fluorescence, the soybean sample to be tested is of GG genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-2-VIC, and exhibits blue fluorescence, the soybean sample to be tested is of AA genotype.

[0016] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA is as follows:

[0017] (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0018] The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4;

[0019] (b2) taking the PCR amplification product obtained in step (b1) and sequencing it;

[0020] (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

[0021] A kit for identifying or assisting in identifying soybean oil content, comprising a primer combination for detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA;

[0022] The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4;

[0023] The genotype GG is based on the genotype of the G20A SNP site being a GG homozygous type;

[0024] The genotype AA is based on the genotype of the G20A SNP site being AA homozygous;

[0025] The G20A SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 6562032nd SNP on soybean chromosome 20, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0026] The molecular marker shown in SEQ ID NO: 1.

[0027] Application of the above kit or the above molecular marker in identifying or assisting in identifying soybean oil content.

[0028] Application of the above kit or the above molecular marker in screening or auxiliary screening of soybeans with different oil contents.

[0029] Application of the above kit or the above molecular marker in soybean breeding.

[0030] The invention discloses an application of a primer combination in the directed breeding or assisted directed breeding of soybean lines with high oil content. The primer combination consists of an upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, an upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and a downstream primer 20PC-2-R shown in SEQ ID NO: 4.

[0031] The beneficial effects of the above technical solution are as follows: the present invention provides KASP markers for identifying genotype GG and AA allelic variations and their correlation with soybean oil content. The KASP markers of the present invention are applied to molecular marker-assisted selection for soybean oil content, enabling rapid and efficient screening of soybean varieties (germplasm) with high oil content, thereby accelerating the development of new high-quality soybean varieties. This invention has important theoretical significance and economic value for the use of molecular marker-assisted selection for soybean germplasm or breeding material with high oil content. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a diagram showing the results of QTL mapping analysis of the oil content trait of population numbered 14019 in Example 1 of the present invention;

[0033] Figure 2 This is a normal distribution and marker selection efficiency diagram of the oil content of population numbered 14019 in Example 1 of the present invention;

[0034] Figure 3 This is a diagram showing the genotyping and oil content results of the KASP marker for oil content in population No. 14019 in Example 2 of the present invention. DETAILED DESCRIPTION

[0035] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0036] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0037] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0038] References to "one embodiment" or "some embodiments" in this specification mean that one or more embodiments of the present application include the features described in conjunction with the embodiment.

[0039] Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0040] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0041] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0042] Example 1: Discovery of soybean oil content-specific SNP sites

[0043] The soybean material in the present embodiment comes from: in 2006, the cultivated soybean Jidou 12 of this laboratory was used as the female parent, and the wild soybean ZYD02738 was used as the male parent, and hybridization was carried out to establish a RIL population. In 2012, Jidou 12 was the female parent, and the RIL population was used as the male parent, and backcrossing was performed, and the BC1F1 population obtained in 2013 was obtained. In 2014, Jidou 12 was the female parent, and the BC1F2 of Jidou 12 and ZYD02738 combination was used as the male parent and backcrossed; BC2F1 population was obtained in 2015. Self-pollination was performed 4 times to obtain a BC2F4:5 population, which was numbered as 53 strains of the 14019 population. In December 2018, in Sanya, BC2F4:5 plants took leaves, and DNA was extracted by Baimix Company, and genotype identification was performed on each strain respectively to construct a genetic map.

[0044] The phenotypic detection method for soybean oil content is as follows: the number of grains per plant and the weight of grains per plant of each family in the wild soybean substitution line population 14019 were counted, and the oil content was calculated as follows: oil content = (grain weight per plant / number of grains per plant) × 100.

[0045] Combined with phenotypic data, QTL mapping for soybean oil content was performed. A QTL locus, qOil-14019-20, associated with soybean oil content, was located on chromosome 20 of soybean. Its LOD value was 5.09, explaining 20.96% of the phenotypic variation. The marker associated with the QTL is CHr20_6562032_G_A. The SNP, identified as SNP 6562032 on chromosome 20, is G or A, using the soybean Williams82 (Wm82.a2.v1) genome sequence as the reference genome. It corresponds to nucleotide position 20 of SEQ ID NO: 1.

[0046] Table 11 QTL mapping analysis results for oil content traits in population 4019

[0047]

[0048] The genotypes of each family in the population corresponding to the soybean SNP marker CHr20_6562032_G_A are divided into three types: GG, AA, and G / A. Among them, the genotype GG is the homozygous type of G, the genotype AA is the homozygous type of A, and the genotype G / A is the heterozygous type of G and A. The oil content phenotypic values ​​of the 53 soybean lines in this example and the genotype identification results of CHr20_6562032_G_A are shown in Tables 2 and 3. Figure 2 As shown, the average oil content of the GG genotype and AA genotype families were 19.70% and 18.54%, respectively. Compared with the average oil content of the AA genotype family, the average oil content of the GG genotype family was significantly higher by 6.28% (P < 0.01).

[0049] Table 214019 soybean molecular marker and oil content test results

[0050]

[0051]

[0052] Example 2: Genetic Identification of KASP Markers in Soybean Populations

[0053] A KASP marker was designed targeting the specific CHr20_6562032_G_A site on chromosome 20, and the following primers were designed:

[0054] 20PC-2-FAM: gaaggtgaccaagttcatgctCTCCTACGTGTCCTCCATCG (SEQ ID NO: 2);

[0055] 20PC-2-VIC: gaaggtcggagtcaacggattCTCCTACGTGTCCTCCATCA (SEQ ID NO: 3);

[0056] 20PC-2-R: GAAAGAACTACATAGGCCCG (SEQ ID NO: 4);

[0057] Amplification was performed using 5 μL of KASPAssay Mix (1.2 μL each of 20PC-2-FAM and 20PC-2-VIC, 3 μL of 20PC-2-R, and 4.6 μL of ddH2O). The reaction system is shown in Table 3. The reaction procedure was as follows: 94°C for 15 min; 10 cycles of 94°C for 20 s, followed by 61-55°C for 30 s, with the temperature decreasing by 0.6°C each cycle; 26 cycles of 94°C for 20 s, followed by 55°C for 1 min, and a final temperature of 30°C for 1 min.

[0058] Table 3 PCR reaction system of test population

[0059]

[0060] The marker CHr20_6562032_G_A was used to identify the genes of 53 families in the population numbered 14019. After KASP marker detection, 17 of the 53 Chinese soybean germplasm materials were of GG genotype and 26 of the germplasm were of AA genotype. The genotype results are shown in Tables 4 and Figure 3 As shown,

[0061] Table 4 Detection results of molecular markers and oil content in soybean population of the 4th generation

[0062]

[0063]

[0064] Note: NA indicates missing oil content data or genotype

[0065] Table 5 Statistical analysis of the relationship between CHr20_6562032_G_A allelic variation types and oil content

[0066]

[0067] The average oil content of the GG and AA genotype families was 19.44% and 18.42%, respectively. Compared with the average oil content of the AA genotype family, the average oil content of the GG genotype family was significantly higher by 5.54% (P < 0.01). This indicates that the marker CHr20_6562032_G_A is reliable and effective for identifying soybean oil content.

[0068] In summary, soybeans with a CHr20_6562032_G_A genotype of GG are high-oil soybeans, while soybeans with a CHr20_6562032_G_A genotype of AA are low-oil soybeans. Soybeans with a CHr20_6562032_G_A genotype of GG have higher oil content than soybeans with a CHr20_6562032_G_A genotype of AA. When selecting soybean varieties with superior oil content, soybeans with a CHr20_6562032_G_A genotype of GG are selected for breeding and improvement.

[0069] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0070] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0071] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. The use of SNP sites is characterized by: The SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome. The SNP is the 6562032nd SNP on soybean chromosome 20, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO:

1. When the site is homozygous for GG, the corresponding genotype is A; when the site is homozygous for AA, the corresponding genotype is B. The application is to screen or assist in screening soybeans with different oil contents, wherein the oil contents of soybeans with different oil contents are as follows: soybeans with homozygous genotype A are higher or are potentially higher than soybeans with homozygous genotype B.

2. A method for screening or assisting in screening soybeans with different oil contents, characterized in that: The method comprises the following steps: detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA, wherein the oil content of the soybean with genotype GG is greater than the oil content of the soybean with genotype AA; The soybean of genotype GG is a soybean of homozygous GG genotype based on the G20A SNP site; The soybean of genotype AA is a soybean of homozygous AA genotype based on the G20A SNP site; The G20A SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 6562032nd SNP on soybean chromosome 20, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

3. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA are as follows: (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4; (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained based on the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-2-FAM, and exhibits orange fluorescence, the soybean sample to be tested is of GG genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-2-VIC, and exhibits blue fluorescence, the soybean sample to be tested is of AA genotype.

4. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA are as follows: (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4; (b2) taking the PCR amplification product obtained in step (b1) and sequencing it; (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

5. A kit for identifying or assisting in identifying soybean oil content, characterized in that: The method comprises a primer combination for detecting whether the genotype of the soybean to be tested is genotype GG or genotype AA; The primer combination consists of the upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, the upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and the downstream primer 20PC-2-R shown in SEQ ID NO: 4; The genotype GG is based on the genotype of the G20A SNP site being a GG homozygous type; The genotype AA is based on the genotype of the G20A SNP site being AA homozygous; The G20A SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 6562032nd SNP on soybean chromosome 20, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. The molecular marker shown in SEQ ID NO:

1.

7. Use of the kit according to claim 5 or the molecular marker according to claim 6 in identifying or assisting in identifying soybean oil content.

8. Use of the kit according to claim 5 or the molecular marker according to claim 6 in screening or assisted screening of soybeans with different oil contents.

9. Use of the kit according to claim 5 or the molecular marker according to claim 6 in soybean breeding.

10. Use of a primer combination in directed breeding or assisted directed breeding of high-oil soybean lines, the primer combination consisting of an upstream primer 20PC-2-FAM shown in SEQ ID NO: 2, an upstream primer 20PC-2-VIC shown in SEQ ID NO: 3, and a downstream primer 20PC-2-R shown in SEQ ID NO: 4.

Images