Application of succinate dehydrogenase subunit B in preparation of medicine for preventing and / or treating renal fibrosis

Abstract

The invention relates to application of a succinate dehydrogenase subunit B (SDHB) in preparation of a medicine for preventing and / or treating renal fibrosis, and belongs to the technical field of medicine and biology. Based on research of the invention, the expression level of SDHB in renal fibrosis tissue is significantly reduced, and enhancement of the expression or activity of SDHB can effectively improve the function of renal tubular epithelial cells and alleviate the fibrosis process. By improving the expression or activity of SDHB, the oxidative phosphorylation ability of mitochondria can be enhanced, the energy metabolism state of cells can be improved, and the generation of active oxygen can be reduced, so that the occurrence and development of renal cell injury and fibrosis can be prevented. According to the application disclosed by the invention, SDHB is determined as a new target spot for resisting renal fibrosis for the first time, and a new direction is provided for prevention and treatment of renal fibrosis.

Description

Technical Field

[0001] The present invention relates to application of succinate dehydrogenase subunit B (SDHB) in preparing a medicine for preventing and / or treating renal fibrosis, and belongs to the fields of medicine and biotechnology. Background Art

[0002] The kidneys are important, energy-intensive organs in the human body, and their normal function is highly dependent on efficient energy metabolism, particularly oxidative phosphorylation. Oxidative phosphorylation is a core pathway of cellular energy metabolism, primarily occurring in the mitochondria. It converts the energy generated by the oxidation of nutrients into ATP through the electron transport chain, powering various cellular physiological activities. Renal tubular epithelial cells and glomerular mesangial cells require substantial amounts of energy to maintain their complex transport and filtration functions, as well as the dynamic balance of the extracellular matrix.

[0003] Renal fibrosis is a key pathological process in the progression of chronic kidney disease (CKD) to end-stage renal disease. It is characterized by tubulointerstitial fibrosis, glomerular sclerosis, and excessive deposition of extracellular matrix. The development and progression of renal fibrosis involves a complex interplay of multiple cell types and signaling pathways, including dedifferentiation of renal tubular epithelial cells, activation of fibroblasts, and infiltration of inflammatory cells.

[0004] Impaired oxidative phosphorylation plays a crucial role in the development of renal fibrosis. On the one hand, renal damage impairs mitochondrial function, reducing the activity of electron transport chain complexes and thus reducing the efficiency of oxidative phosphorylation. This metabolic impairment not only leads to decreased ATP production and insufficient cellular energy supply, but also increases electron leakage during electron transport, significantly increasing the production of reactive oxygen species (ROS). Excessive ROS further damage mitochondria and other cellular components, forming a vicious cycle and exacerbating cellular dysfunction. On the other hand, impaired energy metabolism triggers metabolic reprogramming within cells. To compensate for the insufficient ATP production, cells increase the rate of glycolysis, but this metabolic pathway produces limited energy and increases lactate accumulation, leading to local acidosis and further compromising cellular function. Furthermore, impaired energy metabolism activates a series of pro-fibrotic signaling pathways, such as HIF-1α, accelerating the synthesis and accumulation of extracellular matrix and promoting the progression of renal fibrosis. Therefore, interventions targeting mitochondrial dysfunction hold promise as an effective strategy for the treatment of renal fibrosis.

[0005] Currently, clinical treatment strategies for renal fibrosis primarily focus on controlling underlying conditions such as hypertension and diabetes and providing supportive care. There is an urgent need to explore new anti-renal fibrosis targets and develop targeted anti-renal fibrosis drugs. However, the development of therapeutic targets targeting oxidative phosphorylation is currently limited. Furthermore, existing markers for the diagnosis of renal fibrosis, such as serum creatinine and urea nitrogen, while able to reflect the extent of renal impairment, lack the ability to specifically detect the early stages of renal fibrosis. Changes in these markers typically occur in the middle and late stages of renal fibrosis, failing to provide timely warning of the onset and progression of the disease.

[0006] Mitophagy, a cellular process that selectively degrades damaged mitochondria, maintains mitochondrial quality and the stability of the intracellular environment by eliminating dysfunctional mitochondria. Studies have shown that activating mitophagy can alleviate the severity of renal fibrosis. For example, promoting mitophagy by activating the PINK1-Parkin pathway has been shown to have anti-fibrotic effects in both in vitro and in vivo models. However, the mechanisms by which key proteins regulating mitophagy play a role in renal fibrosis remain largely undefined.

[0007] Succinate dehydrogenase complex subunit B (SDHB) is a key component of mitochondrial respiratory chain complex II (succinate ubiquinone oxidoreductase), participating in the tricarboxylic acid cycle and electron transport chain, and plays an important role in cellular energy metabolism. However, the specific role of SDHB in the development and progression of renal fibrosis and its potential as a therapeutic target have not been thoroughly studied or reported. Summary of the Invention

[0008] The present invention aims to provide a use of succinate dehydrogenase subunit B (SDHB) in the preparation of a drug for preventing and / or treating renal fibrosis.

[0009] The technical solution adopted by the present invention to solve its technical problem is:

[0010] A use of succinate dehydrogenase subunit B (SDHB) in preparing a drug for preventing and / or treating renal fibrosis.

[0011] Preferably, the present invention prevents and / or treats renal fibrosis by enhancing the expression level and / or activity of SDHB. Based on the research findings of the present invention, the expression level of SDHB is significantly reduced in renal fibrosis tissue, and enhancing its expression or activity can effectively improve the function of renal tubular epithelial cells and alleviate the fibrosis process. By increasing the expression or activity of SDHB, the mitochondrial oxidative phosphorylation capacity can be enhanced, the cellular energy metabolism state can be improved, and the production of reactive oxygen species can be reduced, thereby preventing the occurrence and development of renal cell damage and fibrosis.

[0012] Preferably, the renal fibrosis includes tubulointerstitial fibrosis and / or glomerulosclerosis. Tubulointerstitial fibrosis and glomerulosclerosis are two major pathological manifestations of renal fibrosis and are also key pathological processes in the progression of chronic kidney disease to end-stage renal disease. The present invention finds that SDHB plays an important role in both types of fibrosis, providing a new target for the comprehensive prevention and treatment of renal fibrosis.

[0013] Preferably, the expression and / or activity of SDHB is regulated through the STAT3 signaling pathway. The present invention found that a key mechanism of SDHB regulation is that the STAT3 signaling pathway is closely related to the expression and activity of SDHB. By regulating the phosphorylation and activation state of STAT3, the expression level and function of SDHB can be affected, thereby regulating downstream mitochondrial function and cellular metabolic state. This discovery provides a new intervention strategy for indirectly regulating SDHB through the STAT3 signaling pathway.

[0014] Preferably, PINK1-Parkin-mediated mitophagy is affected by regulating SDHB. The PINK1-Parkin pathway is a classic mitophagy pathway that plays a key role in clearing damaged mitochondria and maintaining mitochondrial quality and function. The present invention found that another key mechanism of SDHB regulation is that SDHB can regulate the mitophagy process by affecting the activity of the PINK1-Parkin pathway, thereby reducing the damage of oxidative stress to the kidneys and preventing the progression of renal fibrosis. This mechanism provides a theoretical basis for SDHB's anti-renal fibrosis effect.

[0015] A method for screening drugs for the treatment of renal fibrosis, comprising the following steps: (1) contacting a candidate compound with cells expressing SDHB; (2) determining the effect of the candidate compound on the expression level and / or activity of SDHB; and (3) selecting compounds that can enhance the expression level and / or activity of SDHB as potential drugs for the treatment of renal fibrosis. By evaluating the effect of the candidate compound on the expression level or activity of SDHB, potential drugs for the treatment of renal fibrosis can be quickly and efficiently screened. This screening method has a clear target orientation and can greatly improve the efficiency and success rate of drug screening, laying the foundation for the development of specific drugs for SDHB.

[0016] Preferably, the method further comprises determining the effect of the candidate compound on at least one of the following indicators: (1) mitochondrial oxidative phosphorylation function; (2) PINK1-Parkin-mediated mitophagy; (3) expression of renal fibrosis-related proteins FN1, COL1A1, VIM, and / or α-SMA; and (4) activity of STAT3, HIF-1, and / or FoxO signaling pathways. This preferred solution further improves the evaluation system for drug screening. In addition to directly evaluating the effect of candidate compounds on SDHB, it also comprehensively evaluates the anti-fibrotic effects of candidate compounds from multiple levels, including mitochondrial function, mitophagy, fibrosis markers, and related signaling pathways. This multi-index evaluation strategy can more comprehensively screen for anti-renal fibrosis drugs with synergistic effects of multiple mechanisms, thereby improving the success rate of drug development.

[0017] A use of succinate dehydrogenase subunit B (SDHB) as a biomarker for renal fibrosis. Specifically, SDHB expression levels in subject samples can be detected for diagnosis, prognosis assessment, or monitoring of treatment efficacy of renal fibrosis. The inventors have found that SDHB expression levels in renal fibrosis tissue are negatively correlated with the severity of the disease. Therefore, by detecting SDHB expression levels in patient samples, the extent of renal fibrosis can be assessed, disease prognosis can be predicted, and treatment efficacy can be monitored.

[0018] A method for treating renal fibrosis by regulating SDHB expression and / or activity, the method comprising the following steps: administering a drug capable of enhancing SDHB expression and / or activity to a subject suffering from or at risk of renal fibrosis. Preferably, the drug enhances SDHB expression and / or activity via one of the following pathways: (1) upregulating SDHB gene expression; (2) enhancing SDHB protein stability; (3) enhancing SDHB protein catalytic activity; or (4) modulating the STAT3 signaling pathway.

[0019] The study of the present invention constructed a SD rat renal fibrosis model by adenine induction, and verified the successful establishment of the model through biochemical indicators (serum creatinine, blood urea nitrogen), pathological changes (HE staining, Masson staining, immunofluorescence staining) and fibrosis markers (FN1, COL1A1, VIM, α-SMA). Proteomic analysis showed that the differential proteins in renal fibrosis tissue were mainly enriched in the oxidative phosphorylation pathway, and the core target SDHB was screened out. WB and immunofluorescence staining confirmed that the expression level of SDHB in the renal tissue of rats with renal fibrosis was significantly reduced, which was opposite to the expression trend of fibrosis markers FN1, COL1A1, and α-SMA. GEO data mining (GSE104954 data set) also confirmed that the transcription level of SDHB in the renal tissue of patients with kidney disease was reduced.

[0020] In order to further verify the function of SDHB, the present invention constructed SDHB knockout and overexpression stable strains of human renal tubular epithelial cell line (HK-2), and used TGF-β1 to induce epithelial-mesenchymal transition in cells, promoting the formation of renal fibrosis-related phenotypes. The high-resolution respiratory measurement system Oroboros O2k was used to detect changes in mitochondrial respiration of cells. The results showed that SDHB knockout led to a decrease in mitochondrial respiratory function, while SDHB overexpression enhanced mitochondrial respiratory function. Western blot analysis confirmed that SDHB knockout increased the expression of fibrosis markers FN1, COL1A1, VIM, and α-SMA, while SDHB overexpression inhibited the expression of these fibrosis markers.

[0021] Through GSEA analysis, the present invention found that SDHB can regulate the STAT3 signaling pathway, thereby affecting downstream HIF-1 and FoxO signaling. This result was verified in SDHB knockout and overexpression HK-2 cells, confirming that SDHB has a regulatory effect on STAT3, HIF-1, and FoxO signaling. In addition, the study also found that SDHB can regulate PINK1-Parkin signaling through STAT3, activate mitophagy, thereby clearing damaged mitochondria and improving renal tubular cell damage.

[0022] The beneficial effects of the present invention are:

[0023] This study identifies SDHB as a novel target for renal fibrosis, providing a new approach for the prevention and treatment of renal fibrosis. Unlike existing technologies, which primarily focus on primary disease and symptom control, this study directly targets mitochondrial dysfunction, a key pathological mechanism of renal fibrosis, and proposes a novel intervention strategy from the perspective of energy metabolism.

[0024] 2. This study reveals the molecular mechanism by which SDHB regulates mitophagy and affects renal fibrosis through the STAT3-PINK1-Parkin signaling pathway, providing a theoretical basis for multi-target synergistic intervention in renal fibrosis. This multi-pathway regulatory mechanism, distinct from traditional single-target therapeutic strategies, is expected to achieve more effective disease intervention.

[0025] 3. This study not only proposes the use of SDHB as a therapeutic target but also identifies its potential as a biomarker for renal fibrosis, providing a new tool for early diagnosis, prognostic assessment, and treatment monitoring of renal fibrosis. This integrated diagnosis and treatment strategy will contribute to the realization of precision medicine for renal fibrosis.

[0026] 4. This invention provides a novel method for screening anti-renal fibrosis drugs based on the SDHB target. Through a multi-index comprehensive evaluation system, it lays the foundation for the development of therapeutic drugs specifically targeting SDHB. This drug screening strategy has clear targeting and scientific basis, and is expected to improve the efficiency and success rate of drug development.

[0027] In summary, the present invention provides new targets and strategies for the prevention, diagnosis and treatment of renal fibrosis by discovering the key role of SDHB in renal fibrosis and its regulatory mechanism, and has important clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The results of the rat serum biochemical index test in Example 1 of the present invention are shown in Figure A: Serum creatinine statistical graph; Figure B: Serum urea nitrogen statistical graph;

[0029] Figure 2 The results of rat kidney tissue pathological staining in Example 1 of the present invention are shown in Figure A, HE staining and statistical graph; Figure B, Masson staining and statistical graph; Figure C, COL1A1 immunofluorescence staining and statistical graph; Figure D, α-SMA immunofluorescence staining and statistical graph;

[0030] Figure 3 The WB test results of rat fibrosis markers in Example 1 of the present invention include signal bands and statistical graphs of FN1, COL1A1, VIM, and α-SMA;

[0031] Figure 4 The results of proteomic analysis of normal renal tissue and fibrotic renal tissue in rats in Example 1 of the present invention are shown in Figure A: principal component analysis of repeated samples of proteins in different groups; Figure B: box plot of protein intensity value distribution in different groups; Figure C: volcano plot of differential proteins; Figure D: enrichment analysis of differential protein pathways; Figure E: interaction network diagram of core target proteins;

[0032] Figure 5 The results of screening for the core oxidative phosphorylation target SDHB in Example 2 of the present invention are shown in Figure A, which shows signal strips for fibrosis indicators FN1, COL1A1, α-SMA and oxidative phosphorylation targets SDHA, SDHB, ATP5A1, UQCRFS1, and NDUFS8; and Figure B shows statistical protein expression of fibrosis indicators FN1, COL1A1, α-SMA and oxidative phosphorylation targets SDHA, SDHB, ATP5A1, UQCRFS1, and NDUFS8.

[0033] Figure 6 This is the result of immunofluorescence staining of kidney tissue for the core target of oxidative phosphorylation SDHB in Example 2 of the present invention;

[0034] Figure 7 The transcription level of SDHB in renal tissues of patients with different kidney diseases in Example 2 of the present invention, wherein Figure A: diabetic nephropathy, Figure B: focal segmental glomerulosclerosis, Figure C: Anka-related nephritis, Figure D: IgA nephropathy, Figure E: hypertensive nephropathy, Figure F: minimal change disease, Figure G: membranous nephropathy, and Figure H: thin basement membrane nephropathy;

[0035] Figure 8 The WB results of the SDHB knockout and overexpression HK-2 cell lines constructed in Example 3 of the present invention are as follows;

[0036] Figure 9 The results of the mitochondrial respiration test in the HK-2 cell lines with SDHB knockout and overexpression in Example 4 of the present invention are shown, wherein Figure A shows the mitochondrial respiration rate in normal HK-2 cells after SDHB knockout and overexpression, and Figure B shows the mitochondrial respiration rate in HK-2 cells after SDHB knockout and overexpression after TGF-β stimulation.

[0037] Figure 10 The results of the renal fibrosis index detection in HK-2 cells with SDHB knockout and overexpression in Example 4 of the present invention are verified; wherein, Figure A: SDHB knockout and overexpression of HK-2 cells renal fibrosis index FN1, COL1A1, VIM, α-SMA and SDHB signal bands, Figure B: SDHB knockout and overexpression of HK-2 cells SDHB protein statistical graph, Figure C: SDHB knockout and overexpression of HK-2 cells renal fibrosis index FN1, COL1A1, VIM, α-SMA protein statistical graph;

[0038] Figure 11 SDHB downstream GSEA analysis for SDHB target function validation in Example 4 of the present invention; wherein, Figure A: KEGG enrichment analysis diagram, Figure B: JAK-STAT GESA enrichment analysis diagram, Figure C: FOXO KEGG pathway diagram, Figure D: HIF-1 KEGG pathway diagram;

[0039] Figure 12 Figure 4 shows the changes in STAT3, HIF-1, and FoxO signals in HK-2 cells knocked out and overexpressed by SDHB in Example 4 of the present invention; Figure A: STAT3, HIF1A, and FOXO1 signal strip diagram in HK-2 cells knocked out and overexpressed by SDHB, and Figure B: STAT3, HIF1A, and FOXO1 protein statistical diagram in HK-2 cells knocked out and overexpressed by SDHB.

[0040] Figure 13These are the changes in mitochondrial autophagy in HK-2 cells with SDHB knockout and overexpression in Example 4 of the present invention; wherein, Figure A: STAT3, PINK1-Parkin signals and autophagy indicators P62, BECN1, and LC3B band diagrams in HK-2 cells with SDHB knockout and overexpression, and Figure B: STAT3, PINK1-Parkin signals and autophagy indicators P62, BECN1, and LC3B protein statistics in HK-2 cells with SDHB knockout and overexpression. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described in detail below through specific examples. It should be understood that the implementation of the present invention is not limited to the following examples, and any form of modification and / or change made to the present invention will fall within the scope of protection of the present invention.

[0042] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used are commercially available or commonly used in the art. The methods in the following examples are all conventional methods in the art unless otherwise specified.

[0043] Unless otherwise specified, the reagents used in the following examples can be purchased from conventional biochemical reagent stores.

[0044] Example 1 4D Label-free quantitative proteomics of rat kidney tissue samples

[0045] This example screens and evaluates protein targets that affect the progression of renal fibrosis through proteomics. The specific method is as follows:

[0046] 1) Preparation of renal fibrosis model

[0047] Twenty-four SD rats, 6-8 weeks old, weighing 200±20g, were randomly divided into a blank control group and a model group, with 12 rats in each group. Adenine (Ade) was mixed with a prepared 0.5% sodium carboxymethylcellulose solution to form a suspension. The model group received adenine suspension at 200mg / kg / day by gavage for 28 consecutive days, while the blank control group received an equal amount of purified water by gavage.

[0048] 2) Renal fibrosis model evaluation

[0049] Rats were fasted for 12 hours and anesthetized with an intraperitoneal injection of 3% sodium pentobarbital. They were then placed in the supine position on a thermostatic operating table. The abdominal aorta was exposed and 5-10 ml of blood was collected by puncture. The blood was collected in a blood collection tube and allowed to stand for 30 minutes to promote complete coagulation. The upper serum layer was separated by centrifugation at 5000 rpm for 15 minutes at 4°C, aliquoted into sterile EP tubes, and immediately stored in a -80°C ultra-low temperature freezer until testing. For testing, frozen serum was thawed at room temperature and vortexed to mix. The Amplex Red creatinine assay was used for creatinine testing. The reaction system contained 20 μl of serum sample and 80 μl of working solution. After incubation at 37°C in the dark for 30 minutes, the absorbance was measured at 570 nm. The concentration was calculated using a standard curve. Urea nitrogen was determined using a urea nitrogen (urea) content assay kit. 30 μl of serum was mixed with 170 μl of reaction solution and incubated at 30°C for 10 minutes. The absorbance was measured at 630 nm. The concentration was converted according to the formula in the reagent instructions. The results showed that the creatinine (Scr) in the model group increased significantly by about 9 times, and BUN increased significantly by about 8 times compared with the blank group ( Figure 1 ). The results suggest impaired kidney function.

[0050] Histomorphological observation was performed using hematoxylin-eosin (HE) staining. Freshly obtained renal tissue samples were fixed with 4% paraformaldehyde for 48 hours, dehydrated with a gradient of 70%-100% ethanol, cleared with xylene, and embedded in paraffin. 4-μm-thick sections were prepared using a rotary paraffin microtome and oven-dried at 60°C for at least 5 hours to allow the sections to adhere to the slides. Before staining, sections were dewaxed in xylene I / II for 15 minutes each, rehydrated with a gradient of 100%-70% ethanol, rinsed with distilled water, and then stained with hematoxylin for 5 minutes. After rinsing with running water to remove excess color, sections were incubated with 1% hydrochloric acid and ethanol for 3 seconds, and then blued with PBS for 2 minutes to clearly visualize nuclear chromatin. After rinsing with running water for 5 minutes, the cells were transferred to eosin staining solution for counterstaining of cytoplasmic components for 2 minutes, and then rapidly dehydrated by 85%-100% ethanol gradient for 10 seconds. The cells were transparentized with xylene for 5 minutes, sealed with neutral gum, and observed under a Zeiss upright fluorescence microscope (bright field). The results showed that the renal tissue structure of the rats in the blank control group was complete and clear, the glomeruli were regular in morphology, the capillary loops were densely and evenly arranged, the renal tubular epithelial cells were neatly arranged, the lumen was not dilated or atrophied, and there was no inflammatory cell infiltration or fibrosis in the interstitial area. The overall normal physiological state was observed; the renal tissue of the model group showed significant pathological damage, the glomerular volume was enlarged, some basement membranes were thickened, the capillary loop structure was disordered, the renal tubular epithelial cells were swollen and vacuolar degeneration, some exfoliated cells were seen in the lumen, and a large number of vacuoles were seen in the interstitial area ( Figure 2 A) The results suggest renal disease.

[0051] Masson's trichrome staining was used to assess collagen deposition in renal tissue. Paraffin sections were pretreated as for HE staining. After dewaxing and hydration, sections were stained with Weigert's iron hematoxylin solution (a 1:1 mixture of solution A and solution B) for 8 minutes to stain nuclei. After rinsing with running water for 15 seconds, sections were then incubated with acidic ethanol solution for 10 minutes. After rinsing with running water for 15 seconds, sections were inverted with Masson's blue solution for 5 minutes. Sections were then rinsed with running water for 5 minutes and stained with Ponceau red for 8 minutes. Sections were then rinsed with 0.2% glacial acetic acid solution and treated with phosphomolybdic acid solution for 2 minutes to block myofiber staining. Sections were then counterstained with aniline blue for 2 minutes to specifically label collagen fibers. Stained sections were then incubated with 0.2% glacial acetic acid for 3 seconds, dehydrated with a gradient of 95% to 100% ethanol, and cleared with xylene before mounting with neutral resin. Observation was performed using a Zeiss upright fluorescence microscope (bright field). The results showed that the glomeruli and renal tubules of the rats in the blank control group were intact, the overall muscle fibers were red, and no obvious collagen fiber proliferation or fibrosis areas were observed. The renal tissue of the model group showed enlarged glomeruli, sclerosis of some glomeruli, disordered and dilated renal tubules, and significant widening of the renal interstitial area with a large number of vacuoles. A small amount of blue collagen fibers were observed, mainly distributed in the renal interstitial area and around the renal tubules ( Figure 2 B) The results showed an increase in renal collagen fibers.

[0052] Immunofluorescence (IF) staining was used to observe the expression and distribution of renal tissue fibrosis indicators. Paraffin sections were pretreated in the same way as HE staining, and the antigen activity was restored using the sodium citrate buffer high-pressure heat-induced epitope retrieval method. After cooling naturally to room temperature, the sections were rinsed three times with PBS. The renal tissue area was circled with a histochemical pen, and 3% bovine serum albumin was added at room temperature for 30 minutes to block non-specific binding sites. The target primary antibody was added at a dilution of 1:200 and incubated in a humidified box at 4°C overnight. After rinsing with PBS, a 1:100 diluted FITC-labeled fluorescent secondary antibody was added and reacted at room temperature in the dark for 2 hours. The nuclear counterstain was treated with DAPI for 5 minutes. After sealing with anti-fluorescence quencher, images were collected under a Zeiss upright fluorescence microscope. The images were semi-quantitatively analyzed for fluorescence intensity using ImageJ software. The results showed that COL1A1 was mainly distributed in the renal tubules, and α-SMA was mainly distributed in the interstitial area. The fluorescence intensity of COL1A1 and α-SMA in the blank control group was low, while that in the model control group was high ( Figure 2 CD). The results suggest extracellular matrix deposition and fibroblast activation in the kidney.

[0053] Western blotting (WB) was used to analyze the expression of proteins associated with the renal fibrosis phenotype. Fresh renal cortical tissue was snap-frozen in liquid nitrogen and weighed to 0.1 g. The tissue was then mechanically homogenized in 100 μl of pre-chilled RIPA lysis buffer (containing 1% protease inhibitors and 1% phosphatase inhibitors) and incubated at 4°C for 30 minutes to promote complete lysis. The lysate was centrifuged at 12,000 rpm for 15 minutes, and the supernatant was collected. Protein concentration was determined using the BCA assay and adjusted to a uniform concentration. 5X SDS-PAGE protein loading buffer was added at a 4:1 ratio, and the cells were denatured in a metal bath at 100°C for 10 minutes. A 10% separating gel and a 5% stacking gel were prepared for SDS-PAGE electrophoresis (40 μg sample per well, constant voltage 80 V until the indicator reached the separating gel interface, then adjusted to 120 V). The supernatant was terminated when bromophenol blue migrated to the gel bottom. The protein was transferred to the PVDF membrane using the wet transfer method (70V constant pressure for 90 minutes). After blocking with 5% skim milk powder-PBST blocking solution at room temperature for 2 hours, the membrane was incubated with diluted primary antibodies (target protein antibody 1:1000, internal reference GAPDH antibody 1:4000) at 4°C overnight. After rinsing with PBST 3 times for 10 minutes each time, the membrane was reacted with HRP-labeled secondary antibody (1:4000 dilution) at room temperature for 2 hours. After development with ECL chemiluminescence reagent, the grayscale value was analyzed using ImageJ software. The relative expression of the target protein was expressed as the grayscale ratio of the target band to the internal reference band. The results showed that the protein expression of renal fibrosis-related indicators FN1, COL1A1, VIM, and α-SMA in the model group was significantly higher than that in the blank control group ( Figure 3 The results showed that extracellular matrix deposition in renal tissue, epithelial-mesenchymal transition of epithelial cells, and activation of fibroblasts were observed, and the renal fibrosis model was successfully established.

[0054] 3) Proteomics sample preprocessing

[0055] Protein extraction. Rat renal cortical tissue samples were removed from -80°C, weighed into a mortar, and thoroughly ground with liquid nitrogen until powdered. Four volumes of lysis buffer (containing 8 M urea and 1% protease inhibitors) were added to each sample group and lysed by sonication. The samples were centrifuged at 12,000 g for 10 minutes at 4°C. The supernatant was collected and protein concentration was determined using a BCA kit.

[0056] Trypsin digestion. Take an equal amount of protein sample for enzymatic digestion, slowly add trichloroacetic acid (TCA) at a final concentration of 20%, vortex to mix, and precipitate at 4°C for 2h. Centrifuge at 4500g for 5min, discard the supernatant, and wash the precipitate 2-3 times with pre-cooled acetone. After drying the precipitate, add TEAB at a final concentration of 200mM to resuspend, mix thoroughly with ultrasound, add 1 / 50 trypsin, and digest overnight. Add dithiothreitol (DL-Dithiothreitol, DTT) to a final concentration of 5mM and reduce at 56°C for 30min. Then add iodoacetamide (IAM) to a final concentration of 11mM and incubate at room temperature in the dark for 15min.

[0057] 4) Liquid chromatography-mass spectrometry analysis

[0058] Peptides were dissolved in liquid chromatography mobile phase A and separated using a Vanquish Neo UHPLC system. Mobile phase A consisted of 0.1% formic acid and 2% acetonitrile in water; mobile phase B consisted of 0.1% formic acid and 90% acetonitrile in water. The gradient was as follows: 6% to 23% B (0-68 min); 23% to 32% B (68-82 min); 32% to 80% B (82-86 min); and 80% B (86-90 min). The flow rate was maintained at 500 nL / min. After separation on the UHPLC system, the peptides were injected into the NSI ion source for ionization and then analyzed on an Orbitrap Exploris 480 mass spectrometer. The ion source voltage was set to 2300 V, and the FAIMS offset voltages were set to -45 V and -65 V. The peptide precursor ions and their secondary fragments were detected and analyzed using the high-resolution Orbitrap system. The primary mass spectrometry scan range was set to 400-1200 m / z, and the scan resolution was set to 60,000; the secondary mass spectrometry scan range had a fixed starting point of 110 m / z, the secondary scan resolution was set to 15,000, and TurboTMT was set to off. The data acquisition mode used a data-dependent scanning program, that is, after the primary scan, the top 25 peptide precursor ions with the highest signal intensity were selected and sequentially entered the HCD collision cell using 27% fragmentation energy for fragmentation, and secondary mass spectrometry analysis was also performed in sequence. In order to improve the effective utilization of the mass spectrometer, the automatic gain control was set to 100%, the signal threshold was set to 50,000 ions / s, the maximum injection time was set to Auto, and the dynamic exclusion time of the tandem mass spectrometry scan was set to 20 s to avoid repeated scanning of the precursor ions.

[0059] 5) Database search

[0060] Mass spectrometry analysis can obtain the mass-to-charge ratio and signal intensity of peptides and their fragment ions in a sample. Peptide-level information is generally referred to as the primary spectrum, and peptide fragment ion information is referred to as the secondary spectrum. A theoretical secondary spectrum is constructed based on the protein sequence in the database, which is then searched and compared with the secondary spectrum generated by the mass spectrometer. After algorithmic scoring and filtering, the theoretical peptide sequence with the correct match is obtained. Protein information is then identified by identifying protein-specific peptides. The specific steps are as follows:

[0061] Secondary mass spectrometry data were searched using ProteomeDiscoverer (v2.4.1.15). A reverse library was added to calculate the false discovery rate (FDR) caused by random matches, and a common contamination library was added to the database to eliminate the influence of contaminating proteins in the identification results. The enzyme digestion method was set to Trypsin (Full), and the number of missed cleavage sites was set to 2. The minimum peptide length was set to 6 amino acid residues, and the maximum number of peptide modifications was set to 3. The mass error tolerance for primary precursor ions was set to 10 ppm, and the mass error tolerance for secondary fragment ions was set to 0.02 Da. Carbamidomethyl (C) was set as a fixed modification, and Oxidation (M), Acetyl (N-terminus), Met-loss (M), and Met-loss acetyl (M) were set as variable modifications. To obtain high-quality analysis results, the library search results required further data filtering. The identification FDR was set to 1% at the spectrum, peptide, and protein levels, and proteins were required to contain at least one specific peptide.

[0062] Data quality control. After the database search is completed, a series of quality control evaluations are required to ensure that the quality of the results meets the standards: including peptide length distribution, peptide number distribution, protein coverage distribution, and protein molecular weight distribution.

[0063] 6) Sample quality assessment

[0064] The principal component analysis (PCA) method was used to evaluate whether the quantitative results of biological replicate samples were statistically consistent. PCA analysis was performed based on the relative quantitative values ​​of all samples, and a visualization graph was drawn. The horizontal and vertical axes were marked with the explanatory power of PC1 and PC2. The larger the value, the higher the explanatory power. The degree of clustering within the group represents the repeatability of the grouped samples. Repeated samples within the group tend to cluster ( Figure 4 A). The results showed that there were significant differences between sample groups, but small differences within the groups.

[0065] The protein intensity values ​​of each sample were extracted to explore the distribution and differences of protein intensity values ​​between different samples. Box plots were used for display. The colors of the boxes represent different groups. Horizontal comparison can roughly show the dispersion of data distribution within and between groups ( Figure 4 B) The results show that the sample means are on the same level and the sample quality is good.

[0066] 7) Differential protein screening and enrichment analysis

[0067] Each sample group had three biological replicates, and the ratio of the mean relative quantitative values ​​of the protein in the two groups of samples was used as the fold change (FC). The calculation formula is as follows:

[0068] FCA / B, k = Mean(Rik, i∈A) / Mean(Rik, i∈B). To make the test data conform to the normal distribution, a Log2 logarithmic transformation was performed. The relative quantitative values ​​of protein samples between groups were calculated using a T test to obtain the corresponding P value, and significant values ​​of P < 0.05 were screened. The calculation formula is as follows:

[0069] Pk=T.test(Log2(Rik, i∈A), Log2(Rik, i∈B))

[0070] Where A and B represent groups, R represents protein relative quantitative value, i represents sample, and k represents protein. Further screening was performed to determine if the differential expression level change exceeded 1.5 as a significant upregulation threshold, and if it was less than 0.67 as a significant downregulation threshold.

[0071] Volcano plots were drawn based on the differentially expressed proteins. The blue color indicated proteins that were down-regulated in the model group / blank group, and the red color indicated proteins that were up-regulated in the model group / blank group ( Figure 4 C).

[0072] Functional enrichment analysis of differentially expressed proteins mainly focused on KEGG pathway enrichment ( Figure 4 D) The results showed that the differentially expressed proteins in the oxidative phosphorylation pathway were significantly enriched.

[0073] A protein-protein interaction network (PPI) was constructed for oxidative phosphorylation pathway proteins, and the degree value was calculated to evaluate the protein core degree. The network was visualized using Cytoscape 3.7.1 ( Figure 4The results suggested that ATP synthase subunit alpha (ATP5F1A), NADH dehydrogenase [ubiquinone] iron-sulfur protein 8 (NDUFS8), succinate dehydrogenase complex subunit A (SDHA), succinate dehydrogenase complex subunit B (SDHB), and ubiquinol-cytochrome c reductase complex iron-sulfur subunit (UQCRFS1) are core proteins in the oxidative phosphorylation pathway.

[0074] Example 2 Screening and Verification of SDHB, a Core Target of Oxidative Phosphorylation

[0075] 1) Western blot analysis of oxidative phosphorylation-related protein expression in renal tissue of Ade rats

[0076] The renal cortex tissue of Ade rats frozen and packaged in "Example 1" was used to prepare WB experimental protein samples. The expression of ATP synthase subunit alpha (ATP5F1A), NADH dehydrogenase iron-sulfur protein 8 (NADHdehydrogenase [ubiquinone] iron-sulfur protein 8, NDUFS8), succinate dehydrogenase complex subunit A (Succinate dehydrogenase complex subunit A, SDHA), succinate dehydrogenase complex subunit B (Succinate dehydrogenase complex subunit B, SDHB), and ubiquinol-cytochrome creductase complex iron-sulfur subunit (UQCRFS1) proteins were detected. The results showed that the model group had different degrees of decreases in the above proteins compared with the blank group, among which SDHB decreased most significantly (P < 0.0001) ( Figure 5 AB). The results suggest that SDHB is the most promising potential therapeutic target for renal fibrosis.

[0077] 2) Immunofluorescence detection of SDHB expression and distribution in renal tissue of Ade rats

[0078] The paraffin sections of the kidney tissue of the Ade rats in Example 1 were dried and dewaxed, and the antigen activity was restored by high-pressure heat-induced epitope retrieval with sodium citrate buffer. The target primary antibody was added at a dilution of 1:200 and incubated in a humidified chamber at 4°C overnight. A 1:100 diluted FITC-labeled fluorescent secondary antibody was added and reacted at room temperature in the dark for 2 hours. After sealing, images were collected under a Zeiss upright fluorescence microscope. The results showed that SDHB was mainly expressed in the renal tubules, and the expression of SDHB in the model group was significantly decreased compared with the blank group ( Figure 6 ).

[0079] 3) GEO database analysis of SDHB expression in CKD kidney tissue

[0080] The data comes from the GEO database GSE104954 data set, which is derived from the tubulointerstitial transcriptome of subjects with chronic kidney disease and living donor biopsies from the European Renal cDNA Bank (ERCB). The original data were cleaned and organized into a complete gene expression matrix, in which rows represent genes and columns represent samples. The expression levels of the SDHB gene in different samples were screened and violin plots were drawn. The results showed that the SDHB transcription levels in renal disease types with higher degrees of fibrosis, such as diabetic nephropathy, focal segmental glomerulosclerosis, Anka-related nephritis, IgA nephropathy, and hypertensive nephropathy, were downregulated, while the SDHB transcription levels in renal disease types with lower degrees of fibrosis, such as minimal change disease and thin basement membrane nephropathy, did not show any significant changes ( Figure 7 The results suggest that SDHB is a potential therapeutic target for renal fibrosis.

[0081] Example 3: Construction of SDHB gene knockout and overexpression cell lines

[0082] In this example, SDHB gene knockout and overexpression human renal tubular epithelial cell (HK-2) models were constructed to evaluate the role of SDHB in renal fibrosis. The specific methods are as follows:

[0083] 1. SDHB knockout plasmid glycerol bacteria: seamlessly cloned into the 5'Bsmbl-3'Unlimited LentiCRISPR v2-Puro vector, inserting a 25 bp fragment with the following sequence: CACCGATGGCAAATTTCTTGATACG, SEQ ID NO.1.

[0084] 2. SDHB overexpression plasmid glycerol bacteria: The SDHB gene was cloned into the pLV4ltr-PGK-ZsGreen(2A)PURO-CMV(P202210AA) vector via 5'EcoRI-3'BamHI. The insert size was 852 bp and the sequence was shown in SEQ ID NO. 2. The specific steps were:

[0085] 1) Plasmid Extraction: Select a single colony and inoculate it into 5 mL of LB medium containing ampicillin. Cultivate the culture at 37°C and 220 rpm for 18 hours. Use the YALEPIC Endotoxin-Free Plasmid DNA Miniprep Kit (YC47004) for plasmid extraction. Perform cell lysis, protein precipitation, plasmid precipitation, and purification according to the kit instructions.

[0086] 2) Lentivirus packaging: Before transfection, culture 293T cells in culture medium without anti-antibodies to a confluency of approximately 80-90%. Add 1200ng of packaging plasmid PMD2.G (A), 2400ng of psPAX2 (B), and 4800ng of target plasmid (C) to 0.5mL of serum-free and antibiotic-free Opti medium. Mix thoroughly by pipetting, then add 18µl of the PEI25000 co-infection reagent. Mix again by pipetting, then incubate at room temperature for 20 minutes to form the transfection complex. Slowly add the transfection complex to the culture flask. Incubate in the incubator for 8 hours, then replace with 5ml of fresh medium. Continue incubating for 48 hours, then add 3ml of fresh medium. After 24 hours, collect 8ml of supernatant in a 15mL centrifuge tube. Add 2ml of 5X PEG 8000 to the culture supernatant overnight to fully concentrate the virus. Collect the virus by centrifugation at 4800rpm for 10 minutes at 4°C. Discard the supernatant and resuspend in 400ul of PBS. The cell can be transfected or aliquoted and stored at -80℃ for long-term storage.

[0087] 3) Construction and screening of stable cell lines: 1-5×10 5 HK-2 cells were seeded into 24-well plates and puromycin with different concentration gradients (0, 0.5, 1, 2, 4, 6, 8 mg / ml) was added. After 48 hours, the cell death was observed, the puromycin concentration that could kill the cells was screened and photographed. After the HK-2 cells were re-plated, the infection enhancer was added to the culture medium at a ratio of 1:1000, and 400ul of anti-antibody culture medium and 100ul of virus were added to each well. After 12 hours, the growth medium was replaced and cultured. After the cells grew to 80-90%, they were digested and inoculated into 12-well plates or 6-well plates. The cells in the 12-well plates or 6-well plates were screened using the determined puromycin concentration. After administration, the cell morphology was observed. After 48 hours, the culture medium was replaced and the amplification culture was continued for subsequent wb verification.

[0088] 4) Identification of stable cell lines: The total protein of the stable cell lines was extracted, and the expression level of the target protein was detected by Western Blot. For the knockout strain, the expression of the target protein was expected to be significantly reduced or disappeared; for the overexpression strain, the expression of the target protein was expected to be significantly increased. At the same time, according to the research purpose, the corresponding functional experiments were designed to verify the biological function of the stable cell line. The results showed that the wild-type HK-2 cells expressed SDHB at a molecular weight position of 33kDa, the SDHB knockout cells did not express significantly at a molecular weight position of 33kDa, and the SDHB overexpression cells increased the molecular weight of the fusion protein by about 2.64kDa due to the insertion of the 3*FLAG tag, so it was significantly expressed at a molecular weight position of 36kDa ( Figure 8 The results showed that SDHB gene knockout and overexpression HK-2 cell lines were successfully constructed.

[0089] Example 4 Study on the anti-renal fibrosis function and mechanism of SDHB protein target

[0090] 1) Detection of mitochondrial respiratory function in SDHB knockout / overexpression HK-2 cells

[0091] HK2 cells were digested and counted, and a 100 μL cell suspension containing 1x106 cells was prepared. Mitochondrial respiration was assessed in a 2 ml chamber using the high-resolution respirometry system Oroboros O2k at 37°C. After air correction, the following reagents were added in sequence according to the OUA titration protocol: oligomycin (Oligomycin, Omy), uncoupler (FCCP, U), rotenone (Rot), and antimycin A (Antimycin A, Ama) to assess mitochondrial uncoupled respiration, oxidative phosphorylation oxygen consumption rate, maximum respiration rate, and residual oxygen consumption rate, respectively. Mitochondrial respiration is expressed as oxygen flux per unit mass per second (pmolO2 / s / mg), which is expressed by The software automatically corrected the instrument background and calculated the oxygen consumption rate under different conditions. The results showed that in the blank group (Ctrl) and the model group (TGF-β), the mitochondrial respiration rate of SDHB knockout HK-2 cells was lower than that of wild-type HK-2 cells, and the mitochondrial respiration rate of SDHB overexpression HK-2 cells was higher than that of wild-type HK-2 cells ( Figure 9 The results suggest that SDHB plays a positive role in maintaining oxidative phosphorylation metabolism.

[0092] 2) Detection of fibrosis indicators in HK-2 cells with SDHB knockout / overexpression

[0093] SDHB knockout / overexpression HK-2 stable cells were subjected to routine plating modeling operations and divided into blank control group, blank knockout group, blank overexpression group, model control group, model knockout group, and model overexpression group according to different cell types. TGF-β110ng / ml concentration was used for stimulation for 48 hours. Routine cell collection operations were performed and WB experimental protein samples were prepared. The expression levels of FN1, COL1A1, VIM, and α-SMA proteins were detected between different groups. The results showed that in the blank group (Ctrl) and the model group (TGF-β), the fibrosis index lines FN1, COL1A1, VIM, and α-SMA protein expressions of SDHB knockout HK-2 cells were increased compared with those of wild-type HK-2 cells, and the fibrosis index lines FN1, COL1A1, VIM, and α-SMA protein expressions of SDHB overexpression HK-2 cells were decreased compared with those of wild-type HK-2 cells ( Figure 10 The results suggest that SDHB has a positive effect on alleviating renal fibrosis.

[0094] 3) SDHB single gene set enrichment analysis

[0095] The data comes from the GSE104954 dataset of the GEO database, which is derived from the tubulointerstitial transcriptome of subjects with chronic kidney disease and living donor biopsies from the European Renal cDNA Bank (ERCB). The raw data were cleaned and organized into a complete gene expression matrix, in which rows represent genes and columns represent samples. After selecting the target gene SDHB, the samples were artificially divided into SDHB high expression group and SDHB low expression group based on their different expressions with the median as the boundary. GSEA4.33 software was used to read the gene set files and grouping files required for analysis, and the gene list was compared with the gene set file to calculate the gene set enrichment score (Enrichment Score, ES), normalized enrichment score (NES) as well as p value and FDR. The enrichment results with P < 0.05 were selected and the top 30 signal pathways ranked by ES value and NES value were used to draw the KEGG classification bar chart ( Figure 11 A), select the key pathway JAK-STAT to draw the GSEA enrichment map ( Figure 11 B). KEGG pathway diagram shows that STAT3, a key target of the JAK-STAT pathway, can regulate the downstream FOXO and HIF-1 signaling pathways ( Figure 11 CD). The results suggest that SDHB may regulate FOXO and HIF-1 signaling pathways through STAT3.

[0096] 4) Verify changes in downstream pathways in SDHB knockout / overexpression HK-2 cell lines

[0097] SDHB knockout / overexpression HK-2 stable cells were subjected to routine plating and drug administration operations, and were divided into blank control group, blank knockout group, model control group, and model overexpression group according to different cell types. TGF-β110ng / ml concentration was used for stimulation for 48 hours for modeling. Routine cell collection operations were performed, and WB experimental protein samples were prepared. STAT3 and its downstream HIF-1 and FoxO pathway key proteins were detected between different groups. The results showed that after SDHB knockout in the blank group, the levels of STAT3 and FOXO1 phosphorylated proteins and HIF1A protein expression increased; after SDHB overexpression in the model group, the levels of STAT3 and FOXO1 phosphorylated proteins and HIF1A protein expression decreased ( Figure 12 ).

[0098] 5) Detection of mitochondrial autophagy and PINK1-Parkin pathway protein expression levels

[0099] SDHB knockout / overexpression HK-2 stable cells were subjected to routine plating and drug administration operations, and were divided into blank control group, blank knockout group, model control group, and model overexpression group according to different cell types. TGF-β110ng / ml concentration was used for stimulation for 48 hours. Routine cell collection operations were performed, and WB experimental protein samples were prepared. The expression of PINK1, Parkin, LC3B, and BECN1 proteins was detected among different groups. The results showed that after SDHB knockout in the blank group, the expression of P62 and LC3B increased slightly, the expression of BECN1 decreased slightly, and PINK1 and Parkin showed a downward trend but no statistical significance; after SDHB overexpression in the model group, the expression of P62 decreased significantly, and the expression of PINK1, Parkin, LC3B, and BECN1 increased ( Figure 13 The results suggest that mitophagy is weakened during renal fibrosis, while SDHB overexpression can restore mitophagy.

[0100] In summary, the present invention screened SDHB, a key target of the oxidative phosphorylation pathway, through proteomic analysis combined with experimental verification; verified its ability to maintain mitochondrial oxidative phosphorylation and resist renal fibrosis by knocking out and overexpressing SDHB; verified through GSEA analysis and experiments that SDHB can regulate downstream FoxO and HIF-1 signaling through STAT3 and restore mitochondrial autophagy through PINK1-Parkin pathway, exploring and explaining the key role of SDHB in renal fibrosis and its regulatory mechanism, providing new targets and strategies for the prevention, diagnosis and treatment of renal fibrosis.

Claims

1. Use of succinate dehydrogenase subunit B (SDHB) in the preparation of a drug for preventing and / or treating renal fibrosis.

2. The use according to claim 1, characterized in that Preventing and / or treating renal fibrosis by enhancing the expression level and / or activity of SDHB.

3. The use according to claim 1, characterized in that The renal fibrosis includes tubulointerstitial fibrosis and / or glomerular sclerosis.

4. The use according to claim 1, characterized in that Regulates the expression and / or activity of SDHB through the STAT3 signaling pathway.

5. The use according to claim 1, characterized in that Affects PINK1-Parkin-mediated mitophagy by regulating SDHB.

6. A method for screening drugs for treating renal fibrosis, characterized in that: The method comprises the following steps: (1) contacting a candidate compound with cells expressing SDHB; (2) determining the effect of the candidate compound on the expression level and / or activity of SDHB; (3) Select compounds that can enhance the expression level and / or activity of SDHB as potential therapeutic drugs for renal fibrosis.

7. The method according to claim 6, characterized in that The method further comprises determining the effect of the candidate compound on at least one of the following indicators: (1) Mitochondrial oxidative phosphorylation function; (2) PINK1-Parkin-mediated mitophagy; (3) expression of renal fibrosis-related proteins FN1, COL1A1, VIM, and / or α-SMA; (4) STAT3, HIF-1 and / or FoxO signaling pathway activity.

8. A use of succinate dehydrogenase subunit B (SDHB) as a biomarker for renal fibrosis, characterized in that: By detecting the expression level of SDHB in subject samples, it can be used for diagnosis, prognosis assessment or treatment effect monitoring of renal fibrosis.

9. A method for treating renal fibrosis by regulating SDHB expression and / or activity, characterized in that The method comprises the following steps: administering a drug capable of enhancing SDHB expression and / or activity to a subject having or at risk of renal fibrosis.

10. The method according to claim 9, characterized in that The drug enhances SDHB expression and / or activity through one of the following pathways: (1) Upregulating SDHB gene expression; (2) Enhance the stability of SDHB protein; (3) Enhance the catalytic activity of SDHB protein; (4) Regulate the STAT3 signaling pathway.

Images