Kazakstan yeast strain, microbial inoculum, fermentation product, and preparation and application of Kazakstan yeast strain, microbial inoculum and fermentation product

Abstract

The invention belongs to the field of microorganisms, and particularly relates to a Kazakstein monospora strain, a Kazakstein monospora inoculant, a fermented product and preparation and application of the Kazakstein monospora strain. The Kazakstan monospora yeast provided by the invention has the advantages that the Kazakstan monospora yeast AMCC 30302 (Kazakstan unisporaAMCC 30302) is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number of the Kazakstan monospora yeast is CCTCC M 20231787. The Kazakstachya monospora AMCC 30302 provided by the invention can be used for effectively degrading the furfural and generating compounds such as the acetoin, the acetic acid and the like which are relatively high in content. The Kazakstachya monospora AMCC 30302 provided by the invention can be used for effectively degrading the furfural and generating the compounds such as the acetoin and the acetic acid and the like. Feed fermented by the Kazakstein monospora strain provided by the invention mainly has the sensory characteristic of mainly generating sour and fragrant flavor, the effects of stimulating the appetite of animals and improving the palatability of the feed are achieved, and the feed can generate organic acid and is beneficial to maintaining the health of the intestinal environment of the animals; meanwhile, a large amount of nicotinic acid is generated, the feed conversion rate can be increased, and growth and development of animals are promoted.

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms, and in particular relates to a single-spored Kazakh yeast strain, a bacterial agent, a fermentation product, and preparation and application thereof. Background Art

[0002] Kazachstania unispora belongs to the genus Kazachstania and is widely distributed in traditional fermentation scenarios. So far, this strain has been isolated from Tibetan lingzhi mushrooms, traditional yogurt in Inner Mongolia, and fermented camel milk and cheese in Xinjiang. Due to its safe source, this strain is widely used in the production of health factors, such as exopolysaccharides, ACE inhibitory peptides, pyrazines, etc.

[0003] Furfural is primarily produced by the dehydration of pentose sugars in a high-temperature, acidic environment. Corncobs, wheat bran, rice bran, rice husks, and sawdust, all high in pentosans, are prone to producing furfural, primarily in the chemical industry. Heat pretreatment is essential for the high-value utilization of plant biomass. The furfural produced not only affects the subsequent hydrolysis efficiency of cellulase but also severely inhibits bacterial growth and metabolism, negatively impacting animal health.

[0004] Distillers dried grains with solubles (DDGS) are waste biomass produced during the fermentation of cereal grains to produce ethanol. They contain microbial growth inhibitors such as furfural, are highly acidic, have low levels of nitrogen-free extracts (starch and sugars), are high in lignocellulose, and have poor palatability. Therefore, identifying single-celled Kazakh yeasts that can both efficiently degrade furfural, thereby reducing biomass toxicity, and produce flavor and functional substances is crucial for the development of plant biomass resources. Summary of the Invention

[0005] In view of the problems that furfural produced in the process of resource utilization of plant biomass in the existing technology not only affects product quality but also leads to low efficiency of cellulase hydrolysis and inhibition of microbial growth in subsequent deep utilization, the present invention provides a monosporic Kazakh yeast strain with the characteristics of attenuating plant biomass and producing flavor substances and functional substances.

[0006] In a first aspect, the present invention provides a Kazakh unispora yeast, characterized in that the Kazakh unispora yeast is Kazakh unispora yeast AMCC 30302 (Kazachstania unispora AMCC 30302), which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M 20231787.

[0007] Preferably, the 26S rDNA gene sequence of the Kazakhstan monosporic yeast strain is shown as SEQ ID NO.1.

[0008] Preferably, the Kazakhstan monosporic yeast strain has the characteristics of increasing nicotinic acid content, and / or having the characteristics of degrading furfural content, and / or having the characteristics of producing aromatic substances.

[0009] In a second aspect, the present invention provides a fermentation method for preparing a monosporic Kazakh yeast agent, the preparation method comprising the following steps:

[0010] (1) amplifying and culturing the monosporic Kazakh yeast strain according to any one of claims 1 to 3 at a culture temperature of 20-42° C.;

[0011] (2) fermenting the monosporic Kazakh yeast strain amplified and cultured in step (1) at a culture temperature of 20-42°C.

[0012] Preferably, the culturing time in step (1) is 12-48 h; and / or the culturing time in step (2) is 24-144 h.

[0013] In a third aspect, the present invention provides a monosporic Kazakh yeast agent, which is obtained by the fermentation preparation method.

[0014] Preferably, the Kazakhstan monosporic yeast can produce one or more of acetoin, phenylethanol, acetic acid, citronellol, phenylacetaldehyde, benzaldehyde, 3-ethyl-2,5-dimethylpyrazine, 2,5-dimethylpyrazine, 2-methylpyrazine, 2-ethyl-6-methylpyrazine, 2-ethyl-3,5-dimethylpyrazine, ethyl phenylacetate, phenylethyl acetate, γ-quinolide, γ-dodecalactone, γ-pentyl acetate, phenylethyl propionate, ethyl benzoate, benzyl acetate, phenylethyl isobutyrate and 2-nonanone.

[0015] In a fourth aspect, the present invention provides a yeast fermentation culture, which is prepared by a method comprising the following preparation steps: inoculating the monosporic Kazakhstan yeast strain or the monosporic Kazakhstan yeast agent into plant biomass, and fermenting and culturing at 30-37°C.

[0016] Preferably, the yeast fermentation culture comprises one or more of acetoin, phenylethanol, acetic acid and phenylethyl acetate.

[0017] In a fifth aspect, the present invention provides a method for preparing the yeast fermentation culture, comprising the steps of inoculating the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 5 into plant biomass, and fermenting and culturing at 30-37°C.

[0018] Preferably, the monosporic Kazakh yeast strain or the monosporic Kazakh yeast agent is used to degrade furfural content, and / or to increase nicotinic acid content, and / or to produce aromatic substances.

[0019] Preferably, the monosporic Kazakh yeast strain or the monosporic Kazakh yeast agent is used to degrade furfural content in plant biomass fermentation; and / or to increase nicotinic acid content in plant biomass fermentation; and / or to produce aromatic substances in plant biomass fermentation.

[0020] Preferably, the monosporic Kazakhstan yeast strain or the monosporic Kazakhstan yeast agent is used in feed additives or food additives.

[0021] Preferably, the monosporic Kazakhstan yeast strain or the monosporic Kazakhstan yeast agent is used in the preparation of food or feed.

[0022] In a sixth aspect, the present invention provides a feed additive or a food additive, wherein the feed additive or the food additive contains the monosporic Kazakhstan yeast strain or the monosporic Kazakhstan yeast agent.

[0023] In a seventh aspect, the present invention provides a food or feed, wherein the food or feed contains the monosporic Kazakhstan yeast strain or the monosporic Kazakhstan yeast agent. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Shown is the colony morphology of the monosporic yeast Kazakhstan;

[0025] Figure 2 Shown is a microscopic observation of the monosporic yeast Kazakhstan;

[0026] Figure 3 Shown is a map of the phytase screening plate;

[0027] Figure 4 Shown is the gas chromatogram;

[0028] Figure 5 Shown is a graph of niacin content;

[0029] Figure 6 Shown is a graph of reducing sugar content;

[0030] Culture collection information

[0031] The Kazakh unispora yeast AMCC 30302 (Kazachstania unispora AMCC30302) provided by the present invention was deposited in the China Center for Type Culture Collection on September 25, 2023, with a deposit number of CCTCC M20231787, and a deposit address of Wuhan University, Wuhan, China, with a postal code of 430072; and a telephone number of 027-68754052.

[0032] Beneficial effects of the present invention:

[0033] 1. The Kazakh yeast strain provided by the present invention can effectively degrade furfural and produce compounds such as acetoin and acetic acid at higher contents.

[0034] 2. The feed fermented by the Kazakh yeast strain provided by the present invention mainly produces a sensory characteristic of sour and fragrant flavor, which can stimulate the appetite of animals and improve the palatability of the feed.

[0035] 3. The feed fermented by the Kazakh yeast strain provided by the present invention can produce organic acids, which is beneficial to maintaining the health of the animal's intestinal environment; at the same time, it also produces a large amount of niacin, which can improve feed conversion rate and promote animal growth and development. DETAILED DESCRIPTION

[0036] The present invention provides a Kazakhstani unispora yeast strain, wherein the Kazakhstani unispora yeast strain is Kazakhstani unispora yeast AMCC 30302 (Kazachstania unispora AMCC 30302), which was deposited in the China Center for Type Culture Collection on September 25, 2023, with a deposit number of CCTCC M 20231787, and a deposit address of Wuhan University, Wuhan, China, with a postal code of 430072; and a telephone number of 027-68754052.

[0037] The monosporic Kazakh yeast strain AMCC 30302 provided herein was isolated from a fermented milk sample. Individual colonies are round, white, with a raised center, neat edges, and a smooth, opaque surface. Microscopically, they are oval, with cells measuring approximately 4 x 5 μm, and microscopic observations indicate budding reproduction. The 26S rDNA gene sequence of the monosporic Kazakh yeast strain AMCC 30302 is shown in SEQ ID NO. 1.

[0038] The monosporic Kazakh yeast AMCC 30302 provided by the present invention has the characteristics of high-efficiency furfural degradation, high nicotinic acid content, and production of acetoin and acetic acid, can reduce the toxicity of furfural, and increase the acid flavor.

[0039] It should be noted that Kazakhstan monosporus yeast has been included in the second edition of the "List of Microbial Species Used in Traditional Chinese Fermented Foods." This indicates that Kazakhstan monosporus yeast can be used in traditional Chinese fermented foods, thus proving that a specific strain of Kazakhstan monosporus yeast, namely Kazakhstan monosporus yeast AMCC 30302, can also be used in traditional Chinese fermented foods.

[0040] In order to better understand the technical solution of the present invention, the technical solution of the present invention is described in detail below in conjunction with specific embodiments.

[0041] Unless otherwise specified, the various reagents / instruments used in the examples of the present invention are conventional commercial products. The sources of experimental materials and instrument information used in the present invention are shown in Table 1:

[0042] Table 1 Reagent information

[0043]

[0044] Table 2 Instrument information

[0045]

[0046]

[0047] The culture medium components involved in the embodiment are as follows:

[0048] YPD medium: Mix 20 g yeast extract powder, 20 g glucose, 20 g peptone, 20 g agar, and 1000 mL water, and sterilize at 115°C for 20 min.

[0049] MRS medium: Mix 10 g of peptone, 8 g of beef extract, 4 g of yeast powder, 20 g of glucose, 1.08 g of Tween 80, 2 g of dipotassium hydrogen phosphate (anhydrous), 5 g of sodium acetate (anhydrous), 2 g of triammonium citrate, 0.2 g of magnesium sulfate (anhydrous), 0.05 g of manganese sulfate (monohydrate), 0.5 g of L-cysteine, 20 g of lactose, and 1000 mL of distilled water, and sterilize at 115°C for 20 min.

[0050] Phytase screening medium: Mix 5 g of calcium phytate, 2.5 g of ammonium sulfate, 0.5 g of magnesium sulfate, 0.5 g of potassium chloride, 0.01 g of ferrous sulfate, 0.01 g of manganese sulfate, 15 g of glucose, 20 g of agar, and 1000 mL of water, and sterilize at 115°C for 20 min.

[0051] Phytase production medium: Mix 2 g of sodium phytate, 0.5 g of potassium chloride, 0.03 g of manganese sulfate, 0.5 g of magnesium sulfate, 0.03 g of ferrous sulfate, 5 g of ammonium nitrate, 30 g of glucose and 1000 mL of water, adjust the pH to 5.5, and sterilize at 115°C for 20 min.

[0052] Example 1 Isolation and Identification of Yeast Strains in the Present Invention

[0053] The strain of the present invention is derived from fermented milk, and its preparation method is to naturally ferment fresh milk. The fermented milk sample is diluted in sterile water to prepare a bacterial suspension, and the bacterial suspension is diluted in 10-fold gradients to prepare 10 -5 , 10 -6 The bacterial suspension was spread on YPD medium and cultured at 30℃ for 7 days. A single colony was picked and streaked on YPD medium for purification and cultured for 3 days. After multiple purifications, it was inoculated on YPD slant medium, stored at 4℃ and numbered.

[0054] The purified strain was streaked onto YPD solid culture medium and cultured at 30°C for 2 days before observing the colony morphology. A single colony was picked and inoculated into 5 mL YPD liquid culture medium and cultured at 180 rpm and 30°C for 24 h. 10 μL was aspirated onto a glass slide and the bacterial morphology was observed under an optical microscope at a magnification of 40 times.

[0055] A yeast strain was obtained. Its colonies were round, white, with a raised center, neat edges, and a smooth, opaque surface. Microscopically, it was oval, with individual cells approximately 4 × 5 μm in size and budding. The yeast 26S rDNA sequence was amplified using primers NL1 (5'-GCATATCAATAAGCGGAGGAAAAG-3') and NL4 (5'-GGTCCGTGTTTCAAGACGG-3'). The PCR procedure consisted of 30 cycles of pre-denaturation at 94°C for 5 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 45 seconds, and extension at 72°C for 90 seconds, followed by a final extension at 72°C for 10 minutes. Detection by 1% gel electrophoresis and sequencing revealed the following 26S rDNA sequence: SEQ ID NO. 1:

[0056] TGCATTCAAAAAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGTACCTTCGGTGCTCGAGTTGTAATTTGTAGAGGGATACTTTGGGGCCGTTCCTTGTCTATGTTC CTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTATGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCG AACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCTCTGCTCCTTGTGGGTGGGGGAATCTCGCAGCTCACTGGGCCAACAT CAGTTTTGGTGGTCGGATAAATCCGTAGGAATGTGGCTTGCCTCGGCAAGTGTTATAGCCTGCGGGAATACGGCCAGCTGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGCCCGTCTTGAAACCACGGACCA

[0057] Combined with morphological analysis and molecular identification, the strain is Kazakhstan unispora AMCC30302 (Kazachstania unispora AMCC30302), which was deposited in the China Center for Type Culture Collection on September 25, 2023, with the deposit number CCTCC M 20231787. Figure 1 Shown is the colony morphology of the monosporic Kazakh yeast AMCC30302. Figure 2 Shown is a microscopic observation image of the monosporic Kazakh yeast AMCC30302.

[0058] Example 2 Enzyme system screening and enzyme activity determination of Kazakhstan yeast AMCC30302

[0059] 1. Enzyme system screening

[0060] The monosporic Kazakh yeast AMCC30302 was spotted onto enzyme screening medium plates and cultured at 30°C for 7 days.

[0061] like Figure 3 As shown, the Kazakhstan monosporic yeast AMCC30302 formed a hydrolysis zone on the phytase screening plate, indicating that the Kazakhstan monosporic yeast AMCC30302 can produce phytase and can be used as a basis for primary screening. It also shows that the Kazakhstan monosporic yeast AMCC30302 has the potential for plant biomass fermentation.

[0062] The use of phytase screening plates to identify Kazakh monosporic yeast AMCC30302 with potential for plant biomass fermentation is due to the fact that phytic acid is widely present in plants. Its most notable characteristic is its strong complexing with metal ions, which readily binds to divalent and trivalent ions and proteins in plants to form insoluble complexes. This leads to phytic acid's anti-nutritional effects, preventing plant nutrients such as protein from being absorbed and utilized by animals. However, the presence of phytase eliminates this anti-nutritional effect, allowing plant nutrients such as protein to be fully absorbed and utilized by animals, thereby increasing their nutritional value.

[0063] 2. Enzyme Activity Determination

[0064] (1) Obtaining crude enzyme solution

[0065] The monosporic Kazakh yeast AMCC30302 was inoculated onto YPD medium and cultured at 30°C for 1-2 days to produce a single colony. A loopful of the colony was scraped with an inoculating loop and inoculated into a test tube containing 5 mL of YPD liquid medium. The culture was shaken at 30°C and 180 rpm for 48 hours to obtain a seed solution. 100 μL of the seed solution was then inoculated into a test tube containing 5 mL of phytase production medium and cultured with shaking. After the shaking culture, the supernatant was centrifuged and used as the crude enzyme solution to be tested. The shaking culture parameters were: temperature 30°C, duration 24 hours, and rotation speed 180 rpm. The centrifugation parameters were: temperature 4°C, duration 5 minutes, and rotation speed 8000 rpm.

[0066] (2) Phytase activity determination

[0067] The determination method was carried out according to the spectrophotometric method for enzyme activity determination of feed phytase specified in GB / T 18634-2009. Sodium phytate was used as the reaction substrate, the crude enzyme solution was added and mixed evenly, and the mixture was reacted at 37° C. for 30 minutes. After color development with a color developing solution, the absorbance was measured at a wavelength of 415 nm using an ultraviolet-visible photometer. The phytase activity in the fermentation supernatant of the monosporic Kazakh yeast AMCC30302 was calculated to be 0.84 U / mL.

[0068] Example 3 Analysis of DDGS Fermentation by Kazakhstan Saccharomyces cerevisiae

[0069] (1) Preparation of solid-state fermentation materials

[0070] For each test, accurately weigh 300g of DDGS, add 197g of distilled water, and mix thoroughly with 1mL of 10M NaOH. Then, accurately weigh 100g portions and sterilize at 121°C for 20 minutes. Cool and set aside.

[0071] (2) Preparation of single-spore Kazakh yeast liquid

[0072] Inoculate the monosporic Kazakh yeast AMCC30302 onto YPD medium and culture at 30°C for 1-2 days to grow a single colony. Use an inoculating loop to scrape a loopful of liquid and inoculate it into a test tube containing 5 mL of YPD liquid medium. Incubate at 30°C and 180 rpm for 48 hours to obtain a seed solution. Then, inoculate 1 mL of the seed solution into a 250 mL Erlenmeyer flask containing 50 mL of YPD liquid medium and shake culture. Shake culture parameters: temperature 30°C, time 24 hours, rotation speed 180 rpm.

[0073] (3) Fermentation conditions

[0074] Experimental group: 100 g of DDGS to be fermented was inoculated with 10 mL of Kazakhstan monosporic yeast solution, mixed evenly, and then fermented at 30°C for 1 day. Three replicate groups were set up.

[0075] Control group: 100 g of DDGS was inoculated with 10 mL of sterile water, mixed evenly, and then fermented at 30°C for 1 day. Three replicate groups were set up.

[0076] (4) Analysis of furfural and volatile flavor compounds

[0077] Accurately weigh 4 g of fermentation sample and place it in a solid-phase extraction headspace vial. Add 1 μL of internal standard solution (o-dichlorobenzene), mix thoroughly, and seal. Equilibrate at 50°C for 30 min before performing GC-MS analysis. Gas chromatography conditions: Column: DB-HeavyWAX, 30 m × 0.25 mm × 0.25 μm, inlet temperature: 250°C, carrier gas: He; temperature program: 40°C for 3 min, increase at a rate of 5°C / min to 200°C, hold for 0 min; increase at a rate of 10°C / min to 250°C, hold for 3 min.

[0078] Gas chromatogram of Kazakhstan yeast AMCC30302 Figure 4The relative contents of the main volatile components are shown in Table 3. The main volatile substances in the control group were furfural and phenylethanol, while the main volatile substances in the experimental group were acetoin, acetic acid, and phenylethanol. The relative content of furfural in the control group was 7061 ng / g, while that in the experimental group was 11.73 ng / g. This indicates that the furfural degradation rate reached 99.83% after one day of fermentation with the Kazakhstan monosporous yeast AMCC30302, and the levels of acetoin and acetic acid produced were much higher than those in the control group. Furthermore, fermentation with the Kazakhstan monosporous yeast AMCC30302 produced a predominantly sour and fragrant flavor, which can stimulate animal appetite and improve palatability. Furthermore, feed fermented with the Kazakhstan monosporous yeast AMCC30302 produces a large amount of acetic acid, an organic acid, which is beneficial for maintaining a healthy intestinal environment in animals.

[0079] Table 3 Information on main volatile components

[0080]

[0081]

[0082] (5) Niacin

[0083] like Figure 5 As shown, niacin content was tested according to the second method of GB 5009.89-2016. No niacin was detected in the control group, while the experimental group contained 62,970.87 μg of niacin per 100 g of sample. Niacin, a widely used feed additive, can effectively improve feed protein utilization. Furthermore, since growing and finishing pigs require approximately 7.5 to 20 mg of niacin per kilogram of feed, and lactating dairy cows supplement with approximately 5 to 13 grams of niacin per day, the niacin content in the experimental group fermented with the Kazakh yeast AMCC30302 has the potential to meet the daily niacin requirements of animals. Niacin can also influence animal cellular metabolic pathways, improve feed conversion, promote growth and development, and enhance meat, milk, and egg production in livestock and poultry.

[0084] (6) Reducing sugar

[0085] Accurately weigh 1g of fresh fermentation sample into a 250mL Erlenmeyer flask. Add 50mL of distilled water and boil for 5 minutes. Transfer the entire sample to a 50mL centrifuge tube and centrifuge at 4000 rpm for 5 minutes. Collect the supernatant and transfer it to a 100mL volumetric flask. After washing the precipitate several times, transfer the wash solution to a 100mL volumetric flask to obtain a 100-fold diluted reducing sugar test solution. Samples fermented with the monosporic Kazakh yeast AMCC30302 served as the test group, while samples before fermentation served as the control group.

[0086] The reducing sugar detection system is as follows: 1 mL reducing sugar test solution, 1 mL distilled water, 1.5 mL DNS colorimetric solution; the blank correction system is: 2 mL distilled water, 1.5 mL DNS colorimetric solution, boiled at 100°C for 5 min, cooled, and the absorbance after the reaction was measured at a wavelength of 540 nm using a UV-visible photometer. A standard curve was drawn using 0, 0.2, 0.4, 0.6, 0.8, and 1 mg / mL glucose standard solutions to calculate the reducing sugar content in the test solution.

[0087] like Figure 6 As shown in the figure, the reducing sugar content in the control group was 0.96%, while that in the experimental group was 1.13%. This indicates that the reducing sugar content increased by 0.17% after fermentation with the Kazakhstan monosporic yeast AMCC30302. This is mainly due to the cellulase and amylase produced by the Kazakhstan monosporic yeast AMCC30302 during its growth, which effectively degrades cellulose and starch in the substrate, releasing reducing sugars and increasing the reducing sugar content.

[0088] Example 4 Flavor characteristics of DDGS fermented by Kazakhstan yeast

[0089] The fermentation materials, bacterial liquid and fermentation conditions were prepared as described in Example 3, except that the fermentation time was extended and 4 g of samples were collected on the 3rd, 5th and 7th days of fermentation into solid phase extraction headspace bottles. The flavor components were analyzed by GC-MS. The gas chromatography conditions were the same as those in Example 3.

[0090] Table 4 shows the changes in flavor compounds in DDGS fermented with Kazakhstan monosporus yeast. The results show that, compared with fermentation day 1 in Example 3, the relative content of flavor compounds in the Kazakhstan monosporus yeast culture initially increased and then decreased with fermentation time. Flavor compound content reached its highest level on day 3 of fermentation, with peak values ​​of 3289 ng / g for acetoin, 741 ng / g for acetic acid, 4486 ng / g for phenylethyl acetate, and 101 ng / g for phenylethyl acetate. The primary flavor characteristic of the Kazakhstan monosporus yeast culture is a sour aroma, characterized by the creamy aroma of acetoin, the sour taste of acetic acid, and the rose aroma of phenylethyl alcohol.

[0091] Table 4 Changes in flavor substances in yeast culture Unit: ng / g

[0092]

[0093] Example 5 Flavor of Kazakhstan yeast fermentation broth

[0094] The Kazakhstani yeast (Kazachstania unispora) AMCC30302 strain from Example 1 was inoculated into MRS liquid medium and cultured at 30°C with shaking for 72 hours. The volatile components of the fermentation broth were detected as follows: 5 mL of the fermentation supernatant was transferred to a headspace vial, 1.5 g of sodium chloride and 1 μL of an internal standard solution (o-dichlorobenzene) were added, and the mixture was equilibrated at 50°C for 30 minutes before volatile component analysis. Gas chromatography conditions: Column: DB-HeavyWAX, 30 m × 0.25 mm × 0.25 μm, inlet temperature: 250°C, carrier gas: He; temperature program: 40°C for 3 minutes, then increase to 200°C at a rate of 5°C / min, hold for 0 minutes, then increase to 250°C at a rate of 10°C / min, hold for 3 minutes. The experiment was repeated three times.

[0095] Table 5 shows the main volatile components of the fermentation broth of the Kazakh yeast AMCC30302. The results show that 24 flavor compounds with aroma characteristics were detected in the volatile components, of which eight compounds were detected above the detection threshold, indicating that they are detectable in the fermentation broth. These eight compounds are: acetoin, 3-ethyl-2,5-dimethylpyrazine, phenylacetaldehyde, ethyl phenylacetate, phenylethanol, γ-decanoic acid, γ-dodecanoic acid, and γ-dodecalactone. This combination of eight compounds gives the fermentation broth of the Kazakh yeast AMCC30302 a unique, nutty, chocolate-like aroma reminiscent of floral fruit. Among them, the ratio of the relative content of 3-ethyl-2,5-dimethylpyrazine to its corresponding detection threshold was the highest, indicating that 3-ethyl-2,5-dimethylpyrazine has the most prominent flavor characteristics in the fermentation broth, with aromas of roasted nuts or roasted meat as the main characteristics.

[0096] Table 5 Information on the main volatile components in the fermentation broth

[0097]

[0098]

[0099] In summary, the monosporic Kazakh yeast AMCC30302 has a high efficiency in furfural degradation, its fermentation broth and fermentation culture have a unique flavor, and can increase the niacin content in plant biomass. It has broad application prospects in the application fields of plant biomass fermentation, production of aroma substances, food and food additives, and feed and feed additives.

[0100] The above embodiments are only for further explanation and understanding of the technical solutions of the present invention, and are not intended to limit the present invention. Any non-prominent substantial features and non-significant improvements made by those skilled in the art on this basis should fall within the scope of protection of the present invention.

Claims

1. A strain of Kazakh yeast, characterized in that: The Kazakh unispora yeast is Kazakh unispora yeast AMCC 30302 (Kazachstania unispora AMCC 30302), which is deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: M20231787.

2. The monosporic Kazakh yeast strain according to claim 1, characterized in that The 26S rDNA gene sequence of the monosporic Kazakh yeast strain is shown in SEQ ID NO.

1.

3. The monosporic Kazakh yeast strain according to claim 1 or 2, characterized in that The Kazakhstan monosporic yeast strain has the characteristics of increasing nicotinic acid content, and / or having the characteristics of degrading furfural content, and / or having the characteristics of producing aromatic substances.

4. A fermentation method for preparing a monosporic Kazakhstan yeast agent, characterized in that: The preparation method comprises the following steps: (1) amplifying and culturing the monosporic Kazakh yeast strain according to any one of claims 1 to 3 at a culture temperature of 20-42° C.; (2) fermenting the monosporic Kazakh yeast strain amplified and cultured in step (1) at a culture temperature of 20-42°C.

5. The fermentation preparation method according to claim 4, characterized in that: The culturing time in step (1) is 12-48 hours; and / or the culturing time in step (2) is 24-144 hours.

6. A single-spore Kazakh yeast agent, characterized in that It is obtained by the fermentation preparation method according to claim 4.

7. The monosporic Kazakh yeast agent according to claim 6, characterized in that The monosporic Kazakh yeast can produce one or more of acetoin, phenylethanol, acetic acid, citronellol, phenylacetaldehyde, benzaldehyde, 3-ethyl-2,5-dimethylpyrazine, 2,5-dimethylpyrazine, 2-methylpyrazine, 2-ethyl-6-methylpyrazine, 2-ethyl-3,5-dimethylpyrazine, ethyl phenylacetate, phenylethyl acetate, γ-quinoline lactone, γ-dodecalactone, γ-pentyl acetate, phenylethyl propionate, ethyl benzoate, benzyl acetate, phenylethyl isobutyrate and 2-nonanone.

8. A yeast fermentation culture, characterized in that The method is prepared by a method comprising the following steps: inoculating the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7 into plant biomass, and fermenting and culturing at 30-37°C.

9. The yeast fermentation culture according to claim 8, characterized in that The yeast fermentation culture contains one or more of acetoin, phenylethanol, acetic acid and phenylethyl acetate.

10. The method for preparing a yeast fermentation culture according to claim 8 or 9, characterized in that: The method comprises the following steps: inoculating the single-spored Kazakh yeast strain according to any one of claims 1 to 3 or the single-spored Kazakh yeast agent according to claim 5 into plant biomass, and fermenting and culturing at 30-37°C.

11. Use of the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7 in degrading furfural content, and / or in increasing nicotinic acid content, and / or in producing aromatic substances.

12. Use of the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7 for degrading furfural content in plant biomass fermentation; and / or for increasing nicotinic acid content in plant biomass fermentation; and / or for producing aromatic substances in plant biomass fermentation.

13. Use of the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7 in a feed additive or a food additive.

14. Use of the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7 in the preparation of food or feed.

15. A feed additive or food additive, characterized in that: The feed additive or food additive contains the single-spored Kazakhstan yeast strain according to any one of claims 1 to 3 or the single-spored Kazakhstan yeast agent according to claim 6 or 7.

16. A food or feed, characterized in that The food or feed contains the Kazakhstan monosporic yeast strain according to any one of claims 1 to 3 or the Kazakhstan monosporic yeast agent according to claim 6 or 7.

Images