Genetically engineered bacterium for producing iturin A and application of genetically engineered bacterium

Abstract

The invention discloses a genetically engineered bacterium for producing iturin A and application of the genetically engineered bacterium. A construction method of the genetically engineered bacterium comprises the following steps: knocking out a regulatory gene fapR in bacillus amyloliquefaciens HM618; the expression of the gene FabG is enhanced by adopting a strong promoter Ph03; the gene mmgA is knocked out; a gene fadM and a gene sdaAB are knocked out; a strong promoter Ph03 is adopted to enhance the expression of the gene proBA and the gene serC; the expression of the gene ilvD is enhanced by adopting a strong promoter Ph03; the gene gabT is knocked out; a strong promoter Ph03 is adopted to enhance the expression of the gene opp, so that the genetically engineered bacterium for producing the iturin A is obtained; the genetically engineered bacterium disclosed by the invention has the advantages of high iturin A yield, good genetic stability of the strain, excellent industrial fermentation performance and the like. The yield of the iturin A under the level of a fermentation tank can reach 7.5 g / L or above, and the construction method is simple and convenient and suitable for industrial amplification.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a genetically engineered bacterium for producing iturin A and an application thereof. Background Art

[0002] Iturin A is a cyclic lipopeptide antibiotic synthesized by Bacillus species (e.g., Bacillus subtilis and Bacillus amyloliquefaciens). It exhibits excellent surface activity and broad-spectrum antifungal activity, making it widely used in agricultural biocontrol, food preservation, and biopharmaceuticals. The primary synthesis pathway of iturin A relies on a non-ribosomal peptide synthetase (NRPS) system. Its synthesis is complex, with a multi-level metabolic regulation mechanism that has yet to be fully elucidated.

[0003] At present, the industrial production of Iturin A mainly relies on natural strains or engineered strains that have undergone preliminary modification. However, natural strains have problems such as low yield, low metabolic efficiency, and poor strain stability, which seriously limit their application in industry. In addition, the synthesis of Iturin A requires a large amount of fatty acid and amino acid precursors, and its biosynthesis is closely related to multiple metabolic pathways, including fatty acid synthesis, branched-chain amino acid metabolism, glutamate and proline pathways, etc. Therefore, the insufficient supply of precursor substances and the existence of competitive metabolism are key factors restricting the efficient synthesis of Iturin A. Existing studies have attempted to increase the yield of Iturin A through metabolic engineering methods, such as knocking out competing metabolic pathways, enhancing precursor synthesis flux, and optimizing transport systems. However, there are generally limitations such as a single regulatory level and difficulty in maintaining metabolic balance, which makes it difficult to meet the needs of large-scale industrial fermentation.

[0004] Therefore, there is an urgent need to develop a genetically engineered strain with multi-pathway coordinated regulation, sufficient precursor supply, and high genetic stability to achieve efficient and stable production of iturin A, thereby promoting its application in the industrial field. Summary of the Invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a genetically engineered bacterium for producing iturin A.

[0006] The second object of the present invention is to provide a method for constructing a genetically engineered bacterium for producing iturin A.

[0007] The third object of the present invention is to provide an application of a genetically engineered bacterium for producing iturin A.

[0008] The technical solution of the present invention is summarized as follows:

[0009] A method for constructing a genetically engineered bacterium for producing iturin A comprises the following steps: knocking out the regulatory gene fapR in Bacillus amyloliquefaciens HM618; enhancing the expression of the gene fabG by using the strong promoter Ph03; knocking out the gene mmgA; knocking out the genes fadM and sdaAB; enhancing the expression of the genes proBA and serC by using the strong promoter Ph03; enhancing the expression of the gene ilvD by using the strong promoter Ph03; knocking out the gene gabT; and enhancing the expression of the gene opp by using the strong promoter Ph03, thereby obtaining a genetically engineered bacterium for producing iturin A.

[0010] The nucleotide sequence of the regulatory gene fapR is B. amyloliquefaciens HM618, DKG78_08755;

[0011] The nucleotide sequence of the gene fabG is B. amyloliquefaciens HM618, DKG78_08770;

[0012] The nucleotide sequence of the gene mmgA is B. amyloliquefaciens HM618, DKG78_12215;

[0013] The nucleotide sequence of the gene fadM is B. amyloliquefaciens HM618, DKG78_16020;

[0014] The nucleotide sequence of the gene sdaAB is B. amyloliquefaciens HM618, DKG78_08740;

[0015] The nucleotide sequence of the gene proBA is B. amyloliquefaciens HM618, DKG78_07360;

[0016] The nucleotide sequence of the gene serC is B. amyloliquefaciens HM618, DKG78_05835;

[0017] The nucleotide sequence of the gene ilvD is B. amyloliquefaciens HM618, DKG78_10960;

[0018] The nucleotide sequence of the gene gabT is B. amyloliquefaciens HM618, DKG78_02530;

[0019] The nucleotide sequence of the gene opp is B. amyloliquefaciens HM618, DKG78_06475;

[0020] The nucleotide sequence of the strong promoter Ph03 is shown in SEQ ID NO.1.

[0021] The above construction method constructs a genetically engineered bacterium for producing iturin A.

[0022] The application of the above genetically engineered bacteria in the fermentation production of iturin A.

[0023] Advantages of the present invention:

[0024] By reconstructing multi-site metabolic pathways and regulating key gene expression, the supply of fatty acid and amino acid precursors was significantly improved, effectively reducing metabolic competition and enhancing nutrient transport efficiency. The resulting genetically engineered bacteria exhibited high iturin A production, good genetic stability, and excellent industrial fermentation performance. Iturin A production reached over 7.5 g / L at the fermentation tank level. The simple construction method is suitable for industrial scale-up and holds significant promise for industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is the yield of iturin A after shake flask fermentation of a genetically engineered bacterium producing iturin A.

[0026] Figure 2 It is the yield of iturin A after fermentation in a fermentation tank using a genetically engineered bacterium that produces iturin A. DETAILED DESCRIPTION

[0027] Bacillus amyloliquefaciens HM-618 was deposited on January 8, 2012, at the General Microbiology Center of China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number: CGMCC No. 7097.

[0028] The present invention will be further described below by means of specific examples. Unless otherwise specified, the test methods used in the present invention are methods well known to those skilled in the art. The present examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. For those skilled in the art, equivalent changes or replacements made without departing from the spirit of the present invention should all be included in the scope of the present invention.

[0029] Example 1

[0030] A method for constructing a genetically engineered bacterium for producing iturin A:

[0031] This example uses CRISPR-Cas9 technology to isolate Bacillus amyloliquefaciens

[0032] HM618 (Deposit Number: CGMCC No. 7097) was used to perform multi-site metabolic pathway reconstruction, specifically including the following steps:

[0033] (1) Fatty acid regulation-related transformation:

[0034] The fatty acid regulatory gene fapR was knocked out in Bacillus amyloliquefaciens HM618 using CRISPR / Cas9 technology;

[0035] The strong promoter Ph03 (SEQ ID NO. 1) was used to replace the original promoter to enhance the expression of the gene fabG and increase the synthesis rate of fatty acid precursors;

[0036] Further knockout of the gene mmgA prevents the loss of fatty acid precursors;

[0037] (2) Optimization of Serine and Proline Pathways:

[0038] At the same time, the proline degradation-related gene fadM and the serine degradation-related gene sdaAB were knocked out;

[0039] The strong promoter Ph03 (SEQ ID NO. 1) was used to replace the original promoter to enhance the expression of the proBA and serC genes to increase the supply level of amino acid precursors;

[0040] (3) Enhanced branched-chain amino acid synthesis:

[0041] Branched-chain amino acids are important backbone units for the synthesis of Iturin A. The strong promoter Ph03 (SEQ ID NO. 1) was used to replace the original promoter to enhance the expression of the ilvD gene and increase its synthesis flux.

[0042] Knocking out the gene gabT promotes the conversion of branched-chain fatty acids;

[0043] (4)Transportation system optimization:

[0044] The strong promoter Ph03 (SEQ ID NO. 1) was used to replace the original promoter to enhance the expression of the oligopeptide transport system gene opp, thereby improving the cell's ability to uptake peptide substrates and amino acids, thereby obtaining a genetically engineered bacterium that produces iturin A.

[0045] The nucleotide sequence of the regulatory gene fapR is B. amyloliquefaciens HM618, DKG78_08755;

[0046] The nucleotide sequence of the gene fabG is B. amyloliquefaciens HM618, DKG78_08770;

[0047] The nucleotide sequence of the gene mmgA is B. amyloliquefaciens HM618, DKG78_12215;

[0048] The nucleotide sequence of the gene fadM is B. amyloliquefaciens HM618, DKG78_16020;

[0049] The nucleotide sequence of the gene sdaAB is B. amyloliquefaciens HM618, DKG78_08740;

[0050] The nucleotide sequence of the gene proBA is B. amyloliquefaciens HM618, DKG78_07360;

[0051] The nucleotide sequence of the gene serC is B. amyloliquefaciens HM618, DKG78_05835;

[0052] The nucleotide sequence of the gene ilvD is B. amyloliquefaciens HM618, DKG78_10960;

[0053] The nucleotide sequence of the gene gabT is B. amyloliquefaciens HM618, DKG78_02530;

[0054] The nucleotide sequence of the gene opp is B. amyloliquefaciens HM618, DKG78_06475;

[0055] Through the above combined transformations, a stable, multi-site modified strain was obtained for the production of iturin A. Each transformation step used pJOE8999a as the backbone to construct a CRISPR-Cas9 editing plasmid. Overlapping PCR was used to obtain the homology arms, promoter, and targeting fragment. The editing vector was constructed through seamless cloning. These vectors were then transformed into Escherichia coli JM110 (commercially available) for demethylation. The editing was then completed using the Spizizen method into competent HM618 (Deposit Number: CGMCC No. 7097). Colony PCR and sequencing verified the successful mutation, ultimately resulting in a genetically engineered strain that stably expresses iturin A.

[0056] pJOE8999a plasmid is in the literature "Zheng-Jie Hou, Chun-Yang Cao, Geng-Rong Gao, Ming-Zhu Ding, Qiu-Man Xu, Jing-Sheng Cheng. Improved iturin Aproduction of engineering Bacillus amyloliquefaciens by knockout of endogenous plasmid andRap phosphatase genes. Journal of Agricultural and Food Chemistry, 2024, 72(20):11577-11586." Published in.

[0057] Example 2

[0058] Fermentation verification of a genetically engineered bacterium producing iturin A obtained in Example 1 at the shake flask level:

[0059] The culture conditions are as follows:

[0060] Seed culture medium composition: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L;

[0061] Fermentation medium composition: soluble starch 60 g / L, sodium glutamate 5 g / L, MgSO4·7H2O 0.5 g / L, KCl 0.5 g / L, KH2PO4 0.5 g / L, FeSO4·7H2O 0.15 mg / L, MnSO4·H2O 5 mg / L, tryptone 30 g / L, yeast powder 4 g / L; pH natural.

[0062] Culture conditions: fermentation volume 50 mL, inoculum size 1%, fermentation temperature 32°C, shaking speed 200 rpm, and culture for 72 h.

[0063] The final Iturin A production can reach about 5.7g / L, which is significantly higher than that of the original strain (HM618 (deposit number: CGMCC No.7097). (See Figure 1 )

[0064] Example 3:

[0065] The genetically engineered bacteria for producing iturin A obtained in Example 1 was used as a production strain to produce iturin A in a fermenter.

[0066] The above-mentioned engineered bacteria were used to scale up production in a 7.5L fermenter:

[0067] The primary seed culture medium is the same as the shake flask seed culture medium;

[0068] The secondary seed culture medium is consistent with the shake flask fermentation culture;

[0069] Fermentation medium composition: 100 g / L soluble starch, 5 g / L sodium glutamate, 0.5 g / L MgSO4, 0.5 g / L KCl, 0.5 g / L KH2PO4, 50 g / L tryptone, 20 g / L yeast extract, 10 mL / L trace metal solution (1 g / L MnSO4·H2O, 4 g / L FeSO4·7H2O, 4 g / L CaCl2, 0.2 g / L ZnSO4·7H2O, 0.1 g / L AlCl3·6H2O, 0.1 g / L CuCl2·2H2O, 0.2 g / L Na2MoO4, 0.05 g / L H3BO3);

[0070] Control parameters: liquid volume 3 L, temperature 32 °C, gas velocity 0.5 vvm, stirring speed 800 rpm;

[0071] After 56 h of fermentation, the yield of Iturin A reached 7.6 g / L, indicating that the genetically engineered bacteria producing Iturin A of the present invention have good stability and production potential under industrial conditions. (See Figure 2 )

[0072] The above-described embodiments merely represent several implementation methods of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the application. It should be noted that, without departing from the concept of this patent, a person skilled in the art would be able to make various variations, combinations, and improvements to the above-described embodiments, all of which fall within the scope of protection of this patent. Therefore, the scope of protection of this application shall be determined by the claims.

[0073] sequence

[0074] SEQ ID NO.1

[0075] ttgacagaatttaatatacaatatataataaatgtagtatattagaaaggaggaatatata

Claims

1. A method for constructing a genetically engineered bacterium for producing iturin A, characterized in that The method comprises the following steps: knocking out the regulatory gene fapR in Bacillus amyloliquefaciens HM618; using a strong promoter Ph03 to enhance the expression of the gene fabG; knocking out the gene mmgA; knocking out the genes fadM and sdaAB; using a strong promoter Ph03 to enhance the expression of the genes proBA and serC; using a strong promoter Ph03 to enhance the expression of the gene ilvD; knocking out the gene gabT; and using a strong promoter Ph03 to enhance the expression of the gene opp, thereby obtaining a genetically engineered bacterium for producing iturin A. The nucleotide sequence of the regulatory gene fapR is B. amyloliquefaciens HM618, DKG78_08755; The nucleotide sequence of the gene fabG is B. amyloliquefaciens HM618, DKG78_08770; The nucleotide sequence of the gene mmgA is B. amyloliquefaciens HM618, DKG78_12215; The nucleotide sequence of the gene fadM is B. amyloliquefaciens HM618, DKG78_16020; The nucleotide sequence of the gene sdaAB is B. amyloliquefaciens HM618, DKG78_08740; The nucleotide sequence of the gene proBA is B. amyloliquefaciens HM618, DKG78_07360; The nucleotide sequence of the gene serC is B. amyloliquefaciens HM618, DKG78_05835; The nucleotide sequence of the gene ilvD is B. amyloliquefaciens HM618, DKG78_10960; The nucleotide sequence of the gene gabT is B. amyloliquefaciens HM618, DKG78_02530; The nucleotide sequence of the gene opp is B. amyloliquefaciens HM618, DKG78_06475; The nucleotide sequence of the strong promoter Ph03 is shown in SEQ ID NO.

1.

2. A genetically engineered bacterium for producing iturin A constructed by the construction method of claim 1.

3. Use of the genetically engineered bacteria according to claim 2 in the fermentation production of iturin A.

Images