Application of rice OsGH17 gene in regulation and control of rice root system

Abstract

The invention relates to the technical field of biology, in particular to application of a rice OsGH17 gene in regulation and control of a rice root system. The regulation of the rice root system is to promote the development of the rice root system or inhibit the development of the rice root system. At present, no literature report about application of the rice OsGH17 gene to regulation and control of rice root systems is found. The invention shows that the OsGH17 gene deletion can promote the development of the rice root system, and the OsGH17 gene overexpression can inhibit the development of the rice root system. The regulation characteristic of the OsGH17 gene on the influence of the rice root system is defined, and an important reference is provided for deeply researching the function and action mechanism of the glucoside hydrolase in the plant in the rice.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of rice OsGH17 gene in regulating rice root system. Background Art

[0002] Rice (Oryza sativa L.), an aquatic herbaceous plant belonging to the Poaceae family, is one of the world's most important food crops and the staple food for more than half of the world's population. The rice root system is a crucial nutritional and support organ. It primarily consists of the radicle (taproot), adventitious roots (fibrous roots), root hairs, and lateral roots. This is a typical fibrous root system with a shallow root distribution, adapted to the paddy field environment. As rice grows, the root system is continuously renewed, with growth peaking particularly during the tillering stage. As one of the plant's three major nutritional organs, it is typically located deep below the soil surface. Its primary function is to extract water, inorganic salts, and soluble small organic matter from the soil. Roots also fulfill many important roles in plant life, such as providing support for the plant, participating in reproduction, acting as a storage site for organic matter, and synthesizing it. The seed root of rice, also known as the radicle, is the first to emerge when a rice seed germinates. This root later develops into the seminal root, and typically only one primary root exists.

[0003] Glycoside hydrolases (GHs) are a class of enzymes that catalyze the cleavage of glycosidic bonds (hydrolytic bonds), primarily acting on bonds between sugar molecules or between sugar molecules and other molecules. Glycoside hydrolases are present in nearly all organisms and are involved in processes such as food digestion, biomass conversion, pathogen infection, and energy metabolism, playing a key role in life.

[0004] The rice OsGH17 gene belongs to the glycoside hydrolase family 17 (GH17). As a highly complex and diverse gene family in plants, GH17 is widely involved in plant growth and development, as well as responses to biotic and abiotic stresses. However, there are currently no reports of rice OsGH17 genes regulating rice root growth. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an application of rice OsGH17 gene in regulating rice root system.

[0006] The present invention is achieved in that:

[0007] Application of rice OsGH17 gene in regulating rice root system, wherein regulating rice root system is promoting rice root system development or inhibiting rice root system development.

[0008] Furthermore, the OsGH17 gene deletion or overexpression was used to regulate the rice root system, where the OsGH17 gene deletion promoted the development of the rice root system, while the OsGH17 gene overexpression inhibited the development of the rice root system.

[0009] Furthermore, the OsGH17 gene deletion is performed using CRISPR / Cas9 technology to obtain an OsGH17 mutant of rice, comprising the following steps:

[0010] (1) Two specific editing target sites of 20 bp in length were designed at +1685-+1704 and +1795-+1814 in the coding region, respectively, for recombinant editing;

[0011] (2) Transforming the recombinant editing vector plasmid into rice callus to obtain genetically transformed plants;

[0012] (3) Select mutants based on the expression level, mutation type, and sufficient offspring seeds.

[0013] Furthermore, the nucleotide sequence of the mutant at positions +1685 to +1704 and +1795 to +1814 of the coding region is shown as SEQ ID No. 1, SEQ ID No. 2 or SEQ ID No. 3.

[0014] Furthermore, the regulation includes changes in root number and dry weight.

[0015] Furthermore, the rice root system includes lateral roots.

[0016] The present invention has the following advantages:

[0017] (1) Phenotypic observations of OsGH17 gene deletion mutants and overexpression plants revealed that the mutants had more luxuriant lateral roots, while the overexpression plants showed significantly restricted lateral root growth and sparse distribution. The number of lateral roots was significantly reduced compared to both the wild type and the mutants. Root activity was measured, and the results showed that the mutants had significantly higher root activity than the overexpression plants.

[0018] The above results fully demonstrate that the OsGH17 gene plays a vital role in regulating the development of rice roots, and its main function is to affect the lateral roots.

[0019] (2) By naturally drying the roots and weighing their dry weight, it was found that the root dry weight of the mutant plants was significantly higher than that of the overexpression plants, indicating that the loss of the OsGH17 gene promotes the development of the rice root system, while the overexpression of the OsGH17 gene inhibits the development of the rice root system.

[0020] The present invention clarifies the regulatory characteristics of the OsGH17 gene on the rice root system, providing an important reference for in-depth research on the function and mechanism of action of glycoside hydrolases in rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0022] Figure 1 is the expression level of OsGH17 in different tissues of rice;

[0023] Figure 2 For GUS positive plant identification and staining observation;

[0024] (A) Identification of GUS-positive plants: Lane M is DNA marker DL2000, lane "-" is a negative control, lane "+" is a positive control, and lanes 1 to 4 are transgenic lines GUS-1, GUS-2, GUS-3, and GUS-4, respectively. (B) Detection of GUS expression in GUS-positive plants. (C) GUS staining observation, I: stem, II: leaf, III-IV: root, V: adventitious root and lateral root (stereoscopic), VI: adventitious root and lateral root (electron microscope).

[0025] Figure 3 Detection of the location of the mutation target and the expression level of osgh17 mutant material

[0026] (A) Schematic diagram of the location of the mutation target site in the OsGH17 gene, with green squares representing exons and green lines representing introns. (B) qRT-PCR analysis of the expression level of OsGH17 in T0 generation homozygous osgh17 mutant materials.

[0027] Figure 4 is the mutation type and mutation site of the mutant.

[0028] Figure 5 The phenotypes of OsGH17 mutant and overexpressing rice seedlings are shown;

[0029] (A) Root development of rice seedlings. (B) Lateral root density measurement. (C) Total root length measurement. (D) Total root number measurement. (E) Root activity measurement. All rice seedlings used were one-week old.

[0030] Figure 6 The field phenotypes of OsGH17 mutant and overexpressing rice are shown;

[0031] (A) Root development of wild-type, mutant, and overexpressing rice at maturity. (B) Root dry weight measurement. (C) Aboveground phenotypes of different materials at the same growth stage (wooden ruler length on the left: 1 m). DETAILED DESCRIPTION

[0032] The technical solutions of the present invention will be described clearly and completely below in conjunction with the accompanying drawings and specific embodiments. Where specific conditions are not specified in the examples, conventional conditions or those recommended by the manufacturer were used. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially.

[0033] 1. Test Materials

[0034] 1 Plant material

[0035] The plant materials used include Zhonghua 11 rice (japonica rice), GUS transgenic rice with Zhonghua 11 as the genetic background, OsGH17 gene mutant rice, and OsGH17 overexpressing rice.

[0036] 2 carriers

[0037] Table 1 Main vectors used

[0038]

[0039] 2. Test methods

[0040] 1Bioinformatics analysis website and software

[0041] The OsGH17 gene sequence, related annotation information, and data files (Gene ID: 4325830) were retrieved and downloaded from the National Rice Data Center (https: / / www.ricedata.cn) and the National Center for Biotechnology Information (NCBI) of the United States (https: / / www.ncbi.nlm.nih.gov / ).

[0042] 2. Rice material cultivation and planting

[0043] Rice seeds were placed in a culture dish and soaked for 2 days. The seeds were then transferred to moist gauze and placed in a 28°C artificial climate chamber to promote germination. When the seeds sprouted to about 2 cm in length, they were transferred to a 96-well hydroponic box and cultured using international rice nutrient solution. The artificial climate chamber was set with a daytime temperature of 28°C, a light duration of 14 hours, and a humidity of 80%. The nighttime temperature was 24°C, and there was no light for 10 hours.

[0044] Field planting took place at the experimental field on the campus of Fujian Agriculture and Forestry University (119.23°E, 26.08°N). Preparatory work was carried out before planting, including manual weeding, tilling, sun-drying the fields, cleaning grass roots, applying sufficient base fertilizer, and evenly spreading an appropriate amount of snail medicine after watering to prevent snails from multiplying and feeding on the rice seedlings. One-month-old rice seedlings were moved from the artificial climate chamber to the experimental field, and transplanted in neat rows and orderly intervals, using the single-root method (only one seedling per hole). Subsequent management was carried out according to conventional management methods in Fujian Province, with fertilizer applied as needed based on rice growth, regular weeding, and appropriate pesticide spraying to prevent pests and diseases.

[0045] 3 Rice phenotypic observation and agronomic trait statistics

[0046] Record the important time nodes of rice sowing, seedling transplanting, heading and maturity, and then calculate the specific time required for each growth stage to compare whether there are differences in the growth periods of different rice materials.

[0047] Using a shovel's width (16 cm) as the radius and a shovel's length (32 cm) as the depth, rice plants were carefully excavated and their above-ground parts were photographed. The soil around the roots was carefully washed away with a gentle stream of water, and after washing, the underground parts were photographed. After completing the phenotypic documentation, the rice plants were harvested, and the mature rice ears were cut, stored separately from the grains, and dried in the sun. Agronomic traits such as root dry weight and ear weight were subsequently measured.

[0048] 4. Rice root activity determination (TTC method)

[0049] (1) Weigh 0.1 g of TTC powder and add it to 25 ml of distilled water. Stir continuously to dissolve it and prepare a 0.4% TTC solution. Prepare it immediately and use it immediately. Store it at 4°C and keep it away from light. If the solution turns pink, do not use it. Measure 10 ml of the prepared 0.4% TTC solution and mix it with 10 ml of TTC Assay buffer in a 1:1 ratio. Stir it thoroughly to obtain the TTC Assay buffer working solution. Prepare it immediately and use it immediately. Store it at 4°C and keep it away from light. If the solution turns pink, do not use it. Take a 5 ml centrifuge tube, add 0.25 ml of 0.4% TTC solution, add about 2 mg of reducing agent powder, and stir it quickly. At this time, red particles TTF that are insoluble in water will be generated. Then add 4 ml of ethyl acetate and shake vigorously to ensure that the red particles are fully dissolved. After standing for a period of time, the solution will be clearly separated. The lower 0.25 ml layer is a colorless water layer, which is discarded. The upper layer is a red solution with a TTF concentration of 250 μg / mL. Take 0.1, 0.2, 0.4, 0.6, and 0.8 ml of the upper red solution respectively, and then add ethyl acetate to the 4 ml mark to obtain the TTF series gradient standard tube.

[0050] (2) Sample acquisition and pretreatment: Take 0.3-0.4 g of plant fibrous roots and rinse them in clean water to ensure that there are no impurities remaining on the surface of the roots. Gently press with filter paper to absorb excess water on the surface of the roots. Place the pretreated plant fibrous roots completely into a container containing 10 ml of TTC Assay buffer working solution, ensuring that the roots are completely immersed in it. Then place the container in an environment of 37°C and incubate in the dark for 1 to 3 hours. At the end of the incubation, add 2 ml of TTC stop solution to terminate the reaction process. Prepare another root sample as a blank control. First, completely immerse the roots in 2 ml of TTC stop solution to inactivate the root sample. Then add 10 ml of TTC Assay buffer working solution to it, and also place it in an environment of 37°C in the dark for incubation for 1 to 3 hours.

[0051] (3) Carefully remove the roots from the above experimental group and the blank control group, press them gently with filter paper, and absorb the moisture attached to the root surface. Place the roots in a homogenizer, add 2 ml of ethyl acetate to it, and fully homogenize it to effectively extract TTF from the roots. Transfer the red TTF extract to a centrifuge tube. To ensure sufficient extraction, use a small amount of ethyl acetate to wash the residue in the mortar or homogenizer 3 to 4 times, and transfer the washing liquid obtained each time to the centrifuge tube containing the extract. After washing, add ethyl acetate to the centrifuge tube until the total volume of the solution reaches 4 ml, and shake the centrifuge tube thoroughly.

[0052] (4) Determination of standard tubes and samples: Pipette the solution into the ELISA plate. For the series of standard tubes, use tube "0" as the reference for zeroing, and measure the absorbance values ​​of tubes 1 to 5 at a wavelength of 485 nm in sequence. For the determination of sample tubes, first use the extract of the blank control group sample as the reference solution and perform zeroing calibration using the ELISA reader. After zeroing is completed, place the extract of the experimental group sample in a cuvette and measure its absorbance value at a wavelength of 485 nm.

[0053] (5) Calculation: Plot a TTF standard curve using the TTF content of a series of standard solutions (25, 50, 100, 150, and 200 ng) as the horizontal axis and the corresponding absorbance as the vertical axis. Calculate the TTF content (μg) of the test sample based on the regression equation, which is the root activity or dehydrogenase activity. Root (dehydrogenase) activity [mg / (gh)] = m / (1000 × W × t). Where: m = TTF content of the sample extract (μg) obtained from the standard curve = TTC reduction amount (μg), W = weight of the plant root (g), and t = incubation time (h).

[0054] 5. Fluorescence quantitative PCR (qRT-PCR) detection

[0055] Primer-BLAST online website was used to design fluorescent quantitative PCR primers; qPCR SYBR Green Master Mix kit was used to prepare the reaction system; amplification detection was performed using CFX96 fluorescent quantitative PCR instrument; OsActin gene was selected as the internal reference, and 2 -ΔΔCt The relative expression levels of the genes to be tested were calculated.

[0056] 2. Test results

[0057] 1. Expression of OsGH17 in different rice tissues

[0058] RNA was extracted from the roots, stems, leaves, and sheaths of wild-type rice ZH11, and real-time fluorescence quantitative analysis was performed to detect the expression levels of OsGH17 in different tissues. Figure 1 As shown in the figure, OsGH17 showed a significant characteristic of specific high expression in rice roots.

[0059] 2. GUS staining

[0060] To further visualize and qualitatively analyze the expression of OsGH17 in rice tissues, the 1000bp promoter sequence upstream of the OsGH17 gene was connected to the GUS expression vector to construct the OsGH17-promoter::GUS recombinant expression vector, which was transformed into wild-type ZH11 rice callus tissue and cultured to obtain GUS transgenic plants. DNA of transgenic rice plants was extracted and positive plants were identified, and 4 GUS-positive plants were obtained ( Figure 2 RNA was extracted from positive GUS transgenic rice plants and real-time fluorescence quantitative analysis was performed to detect the relative expression levels of the GUS gene in different transgenic rice plants. The results showed that the GUS gene expression levels of the four positive lines were higher than those of wild-type rice ( Figure 2 The above results demonstrated the reliability of the GUS material. The GUS-1 and GUS-3 strains showed higher GUS gene expression levels, so we selected these two strains for subsequent experiments.

[0061] After breeding, T1 generation GUS transgenic plants were obtained and GUS histochemical staining was performed. Figure 2 As shown in center C, the stem is the lightest stained, with leaves partially stained. Focusing on the roots, the entire root system is stained, suggesting that the OsGH17 gene may be involved in regulating the growth and development of rice roots.

[0062] 3. Construction of mutants and overexpression plants

[0063] (1) To further study the biological function of OsGH17 gene in rice, CRISPR / Cas9 technology was used to obtain the OsGH17 mutant of ZH11.

[0064] Two specific editing targets with a length of 20 bp were designed at +1795 to +1814 ( Figure 3 A), the nucleotide sequence of which is shown in SEQ ID No.1 and SEQ ID No.2. The editing mutation probability of OsGH17 was increased by designing dual target sites. The recombinant editing vector plasmid was transformed into ZH11 callus to obtain 54 genetically transformed plants, and the mutation sites of the obtained mutant plants were identified and analyzed. By designing upstream primers in the upstream region of target 1 and downstream primers downstream of target 2, the preset amplified fragment contained both target 1 and target 2. DNA of 54 T0 generation plants was extracted, and PCR amplification was performed using the above primers. Bands were amplified in all 54 transformed plants. Sequencing analysis of PCR amplification products showed that 9 of the 54 transformed plants were homozygous mutants, 25 were heterozygous mutants, and 20 had no mutations at both target sites. The 9 homozygous lines were numbered 1, 8, 11, 12, 13, 15, 27, 39 and 52, and the mutation sites were as follows: Figure 4 shown.

[0065] Combined expression level ( Figure 3 (B) Mutation type and sufficient offspring seeds. Three lines, No. 1, 12, and 27, were selected and named osgh17-1, osgh17-12, and oggh17-27, respectively, for subsequent studies.

[0066] like Figure 4 As shown, strain 1 deleted 29bp starting from the 9th base of target 1, the 4th base "C" of target 2 was replaced by "T", and the 8th base "C" was replaced by "A"; the entire target 1 and the first 10bp of strain 12 were deleted, and a single base "T" was inserted between the 3rd and 4th bases of target 2; strain 27 deleted from the last 8 bases of target 1 to the first 3 bases of target 2, with a total deletion of 101bp.

[0067] SEQ ID No. 1:

[0068] GGTGTCCACGGTGTTTGCTA;

[0069] SEQ ID No. 2:

[0070] GGACCAGCAGGCCCTCGACG.

[0071] (2) Construction of overexpression plants

[0072] The CDS sequence of this gene was amplified from the cDNA library of wild-type rice ZH11, an overexpression vector was constructed, and overexpression plants were obtained. The expression levels of the overexpression strains increased by about 15-71 times, which were significantly higher than those of wild-type rice. Three strains numbered 1, 12 and 17 were selected and named OsGH17-OE-1, OsGH17-OE-12 and OsGH17-OE-17, respectively.

[0073] 4. Phenotypes of OsGH17 mutants and overexpressing materials

[0074] (1) Phenotypic observations of one-week-old OsGH17 mutant and overexpressing rice seedlings revealed that the roots of different materials exhibited different phenotypic characteristics, such as Figure 5 As shown in middle A, compared with the wild type, the lateral roots of the mutant are more luxuriant, while the growth of the overexpressed lateral roots is significantly restricted and the distribution is sparse, and the number of lateral roots is greatly reduced compared with both the wild type and the mutant.

[0075] (2) To quantify this difference more accurately, we further measured the key indicator of lateral root density. The results showed that the lateral root density of the mutant strain was significantly higher than that of the overexpression strain ( Figure 5 Middle B).

[0076] (3) In addition, we also observed the seed roots and adventitious roots and found no difference between the different materials. By comprehensively measuring the total root length and total root number, two important root system measurement indicators, the results showed that the average total root length of different materials was between 24-27 cm, and the difference was not significant ( Figure 5 Middle C); the total number of roots of a single plant ranged from 3 to 6, with no significant difference ( Figure 5 Middle D).

[0077] (4) We further explored the physiological activity of the root system and measured the root vitality. The results showed that the root vitality of the mutant was significantly higher than that of the overexpressed root system ( Figure 5 These results clearly demonstrate that the OsGH17 gene plays a crucial role in regulating rice root development, and that its role is primarily through its influence on lateral roots.

[0078] 5. Field phenotypes and agronomic traits of rice with different OsGH17 genotypes

[0079] When the rice grows to maturity, we carefully remove it from the field, clean the soil, and observe the underground part, namely the rice root system.

[0080] (1) Comparison of the root systems of mutant plants and overexpression plants revealed that the root systems of mutant plants were more developed, while the root systems of overexpression plants were poorly developed, with sparse roots, relatively few roots, and shorter roots, showing an overall state of poor development ( Figure 6 Middle A).

[0081] (2) After the roots were dried naturally, their dry weight was measured. Figure 6 As shown in Figure B, the root dry weight of the mutant plants was significantly higher than that of the overexpressing plants, indicating that the loss of the OsGH17 gene promoted the development of rice roots, while the overexpression of the OsGH17 gene inhibited the development of rice roots.

[0082] (3) During the observation of the aboveground parts of the plants, we found that at the same growth stage, the wild-type and mutant plants were fully mature, with golden-yellow ears and drooping growth. Their growth processes were basically synchronized and their growth periods were the same. However, the overexpression plants still showed a relatively obvious green color in their overall appearance, with the ears not fully mature and the growth process significantly delayed ( Figure 6 (C) This indicates that overexpression of OsGH17 delayed heading and panicle development, thereby extending the plant's reproductive period.

[0083] The primers involved in the present invention are as follows:

[0084]

[0085]

[0086] Although the specific embodiments of the present invention are described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Rice OsGH17 The application of genes in regulating rice root system is characterized by: The regulating the rice root system is to promote the development of the rice root system or to inhibit the development of the rice root system.

2. The use according to claim 1, characterized in that: use OsGH17 Gene deletion or overexpression regulates rice roots, including OsGH17 Gene deletion promotes rice root development OsGH17 Gene overexpression inhibits root development in rice.

3. The use according to claim 2, characterized in that: described OsGH17 Gene deletion using CRISPR / Cas9 technology to obtain rice OsGH17 The mutant comprises the following steps: (1) In the coding region +1685 ～ +1704 and +1795 ～ Two specific editing targets of 20 bp in length were designed at +1814 for recombinant editing; (2) Transforming the recombinant editing vector plasmid into rice callus to obtain genetically transformed plants; (3) Select mutants based on the expression level, mutation type, and sufficient offspring seeds.

4. The use according to claim 3, characterized in that: The specific editing target in step (1), wherein the nucleotide sequence of target 1 is shown as SEQ ID No. 1, and the nucleotide sequence of target 2 is shown as SEQ ID No.

2.

5. The use according to claim 3, characterized in that: The mutant deleted 29 bp starting from the 9th base of target 1, the 4th base "C" of target 2 was replaced by "T", and the 8th base "C" was replaced by "A"; alternatively, the entire target 1 and the first 10 bp were deleted, and a single base "T" was inserted between the 3rd and 4th bases of target 2; alternatively, the deletion started from the last 8 bases of target 1 to the first 3 bases of target 2, with a total deletion of 101 bp.

6. The use according to claim 1, characterized in that: The modulation includes changes in root number and dry weight.

7. The use according to claim 1, characterized in that: The rice root system includes lateral roots.

Images