Genetic transformation method and application of 'Hanfu' apple seed callus

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a genetic transformation method and application of Hanfu apple seed calluses. The explants are subjected to induction culture, multiplication culture, dip dyeing culture, co-culture and screening culture to obtain successfully converted calluses, and the explants are Hanfu apple seeds; the non-infected 'Hanfu' apple seed induced callus obtained by the method has a weak fluorescence signal under ultraviolet excitation light waves. After the callus is subjected to agrobacterium-mediated genetic transformation and is introduced into a pRI101 GFP vector, the fluorescence signal intensity of the callus is remarkably increased, which indicates that the 'Hanfu' apple callus can adopt a genetic transformation method containing a GFP label.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular relates to a genetic transformation method and application of 'Hanfu' apple seed callus. Background Art

[0002] In the field of botany, when plant cells are stimulated by trauma, a special cell group called callus is formed on the surface of the wound. This callus is composed of thin-walled cells that have increased in size and dedifferentiated. It occupies an important position in plant molecular research and genetic engineering research and is a commonly used experimental material. For genetic transformation, a stable regeneration system is an indispensable prerequisite. However, in the field of apple genetic transformation, there are many challenges. The transformation is difficult and the probability of successfully obtaining transformed plants with stable genetic characteristics is low. However, in comparison, it is relatively easy to obtain stable callus genetic transformation materials.

[0003] Therefore, apple can successfully cultivate its callus tissue and establish a complete apple callus tissue transformation system, thereby obtaining callus tissue with consistent genotype and stable growth, and at the same time exploring a rapid and stable genetic transformation method. This will provide a new transgenic receptor material and experimental approach for apple molecular biology and genetic engineering research, which has great research significance and application value.

[0004] Currently, research on apple callus mostly uses callus induced from 'Wanglin' ​​apple fruit. However, it's worth noting that untransformed 'Wanglin' ​​callus exhibits a distinct green fluorescence signal under 488nm UV excitation. This characteristic makes 'Wanglin' ​​apple callus unsuitable for research involving the use of green fluorescent protein (GFP)-tagged cells. This inherent fluorescence can significantly interfere with observation of experimental results, thereby impacting the accuracy and reliability of research results. Summary of the Invention

[0005] To solve the above problems, the present invention provides a genetic transformation method and application of 'Hanfu' apple seed callus.

[0006] A method for genetic transformation of callus tissue from 'Hanfu' apple seeds, wherein the explants are subjected to induction culture, proliferation culture, immersion culture, co-culture and screening culture to obtain successfully transformed callus tissue, wherein the explants are 'Hanfu' apple seeds; The formula of the induction culture medium used in the induction culture is 4 g~5 g MS+0.1 mg~0.4 mg NAA+1.0 mg~2.0 mg 2,4-D+0.5 mg~1.0 mg 6-BA+10 g~30 g sucrose+7 g~9 g agar, and water is added to 1 L; The formula of the proliferation culture medium used in the proliferation culture is 4 g~5g MS+1.5 mg6-BA+0.4 mg~0.8mg ZT+10 g~30 g sucrose+7 g~9g agar, and water is added to 1L; The immersion culture is to use MdPHV-GFP Agrobacterium carrying the target gene vector to immerse and culture the callus tissue of 'Hanfu' apple seeds.

[0007] Preferably, the formula of the co-culture medium used in the co-culture is: 4 g~5g MS+1.0 mg~2.0 mg 2,4-D+0.5 mg~1.0 mg 6-BA+10 g~30 g sucrose+7 g~9g agar, and water is added to 1L.

[0008] Preferably, the screening culture medium used in the screening culture is composed of 4 g~5g MS+1.0 mg~2.0 mg2,4-D+0.5 mg~1.0 mg 6-BA+20 mg~40 mg kanamycin+150 mg~250 mg cephalosporin+10 g~30 g sucrose+8 g~10g agar, and water is added to 1L.

[0009] Preferably, the induction culture time is 60 to 90 days.

[0010] Preferably, the proliferation culture time is 14 days.

[0011] Preferably, the 'Hanfu' apple seeds are selected from 30 to 40 days after flowering.

[0012] Preferably, the 'Hanfu' apple seed sample is a wounded embryo.

[0013] Preferably, the culture medium needs to be adjusted to pH 5.6 using 1 mol / L NaOH solution.

[0014] The application of the genetic transformation method in genetic transformation.

[0015] Preferably, the genetic transformation is a genetic transformation method containing a GFP tag.

[0016] Compared with the prior art, the present invention is beneficial in that: This invention provides a method for genetically transforming callus from 'Hanfu' apple seeds. Callus induced from uninfected 'Hanfu' apple seeds using the culture medium described in this method exhibits a weak fluorescence signal under ultraviolet excitation. However, after Agrobacterium-mediated genetic transformation of this callus and introduction of the pRI101 GFP vector, the fluorescence signal intensity significantly increases. This property demonstrates that 'Hanfu' apple callus can be transformed using methods containing a GFP tag, effectively improving the efficiency of identifying transgenic material and providing a more convenient and accurate method for related research.

[0017] The genetic transformation method provided by the present invention further reduces the fluorescence signal of callus tissue induced by 'Hanfu' apple seeds under ultraviolet excitation light waves, so that the fluorescence signal intensity of the callus tissue after Agrobacterium-mediated genetic transformation is more significantly increased, making it easier to identify transgenic materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are graphs showing the proliferation of 'Hanfu' apple seed callus and 'Wanglin' ​​apple callus within 14 days. A is the 1st day after inoculation of 'Wanglin' ​​apple callus, B is the 7th day after inoculation of 'Wanglin' ​​apple callus, C is the 14th day after inoculation of 'Wanglin' ​​apple callus, D is the 1st day after inoculation of 'Hanfu' apple seed callus, E is the 7th day after inoculation of 'Hanfu' apple seed callus, and F is the 14th day after inoculation of 'Hanfu' apple seed callus.

[0019] Figure 2 Comparison of fluorescence characteristics of different callus tissues under UV irradiation. A is a picture of 'Hanfu' apple seed callus tissue, and B is a picture of 'Wanglin' ​​apple callus tissue.

[0020] Figure 3 Comparison of fluorescence characteristics of 'Hanfu' apple seed callus under UV irradiation, where A is 'Hanfu' apple seed callus, B is overexpression GFP Genetic 'Hanfu' apple seed callus.

[0021] Figure 4 Comparison of fluorescence characteristics of 'Wanglin' ​​apple callus under UV irradiation, where A is 'Wanglin' ​​apple callus, B is overexpressed GFP 'Wanglin' ​​apple callus with the gene.

[0022] Figure 5 This is a bar graph showing the proliferation coefficient of 'Hanfu' apple seed callus and 'Wanglin' ​​apple callus within 14 days. DETAILED DESCRIPTION

[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0024] Materials used in the examples Plant material: 'Hanfu' apple seeds were picked in the fruit tree germplasm resource garden that year.

[0025] Agrobacterium strain: EHA105.

[0026] Plasmid: pRI101GFP is the pRI101GFP reported in Yue Ma, Hao Xue, Feng Zhang, Qiu Jiang, ShuangYang, Pengtao Yue, Feng Wang, Yuanyan Zhang, Linguang Li, Ping He, ZhihongZhang. (2021) The miR156 / SPL module regulates apple salt stress tolerance byactivating MdWRKY100 expression. Plant Biotechnology Journal. 19, 2, 311-323.

[0027] Primer synthesis was completed at Shanghai Sangon Biotechnology Co., Ltd.

[0028] Reagents used in the examples: MS medium, sucrose, and agar were purchased from Coolbo Technology Co., Ltd., and PhantaMax Super-Fidelity DNA Polymerase was purchased from Novozymes Nanjing Biotechnology Co., Ltd.

[0029] The formula of YEP liquid culture medium is: 10 g yeast extract powder, 10 g tryptone, 5 g NaCl, and water to 1 L.

[0030] The formula of YEP solid plate is: 10 g yeast extract powder, 10 g tryptone, 5 g NaCl, 100 mg kanamycin, 100 mg rifampicin, 15 g agar, and water to make up to 1 L.

[0031] Example 1 Freeze-thaw method to transform Agrobacterium competent cells (1) Take 1 μL (100 ng / μL) of pRI101GFP Escherichia coli plasmid and mix it into 50 μL of EHA105 Agrobacterium competent culture. Gently pipette to mix to obtain a mixed solution.

[0032] (2) The mixed solution was placed on ice for 5 minutes, then placed in liquid nitrogen for 5 minutes, and finally placed in a 28°C water bath for 5 minutes, and then placed on ice for 5 minutes for heat shock conversion.

[0033] (3) After transformation, add 700 μL of YEP liquid culture medium to the centrifuge tube and culture at 28°C with shaking at 180 rpm for 2 h.

[0034] (4) After the incubation period, centrifuge the cells at 5000 rpm for 2 minutes. Discard the supernatant, retain the precipitate, pipette and mix thoroughly, and spread on a YEP solid plate.

[0035] (5) Incubate the culture at 28°C for 48 h. Perform PCR verification on the grown colonies, and pick the positive clones. Add YEP liquid medium (with corresponding antibiotics) and culture at 28°C and 180 rpm to obtain the activated Agrobacterium strain EHA105pRI101-GFP, i.e., the positive colonies. When the solution becomes turbid, mix it with 50% glycerol at a volume ratio of 1:1 and freeze at 80°C for later use.

[0036] Example 2 In order to detect the positive colonies obtained in Example 1 (5). Colony PCR detection

[0037] Primers were designed based on the apple genome database and the sequence information of the target gene GFP, wherein the primers include an upstream primer F and a downstream primer R, and the specific sequences are as follows: Upstream primer F: 5′ GACGCACAATCCCACTATCC3′; Downstream primer R: 5'CACGCTGAACTTGTGGCCGTTCAC3'.

[0038] RNA was extracted from the leaves of 'Hanfu' and reverse transcribed to obtain cDNA as a template for PCR amplification. PCR amplification was performed based on the above primers. The reaction system was:

[0039] Table 1 PCR reaction system The PCR products were electrophoresed on 1% agarose gel to observe the gene amplification, and the amplified products were observed using a gel imaging system.

[0040] The molecular weight of the specific band in this example is about 500 bp, indicating that an Agrobacterium colony with the EHA105pRI101-GFP plasmid inserted was obtained, which was used for subsequent genetic transformation to obtain the desired positive colony.

[0041] Example 3 Induction, Proliferation and Genetic Transformation of 'Hanfu' Apple Seed Callus The method for inducing proliferation and genetic transformation of 'Hanfu' apple seed callus provided in the embodiment of the present invention comprises the following steps: This embodiment uses GFP The 'Hanfu' apple seed callus genetic transformation system was established with the target gene as the target gene, which specifically includes the following steps: (1) Acquisition of genetic transformation receptors.

[0042] The collected 'Hanfu' apple seed samples were disinfected and sterilized by shaking the 'Hanfu' apple seeds with a disinfectant containing 2% sodium hypochlorite for 20-30 minutes, then rinsing them 3-5 times with sterile water. The rinsed seeds were peeled in a clean bench and placed on sterilized gauze. The peeled seeds were collected and placed in a disinfectant containing 0.5% sodium hypochlorite for 1 minute, then rinsed 2-3 times with sterile water, placed on sterile filter paper to absorb moisture, and set aside.

[0043] (2) Induction and proliferation of callus tissue from 'Hanfu' apple seeds.

[0044] Disinfected 'Hanfu' apple seeds were inoculated onto an induction medium and cultured in the dark at 25°C for 60-90 days. After obtaining callus tissue, the callus was transferred to a proliferation medium for proliferation culture with a 16 / 8 h photoperiod and a culture temperature of 25°C. The induction medium consisted of 4.43 g / L MS, 0.4 mg / L NAA, 1.5 mg / L 2,4-D, 0.5 mg / L 6-BA, 30 g / L sucrose, and 8 g / L agar. The proliferation medium consisted of 4.43 g / L MS, 1.5 mg / L 6-BA, 0.4 mg / L ZT, 30 g / L sucrose, and 8 g / L agar.

[0045] (3) Dipping test 1) Agrobacterium culture The activated Agrobacterium strain EHA105pRI101-GFP from Example 1 was added to YEP liquid medium containing kanamycin and rifampicin for cultivation. The culture was shaken at 180 rpm at 28°C for 12-16 hours. The Agrobacterium culture was used when the concentration reached OD600 of 0.4-0.6.

[0046] 2) Preparation of Agrobacterium infection solution Pour the Agrobacterium culture solution into a sterile centrifuge tube and centrifuge at 5000g for 5 minutes at 4°C to collect the Agrobacterium cells and discard the supernatant; resuspend the Agrobacterium in ddH2O and measure the concentration of the Agrobacterium culture solution using a UV spectrophotometer (OD600 = 0.4-0.6); 3) Callus infection, co-culture and screening culture The Agrobacterium-infected solution prepared in step 2) was co-cultured with the 'Hanfu' apple seed callus in a constant temperature shaker at 28°C and 100 rpm for 30 minutes in the dark to obtain the infected 'Hanfu' apple seed callus.

[0047] The infected 'Hanfu' apple seed callus obtained above was placed on filter paper to absorb the infection liquid and then placed in co-cultivation medium for co-cultivation in the dark for 1 day.

[0048] A sterile filter paper was placed on the co-cultivation medium, and then the infected callus was spread on the co-cultivation medium. The co-cultivation medium was 4.43 g / L MS + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 30 g / L sucrose + 9 g / L agar. 4) Screening and cultivation The 'Hanfu' apple seed callus solid MS screening medium (4.43 g / L MS + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 30 mg / L Kana + 200 mg / L Cef + 30 g / L sucrose + 9 g / L agar) obtained in step 3) was cultured in the dark at 25°C for 30 days, and then the callus was irradiated with a handheld fluorescence irradiator for fluorescence observation.

[0049] Comparative Example 1 The difference between Comparative Example 1 and Example 3 is that the callus tissue in step 3) and step 4) is 'Wanglin' ​​apple callus tissue. Step 3) and step 4) are specifically as follows: 3) Callus infection, co-culture and screening culture The Agrobacterium-infected solution prepared in step 2) was co-cultured with the 'Wanglin' ​​apple callus in a constant temperature shaker at 28° C. and 100 rpm in the dark for 30 min to obtain the infected 'Wanglin' ​​apple callus.

[0050] The infected 'Wanglin' ​​apple callus obtained above was placed on filter paper to absorb the infection liquid, and then placed in a co-cultivation medium and co-cultivated in the dark for 1 day.

[0051] A sterile filter paper was placed on the co-cultivation medium, and then the infected callus was spread on the co-cultivation medium. The co-cultivation medium was 4.43 g / L MS + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 30 g / L sucrose + 9 g / L agar. 4) Screening and cultivation The 'Wanglin' ​​apple callus obtained in step 3) was placed on solid MS screening medium (4.43 g / L MS + 1.5 mg / L 2,4-D + 0.4 mg / L 6-BA + 30 mg / L Kana + 200 mg / L Cef + 30 g / L sucrose + 9 g / L agar). After screening at 25°C in the dark for 30 days, the callus was irradiated with a handheld fluorescence irradiator for fluorescence observation. The results showed that successfully infected calli from 'Hanfu' and 'Wanglin' ​​apple seeds appeared green. Fluorescently labeled calli were placed separately on solid MS screening medium. After three generations of 34-week screening and cultivation, homozygous resistant calli from 'Hanfu' and 'Wanglin' ​​apple seeds were obtained. The culture conditions were dark incubation at 25°C.

[0052] Figure 2 These are pictures of 'Hanfu' apple seed callus and unstained 'Wanglin' ​​apple callus. Using fluorescent markers, it was observed that the fluorescence of 'Hanfu' apple seed callus was weaker than that of 'Wanglin' ​​apple callus.

[0053] Figure 3 Images of uninfected and infected 'Hanfu' apple seed callus. Fluorescent markers revealed distinct fluorescence in the infected 'Hanfu' apple seed callus, with a clear contrast between the two.

[0054] Figure 4 The following are images of uninfected and infected 'Wanglin' ​​apple callus. Using fluorescent markers, the infected 'Wanglin' ​​apple callus showed more fluorescence than the uninfected 'Wanglin' ​​apple callus, but the contrast between the two was not obvious.

[0055] Table 2 Callus induction rate of 'Hanfu' apple seeds on different induction media Note: Ducan's multiple range test was used for analysis. Different lowercase letters indicate significant differences at the p<0.05 level.

[0056] Induction rate = number of calli producing callus / total number of calli inoculated The experimental data were first summarized using Microsoft Excel 2010 and then statistically analyzed using IMS SPSS Statistics 22, and significant differences were analyzed at the P ≤ 0.05 level.

[0057] Table 3 Statistics of callus proliferation of 'Hanfu' apple seeds under different proliferation media Note: The ideal state is when the callus is yellow-white in color, loose and moist in texture, and grows fast; the second best state is when the callus is milky white or slightly brown in color, hard in texture, and grows fast; the worst state is when the callus is brown in color, hard in texture, and grows slowly.

[0058] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes preferred embodiments.

[0059] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0060] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. A method for genetic transformation of 'Hanfu' apple seed callus, wherein the explant is subjected to induction culture, proliferation culture, immersion culture, co-culture and screening culture to obtain successfully transformed callus, characterized in that: The explants are 'Hanfu' apple seeds; The formula of the induction culture medium used in the induction culture is 4 g~5 g MS+0.1 mg~0.4 mg NAA+1.0 mg~2.0 mg 2,4-D+0.5 mg~1.0 mg 6-BA+10 g~30 g sucrose+7 g~9 g agar, and water is added to 1 L; The formula of the proliferation culture medium used in the proliferation culture is 4 g~5g MS+1.5 mg6-BA+0.4 mg~0.8 mg ZT+10 g~30 g sucrose+7 g~9g agar, and water is added to 1L; The immersion culture is to use MdPHV-GFP Agrobacterium carrying the target gene vector to immerse and culture the callus tissue of 'Hanfu' apple seeds.

2. The genetic transformation method according to claim 1, characterized in that The formula of the co-culture medium used in the co-culture is: 4 g~5 g MS+1.0 mg~2.0 mg 2,4-D+0.5 mg~1.0 mg 6-BA+10 g~30 g sucrose+7 g~9 g agar, and water is added to 1 L.

3. The genetic transformation method according to claim 1, wherein The screening culture medium used in the screening culture is composed of 4 g~5 g MS+1.0 mg~2.0 mg 2,4-D+0.5 mg~1.0 mg 6-BA+20 mg~40 mg kanamycin+150 mg~250 mg cephalosporin+10 g~30 g sucrose+8 g~10 g agar, and water is added to 1 L.

4. The genetic transformation method according to claim 1, characterized in that The induction culture time is 60 to 90 days.

5. The genetic transformation method according to claim 1, wherein The proliferation culture time is 14 days.

6. The genetic transformation method according to claim 1, characterized in that The 'Hanfu' apple seeds are selected 30 to 40 days after flowering.

7. The genetic transformation method according to claim 6, characterized in that The 'Hanfu' apple seed sample is a wounded embryo.

8. The genetic transformation method according to claim 1, characterized in that The pH of the culture medium needs to be adjusted to 5.6 with 1 mol / L NaOH solution.

9. Use of the genetic transformation method according to claim 1 in genetic transformation.

10. The use according to claim 9, characterized in that The genetic transformation is a genetic transformation method containing a GFP tag.

Images