Construction method of recombinant vaccinia virus
By combining the recombinant vaccinia virus vector with the CRISPR/Cas9 system, the immunogenicity and targeting problems of existing gene delivery vectors have been solved, and efficient and safe gene delivery has been achieved, which is suitable for tumor immunotherapy, genetic disease treatment and infectious disease prevention and control.
Patent Information
- Application Number
- CN202510734004.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-04
- Publication Date
- 2025-09-16
AI Technical Summary
Existing gene delivery vectors such as adenovirus and retrovirus have problems such as strong immunogenicity, limited gene carrying capacity, and lack of precise targeting, making it difficult to meet the needs of precision medicine and complex gene therapy.
Recombinant vaccinia virus is used as a gene delivery vector, and precise gene editing is performed through the CRISPR/Cas9 system. Combined with tissue-specific promoter and targeted ligand modification, high loading capacity, low immunogenicity and long-lasting stable expression are achieved.
It improves the efficiency and safety of gene delivery, reduces production costs, and achieves efficient and precise delivery of complex genome editing tools and tumor neoantigen coding sequences. It is suitable for tumor immunotherapy, genetic disease treatment, and infectious disease prevention and control.
Smart Images

Figure CN120648748A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to a method for constructing a recombinant vaccinia virus. Background Art
[0002] Traditional gene delivery vectors such as adenovirus and retrovirus have long faced multiple bottlenecks in clinical applications: first, the strong immunogenicity caused by viral proteins can easily lead to the host's production of neutralizing antibodies, resulting in vector clearance or failure of repeated administration; second, the gene carrying capacity is severely limited (for example, adenovirus can only accommodate 7-8kb of exogenous DNA), making it difficult to support the delivery of large functional genes (such as CRISPR-Cas9 systems, multivalent antigens or multi-gene regulatory networks); third, viral vectors lack precise targeting and rely on random integration or nonspecific infection, which can easily cause insertional mutagenesis or off-target effects. With the deepening of precision medicine, there is an urgent need to build a new generation of delivery systems for complex treatment scenarios such as tumor-driven gene repair, immune microenvironment reprogramming and personalized vaccine development. This system must have core characteristics such as high loading capacity (>20kb), low immunogenicity (non-viral or stealth design), sustained and stable expression (such as extrachromosomal circular DNA or site-specific integration technology) and intelligent targeted regulation (such as tissue-specific promoter or ligand modification) to break through existing technological barriers and achieve efficient and precise delivery of complex genome editing tools, tumor neoantigen coding sequences or immune checkpoint regulatory factors, providing safer and more controllable technical support for gene therapy and cell therapy.
[0003] Vaccinia virus (VV) exhibits unique advantages as a gene delivery vector: its genome is double-stranded DNA, and its capacity for inserting foreign genes is high, far exceeding that of adenovirus, and it can fully carry the CRISPR-Cas9 system, multivalent antigen coding sequences, or complex gene regulatory elements. Viral particles can efficiently infect mammalian cells, and organ-directed delivery can be achieved through engineering modifications (such as tissue-specific promoters or targeting ligand modifications). Within host cells, VV maintains the continuous expression of foreign genes by establishing a replication-independent latent infection in the cytoplasm, avoiding the risk of carcinogenesis caused by random integration of retroviruses. Its safety has been verified by the global cowpox vaccination program. Attenuated strains such as MVA (Modified Vaccinia Ankara) significantly reduce virulence and immunogenicity by deleting VP37 (envelope formation-related gene) and VP26 (host range regulatory gene), while retaining efficient gene expression characteristics.
[0004] In the field of tumor immunotherapy, recombinant VV can encode tumor-specific antigens (such as EGFRvIII, HER2 / neu) or secretory immunomodulatory molecules (such as PD-1 / PD-L1 blocking antibodies, IL-12), directly activating T cells in the tumor microenvironment and reshaping the immunosuppressive microenvironment. For infectious disease prevention and control, VV vectors can deliver genes encoding SARS-CoV-2 spike protein trimers, inducing high levels of IgA antibodies and memory T cell responses through mucosal immune pathways (intranasal vaccination), thus making up for the shortcomings of traditional mRNA vaccines in immune persistence. In the treatment of genetic diseases, VV carries the β-globin functional gene and is delivered through hematopoietic stem cells in a targeted manner, which can repair the genetic defects of patients with sickle cell anemia. Its large capacity can also simultaneously deliver gene editing tools (such as BaseEditor) for precise correction. In the future, the optimization of vector backbones (such as inserting "suicide switch" genes) and intelligent regulatory elements through synthetic biology technology will further expand its application potential in the treatment of complex diseases.
[0005] Although attenuated strains such as MVA have been widely used, problems such as low homologous recombination efficiency and high cost still exist. Summary of the Invention
[0006] The purpose of the present invention is to provide a method for preparing recombinant vaccinia virus to solve the problems of low homologous recombination efficiency and high cost in attenuated strains such as MVA in the background art, thereby improving experimental efficiency and reducing production costs.
[0007] The purpose of the present invention can be achieved through the following technical solutions:
[0008] The present invention provides a method for preparing a recombinant vaccinia virus, comprising the following steps:
[0009] S1. Obtaining viral genome: Obtain virus A and then extract the MVA viral genome;
[0010] S2. Obtain recombinant plasmid: Design TK-sgRNA target site and construct the target site into the vector to obtain VP116 plasmid; construct EGFP and its front and back homologous sequences into the plasmid Phdr-TK to obtain Phdr-TK (EGFP) plasmid;
[0011] CRISPR / Cas9 gene editing technology uses a designed guide RNA (gRNA) to complement the target DNA sequence, allowing the Cas9 enzyme to precisely identify and cut specific gene sites, minimizing off-target effects. Compared to traditional methods, CRISPR / Cas9 has a shorter construction cycle, lower costs, and significantly improved editing efficiency in most cell types.
[0012] Traditional enzyme digestion is limited by the compatibility of the enzyme digestion sites of the vector and the target fragment. Compared with the traditional restriction endonuclease cloning method, the homologous recombination method has the following advantages: (1) It is not limited by restriction enzyme digestion sites and can achieve precise insertion at any site; (2) It has high recombination efficiency and high positive cloning rate; (3) It can achieve simultaneous assembly of multiple fragments and is suitable for the construction of complex vectors; (4) It is seamless and does not introduce additional base sequences. These characteristics have made the homologous recombination method widely used in molecular biology experiments such as gene cloning, gene knock-in / knock-out, and point mutation introduction.
[0013] As a fluorescent reporter gene, EGFP can be used to monitor gene integration efficiency in real time directly through fluorescence microscopy or flow cytometry, allowing for rapid screening of successfully edited cells.
[0014] S3. Cell transfection: Culture 293T cells for transfection and co-transfect VP116 plasmid and Phdr-TK (EGFP) plasmid into 293T cells;
[0015] 293T cells are a cell line with high transfection efficiency. Co-transfection can introduce multiple plasmids simultaneously, which can be used to increase the expression level of the target gene EGFP, facilitating subsequent experimental detection.
[0016] S4. Extraction of recombinant viral genome: 24 hours after the plasmid transfection in S3, infect 293T cells with virus A and collect virus B; dilute virus B and infect HepG2 cells. After culture, single clones are picked and expanded for genome extraction;
[0017] S5. Obtaining recombinant vaccinia virus: amplify the recombinant virus genome by PCR, and screen positive clones by electrophoresis; purify the positive clones and amplify them to obtain the recombinant vaccinia virus.
[0018] PCR amplification uses specific primers to amplify the target recombinant fragment (such as a marker gene or functional gene) to confirm the successful integration of the exogenous DNA into the viral genome. Agarose gel electrophoresis can directly determine whether the PCR product is the same size as the target fragment by band mobility, allowing rapid screening of recombinant positive clones.
[0019] Furthermore, in step S1, the method for obtaining virus A is plaque purification technology. The specific steps of the plaque purification technology are as follows: one day before infection, HepG2 cells were cultured in a 6-well plate, and the number of cells inoculated was 3×10 6 -4x10 6 The next day, the MVA strain (GenBank: AY603355.1) was diluted 10-fold in serum-free medium. -2 -10 -6HepG2 cells were infected with the virus in an infection volume of 1 ml. After infection at 37°C for 6 h, the virus solution was discarded and the cells were rinsed twice with 1xPBS. An agar-medium mixture with a final agar concentration of approximately 0.4% was poured into each well. 2 ml was added to each well. The cell culture plate was placed in an incubator and cultured for 3-6 days. Plaque formation was observed, and monoclonal plaques were selected and marked with a marker. A single plaque was selected and inoculated into HepG2 cells for expansion culture. After 2-3 rounds of plaque purification, the final plaque was expanded and purified to obtain virus A.
[0020] Plaque purification technology is a purification method based on the specific lysis characteristics of viral host cells. Its core process is: a gradient dilution of the virus suspension is inoculated onto the surface of the adherent monolayer of cells, and after adsorption and penetration, it is covered with a low-melting-point agarose culture medium to form a physical diffusion barrier. After the virus completes its replication cycle in the host cell, the cell is lysed, and the released progeny virus is blocked by the agarose layer and can only infect adjacent cells to form a localized lesion area. By controlling the initial multiplicity of infection of the virus through continuous quantitative dilution, a statistically significant single-particle infection event can be achieved, and a single plaque corresponds to an original virus particle with infectious activity. After 3-5 generations of plaque screening, a single plaque is isolated by mechanical scraping or agarose puncture and amplified and cultured, which can eliminate heterologous virus contamination and defective interfering particles, and obtain a monoclonal virus strain with a uniform genetic background. This technology effectively solves the problem of separating mutant strains in mixed virus populations through the dual control of spatial isolation and dilution effect, and is a standard for virus cloning, vaccine seed preparation and pathogenic mechanism research.
[0021] Furthermore, in step S2, the vector is VP116-U6-sgRNA-EF1a-Cas9-P2A-Pur o.
[0022] Furthermore, in step S2, the sequence of the TK-sgRNA target is shown as SEQ ID NO: 2, and the sequence of the TK site is shown as SEQ ID NO: 1.
[0023] Furthermore, in step S2, the homologous sequence is shown as SEQ ID NO:3.
[0024] Furthermore, in step S3, the specific steps of cell transfection are as follows: one day before transfection, 293T cells are plated until the density reaches 65-75% on the next day, and VP116 plasmid and Phdr-TK (EGFP) plasmid are co-transfected into 293T cells.
[0025] Furthermore, in step S4, the infection time of virus A is 24h-48h, and the MOI of the initial infection virus A is 5-10.
[0026] Furthermore, in step S4, the specific steps of diluting virus B are as follows: diluting virus B by 10 times in a gradient manner, and finally taking the diluted 10 -2 -10 -6 virus.
[0027] Furthermore, in step S4, the culture time is 3-6 days.
[0028] Furthermore, in step S5, the primers for PCR amplification are MG-FP and MG-RP, and the sequences are shown in SEQ ID NO:4 and SEQ ID NO:5.
[0029] Beneficial effects of the present invention:
[0030] This invention proposes a highly innovative and practical method for constructing recombinant vaccinia viruses. Its core advantages lie in the convenience, efficiency, and cost-effectiveness of the operational process, providing strong technical support for the rapid development and optimization of vaccinia virus vectors in biomedical research and virology applications. By systematically optimizing the viral recombination steps, this method significantly shortens the lengthy gene manipulation cycles used in traditional techniques while significantly reducing experimental costs, enabling laboratories to efficiently produce high-quality recombinant vaccinia viruses with lower resource investment. The details are as follows:
[0031] 1. The construction of traditional recombinant vaccinia virus usually relies on complex homologous recombination or bacterial artificial chromosome (BAC) systems, which have bottlenecks such as cumbersome operation, low screening efficiency, and long cycle time. The present invention overcomes the above-mentioned shortcomings through the following technological innovations: the highly efficient CRISPR-Cas9 system is used to accurately create double-strand breaks in the vaccinia virus genome, and a linearized donor plasmid containing a marker gene (fluorescent protein EGFP) is introduced. The exogenous gene is directly inserted through intracellular homologous recombination, which improves the recombination efficiency and shortens the recombination cycle compared with traditional methods.
[0032] 2. This method has wide applicability and can be flexibly applied to the construction and modification of various types of recombinant vaccinia viruses. By inserting fluorescent proteins, it can achieve real-time tracking and quantitative analysis of viruses in cells or animal models, and has a wide range of application scenarios.
[0033] 3. The labeled recombinant vaccinia virus constructed by the method of the present invention exhibits unique advantages in the study of viral biological characteristics: through fluorescent or bioluminescent labeling, the entire process of virus adsorption, invasion, replication and release in host cells can be monitored in real time, revealing the interaction mechanism between the virus and host cell membrane receptors. BRIEF DESCRIPTION OF THE DRAWINGS
[0034] The present invention will be further described below with reference to the accompanying drawings.
[0035] Figure 1This is the vector map of VP116-U6-sgRNA-EF1a-Cas9-P2A-Puro of the present invention;
[0036] Figure 2 is the plasmid map of Phdr-TK (EGFP) of the present invention;
[0037] Figure 3 Schematic diagram of the results of agarose gel electrophoresis of the recombinant viral gene of the present invention, in which M represents a marker and lanes 1-4 represent PCR amplification products, respectively. DETAILED DESCRIPTION
[0038] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments.
[0039] Example 1
[0040] Obtain viral genome:
[0041] 1. Obtain pure virus A: Culture HepG2 cells in a 6-well plate one day before infection, with the inoculated cell count being 5x10 6 The next day, the MVA strain (GenBank: AY603355.1) was diluted 10-fold in serum-free medium. -4 HepG2 cells were infected with the virus in an infection volume of 1 ml. After infection at 37°C for 6 h, the virus solution was discarded and the cells were rinsed twice with 1xPBS. An agar-medium mixture with a final agar concentration of approximately 0.4% was poured into each well. 2 ml was added to each well. The cell culture plate was placed in an incubator and cultured for 5 days. Plaque formation was observed, and monoclonal plaques were selected and marked with a marker. A single plaque was selected and inoculated into HepG2 cells for expansion culture. After three rounds of plaque purification, the final plaque was expanded and purified to obtain virus A.
[0042] 2. Viral genome extraction: Using the viral genome extraction kit developed by Universal Biotechnology (Anhui) Co., Ltd., 200 μl of the purified virus A was taken to extract the viral genome according to the kit instructions. The viral genome concentration was quantified using Nanodrop and then stored at -20°C.
[0043] Example 2
[0044] Obtain recombinant plasmid:
[0045] 1. CRISPR / Cas9 gene editing to obtain VP116 plasmid:
[0046] (1) Design sgRNA to target the TK site of the viral genome. The TK gene sequence is as follows: atgaacggc (SEQ ID NO: 1);
[0047] (2) The target sequence TK-sgRNA was designed according to the website https: / / crispor.gi.ucsc.edu / . The sequence of TK-sgRNA was GGACATATTCAGTTGATAAT (SEQ ID NO: 2).
[0048] (3) The target sequence TK-sgRNA was constructed into the VP116-U6-sgRNA-EF1a-Cas9-P2A-Puro vector to obtain the VP116 plasmid.
[0049]
[0050] Example 3
[0051] Cell transfection: 293T cells were plated one day before transfection, and the density was about 70% on the next day. The two plasmids VP116 and Phdr-TK (EGFP) constructed above were co-transfected into 293T cells.
[0052] Example 4
[0053] Extraction of recombinant virus genome: 24 hours after transfection, the purified virus A was used to infect 293T cells at an MOI of 8. After 24 hours of infection, the cells showed complete pathological changes and virus B was obtained. Virus B was collected and stored at -80°C. Virus B was diluted 10-fold and the 10-fold dilution was used. -4 The virus was infected with HepG2 cells plated on a 6-well plate, and then agar was added after infection. After 6 days of culture, monoclonal plaques were picked and cultured on a 48-well plate. After expanded culture, part of the plaques was taken out for genome extraction to obtain the recombinant virus genome.
[0054] Example 5
[0055] Obtain recombinant vaccinia virus:
[0056] 1. PCR amplification: The PCR amplification primers were MG-FP and MG-RP, with sequences shown as AAGCAGAAGAACGGCATCAA (SEQ ID NO: 4) and TCTCGGTTTCCTCACCCAAT (SEQ ID NO: 5). The amplified fragment was 692 bp in size, spanning the MVA gene and the EGFP gene. The PCR amplification system was shown in Table 1, and the PCR reaction procedure was shown in Table 2.
[0057] Table 1
[0058] Reagents Addition amount PCRmastermix 25 μL MG-FP (10 μM) 1 μL MG-RP (10 μM) 1 μL <![CDATA[ddH2O]]> 21 μL template 2μL Total volume 50μL
[0059] Table 2
[0060]
[0061]
[0062] 2. Select positive clones: After PCR amplification, the PCR products were detected by agarose gel electrophoresis. Figure 3As shown, based on the band sizes in the figure, the target fragment size for the four monoclonal clones in this round of screening is 692 bp. Based on the marker, the band in lane 2 is located between 400 and 700 bp, which matches the target band size. Therefore, it can be determined that the band amplified in lane 2 is the selected recombinant virus, indicating that this monoclonal plaque is a successfully recombinant vaccinia virus. The target band is absent in the remaining lanes, indicating that only the plaque corresponding to lane 2 is positive for the recombinant strain, while the remaining plaques are negative.
[0063] 3. The recombinant vaccinia virus was expanded in HepG2 cells and subjected to three rounds of plaque purification. The specific steps were as follows: HepG2 cells were cultured in 6-well plates one day before infection, and the number of cells inoculated was 5x10 6 On the second day, the positive clones screened were diluted 10-fold in serum-free medium. -4 HepG2 cells were infected with the virus in an infection volume of 1 ml. After infection at 37°C for 6 h, the virus solution was discarded and the cells were rinsed twice with 1xPBS. An agar-medium mixture with a final agar concentration of approximately 0.4% was poured into each well. 2 ml was added to each well. The cell culture plate was placed in an incubator and cultured for 5 days. Plaque formation was observed, and monoclonal plaques were selected and marked with a marker. A single plaque was selected and inoculated into HepG2 cells for expansion culture. After three rounds of plaque purification, the final plaque was expanded and purified to obtain the recombinant vaccinia virus.
[0064] The above disclosures are only a few specific embodiments of the present invention. However, the embodiments of the present invention are not limited thereto. Any changes that can be conceived by those skilled in the art should fall within the scope of protection of the present invention.
Claims
1. A method for preparing a recombinant vaccinia virus, characterized in that: The steps include: S1. Obtaining viral genome: Obtain virus A and then extract the MVA viral genome; S2. Obtain recombinant plasmid: Design TK-sgRNA target site and construct the target site into the vector to obtain VP116 plasmid; construct EGFP and its front and back homologous sequences into the plasmid Phdr-TK to obtain Phdr-TK (EGFP) plasmid; S3. Cell transfection: Culture 293T cells for transfection and co-transfect VP116 plasmid and Phdr-TK (EGFP) plasmid into 293T cells; S4. Extraction of recombinant viral genome: 24 hours after the plasmid transfection in S3, infect 293T cells with virus A, collect virus B, dilute it and infect HepG2 cells, culture it and expand it for genome extraction; S5. Obtaining recombinant vaccinia virus: Perform PCR amplification on the genome obtained in S4 and screen for positive clones; purify and amplify the positive clones to obtain recombinant vaccinia virus.
2. The method for preparing a recombinant vaccinia virus according to claim 1, wherein: In step S1, virus A is obtained by plaque purification. The specific steps of the plaque purification technique are as follows: HepG2 cells are cultured in a 6-well plate one day before infection, and the number of cells inoculated is 3×10 6 -4x10 6 On the second day, the MVA strain was diluted 10-fold in serum-free medium. -2 -10 -6 HepG2 cells were infected with the virus in an infection volume of 1 ml. After infection at 37°C for 6 h, the virus solution was discarded and the cells were rinsed twice with 1xPBS. An agar-medium mixture with a final agar concentration of approximately 0.4% was poured into each well. 2 ml was added to each well. The cell culture plate was placed in an incubator and cultured for 3-6 days. Plaque formation was observed, and monoclonal plaques were selected and marked with a marker. A single plaque was selected and inoculated into HepG2 cells for expansion culture. After 2-3 rounds of plaque purification, the final plaque was expanded and purified to obtain virus A.
3. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S2, the vector is VP116-U6-sgRNA-EF1a-Cas9-P2A-Puro.
4. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S2, the sequence of the TK-sgRNA target site is shown in SEQ ID NO: 2, and the sequence of the TK site is shown in SEQ ID NO:
1.
5. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S2, the homologous sequence is shown as SEQ ID NO:
3.
6. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S3, the specific steps of cell transfection are as follows: one day before transfection, 293T cells are plated until the density reaches 65-75% on the next day, and VP116 plasmid and Phdr-TK (EGFP) plasmid are co-transfected into 293T cells.
7. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S4, the infection time of virus A is 24h-48h, and the MOI of the initial infection virus A is 5-10.
8. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S4, the specific steps of diluting virus B are as follows: dilute virus B 10 times in a gradient, and finally take the diluted 10 -2 -10 -6 virus.
9. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S4, the culture time is 3-6 days.
10. The method for preparing a recombinant vaccinia virus according to claim 1, characterized in that: In step S5, the primers for PCR amplification are MG-FP and MG-RP, and the sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5.