SNP (Single Nucleotide Polymorphism) molecular genetic marker of NFE2L1 gene related to chicken feed conversion rate and application of SNP molecular genetic marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular genetic marker of an NFE2L1 gene related to a chicken feed conversion rate and application, and belongs to the technical field of animal genetic breeding and molecular biology. The SNP molecular genetic marker is located at the 6493284 site of a chromosome 27, the sequence number is rs731344472, and the site is G > T mutation. Experiments prove that the SNP molecular genetic marker chr27-6493284 provided by the invention is remarkably related to the feed conversion rate character of the yellow-feathered broiler chicken, can be applied to breeding of the yellow-feathered broiler chicken with low feed conversion rate, and can effectively reduce the feed consumption in the production process and improve the economic benefits and competitiveness of enterprises; the method can be used for efficiently screening yellow feather broilers of individuals or parents with excellent characters of feed conversion rate.

Description

Technical Field

[0001] The present invention relates to the technical field of animal genetic breeding and molecular biology, and in particular to a SNP molecular genetic marker of an NFE2L1 gene associated with chicken feed conversion rate and an application thereof. Background Art

[0002] Feed Conversion Ratio (FCR) is the core indicator for measuring the efficiency of poultry feed utilization. It is defined as the ratio of the total amount of feed consumed by the animal to the total amount of output products (such as meat and eggs). In poultry production, feed costs account for 60%-70% of the total breeding costs, which directly determines the level of breeding efficiency. Studies have shown that for every 0.1 point improvement in FCR, each broiler can reduce feed consumption by approximately 0.8-1.2 kg, which not only significantly reduces production costs, but also reduces nitrogen and phosphorus emissions, achieving a dual improvement in economic and environmental benefits. From a genetic perspective, FCR is a medium heritability trait (h 2 ≈0.3-0.4), indicating that stable genetic progress can be achieved through genetic selection.

[0003] Reducing feed conversion efficiency is crucial for improving economic profitability. Therefore, discovering and utilizing new genes associated with feed conversion efficiency in yellow-feathered broiler chickens is of great significance for chicken genetics and breeding. Genome-wide association studies (GWAS) are a method for locating loci associated with complex traits by scanning large swaths of the genome for variation. Its core principle is based on linkage disequilibrium (LD). This involves comparing genotype frequencies of individuals with extreme trait characteristics within a population to identify SNPs that are significantly associated with the trait.

[0004] As poultry breeding enters the genomic era, integrating GWAS technology with SNP marker-assisted selection has become a key path to breaking through the bottleneck of FCR genetic improvement. High-throughput sequencing technology can reveal the genetic regulatory mechanisms of feed conversion efficiency traits, identify potential molecular markers for specific phenotypes, and improve the accuracy of trait genetic prediction, providing a powerful tool for early selection of traits and accelerating genetic breeding processes. Identifying SNP molecular genetic markers associated with feed conversion efficiency is one of the keys to accelerating the breeding of low-feed conversion yellow broiler chickens and improving breeding efficiency. Summary of the Invention

[0005] In order to solve the above technical problems, the purpose of the present invention is to provide a SNP molecular genetic marker of the NFE2L1 gene related to the feed conversion rate of chickens and its application.

[0006] The technical solution of the present invention to solve the above technical problems is as follows: In a first aspect of the present invention, a SNP molecular genetic marker of the NFE2L1 gene related to the feed conversion rate of chickens is provided. The SNP molecular genetic marker is located at position 6493284 of chromosome 27, with the sequence number being rs731344472, and the position is a G>T mutation.

[0007] The beneficial effects of the present invention are as follows: the present invention targets the differences in feed conversion rates of yellow-feathered broiler chickens of different genotypes, and through association analysis between the feed conversion rate of yellow-feathered broiler chickens and whole-genome SNP genetic markers, screens out a SNP molecular genetic marker chr27-6493284 that affects yellow-feathered broiler chickens. The SNP molecular genetic marker chr27-6493284 is applied to the screening of yellow-feathered broiler chickens to screen out yellow-feathered broiler chickens with low feed conversion rates, effectively reducing feed consumption in the production process and improving the economic benefits and competitiveness of the enterprise. The chr27-6493284 genetic marker involved, i.e., the mutation site with the SNP number chr27-6493284, can be found in the NCBI chicken genome database (bGalGal1.mat.broiler.GRCg6a).

[0008] Furthermore, G>T mutation indicates different mutant alleles at a site, G is the allele with a high frequency, T is the allele with a low frequency, and the symbol > indicates the frequency of the allele.

[0009] Furthermore, the mutation site and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO. 1, wherein R is the mutation site, and when R is T, it is a chicken with low feed conversion rate; SEQ ID NO.1: 5'-ACTGTCCCGTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATC TGTGCCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGCGATAAAGAGGGTGGCTGATGATTGCAGGGCAACTGCAACACCCTCAGGACCCCAGCCCAGGCATGGGGCCAGCAGGCAGCCAACGCTCACCTGARGGCTGGGCTCCACCACGATGCCCCAATCG ATCTCATTGTCCTGGGCTTCCCCGCCTGCAGCAGCGCTGTCAATGTCACCCCCACCAATGGGCTCCAGCGTGAAGTCACCCCAGTCGATCTGCAGCGAAAAGGGCAATGGGACCTCTGAGACCTGAAGGACACGAGCTCCCCTCCAGCTGCAGCAAACACCCACAGCCCCA-3'.

[0010] Furthermore, a method for determining the above-mentioned SNP molecular genetic marker is provided, and the specific steps are as follows: (1) Cultivate healthy yellow-feathered broiler chickens, select the yellow-feathered broiler chickens with the lowest and highest feed conversion rates, and collect blood for preservation; (2) Extract DNA and measure DNA quality; (3) Identify SNP molecular genetic markers associated with feed conversion efficiency traits in yellow-feathered broiler chickens.

[0011] In a second aspect of the present invention, a primer is provided for detecting the above-mentioned SNP molecular genetic marker, wherein the forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3; SEQ ID NO.2: 5'-CCTCAGAGCCATCCTCCAAC-3'; SEQ ID NO. 3: 5'-GTCTCAGAGGTCCCATTGCC-3'.

[0012] The third aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular genetic marker, comprising the above-mentioned primers.

[0013] Furthermore, the kit also includes 2×Taq Master Mix.

[0014] A fourth aspect of the present invention provides the use of the above-mentioned SNP molecular genetic markers or primers or kit in screening chicken individuals or parents with low feed conversion rates.

[0015] In a fifth aspect, the present invention provides a method for screening chickens with low feed conversion rate, wherein the SNP molecular markers of the individuals to be screened are amplified and sequenced by PCR technology, and homozygous individuals with the SNP molecular marker genotype of TT are screened as chickens with low feed conversion rate.

[0016] Furthermore, a method for screening chickens with low feed conversion rate based on the above-mentioned kit for detecting SNP molecular genetic markers comprises the following steps: (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction; (2) The kit contains 2×Taq Master Mix, forward and reverse primers; (3) Sequencing the PCR products using the Sanger sequencing method; (4) Select homozygous individuals with TT genotype at position 6493284 on chromosome 7.

[0017] Furthermore, the PCR system was a 20 μL system, including 10 μL of 2×Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.

[0019] The present invention has the following beneficial effects: (1) The present invention provides a SNP molecular genetic marker chr27-6493284. Experimental verification shows that the molecular genetic marker is significantly correlated with the feed conversion rate trait of yellow-feathered broiler chickens. The marker can be used to select and breed yellow-feathered broiler chickens with low feed conversion rate, effectively reduce feed consumption during the production process, and improve the economic benefits and competitiveness of the enterprise.

[0020] (2) The present invention provides primers and a kit for identifying the SNP molecular genetic marker chr27-6493284, which can be used to efficiently screen yellow-feathered broiler chickens with individuals or parents having excellent feed conversion rate traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Manhattan plot for SNP molecular genetic markers; Figure 2 This is the SNP molecular genetic marker genotype sequencing map. DETAILED DESCRIPTION

[0022] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not intended to limit the scope of the invention. In the embodiments, if specific conditions are not specified, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0023] Example 1: Screening of SNP molecular genetic markers The screening process of SNP molecular genetic markers specifically includes the following steps: 1872 healthy yellow-feathered broiler chickens were selected and fed a full diet for 49 days. The daily feed intake, initial test body weight, and final body weight of each chicken were recorded, and the feed conversion rate was calculated using the following formula: ; Where, FCR is feed conversion rate; W f is feed consumption; W a To increase the weight of living organisms.

[0024] The lower the FCR value, the lower the feed conversion rate, which means that less feed is consumed for the same production capacity during the production process, that is, feed is saved. DNA was extracted from each sample, and the DNA sample was quality tested. The DNA concentration was tested using QubitFluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. The test results showed that 99 samples were unqualified, and the qualified 1,773 yellow-feathered chicken breeder DNA samples were used for subsequent library construction and sequencing. Simplified genome sequencing was performed using high-throughput production measurement technology. The sequencing data was quality controlled and filtered to remove low-quality sequencing reads and possible false-positive BNP. Feed conversion rate was used as a phenotype and associated with SNP data. GWAS analysis was performed using the EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html.), and the analysis model is as follows: y=Xb+Zu+m+e In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2 α ), e~N(0, Iσ 2 ε α), G represents the genomic kinship matrix, I represents the identity matrix, σ 2 α , σ 2 εrepresent the additive genetic effect variance and residual variance, respectively, and m represents the SNP marker effect.

[0025] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered broiler chickens was found. It is located in the NFE2L1 gene on chromosome 27 of yellow-feathered broiler chickens, specifically at the 6493284 site of the rs731344472 sequence on chromosome 27, and is named chr27-6493284. Figure 1 As shown in the Manhattan plot, the mutation site and upstream and downstream primer sequences of the SNP molecular genetic marker are shown in SEQ ID NO.1.

[0026] SEQ ID NO.1: 5'-ACTGTCCCGTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATC TGTGCCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGCGATAAAGAGGGTGGCTGATGATTGCAGGGCAACTGCAACACCCTCAGGACCCCAGCCCAGGCATGGGGCCAGCAGGCAGCCAACGCTCACCTGARGGCTGGGCTCCACCACGATGCCCCAATCG ATCTCATTGTCCTGGGCTTCCCCGCCTGCAGCAGCGCTGTCAATGTCACCCCCACCAATGGGCTCCAGCGTGAAGTCACCCCAGTCGATCTGCAGCGAAAAGGGCAATGGGACCTCTGAGACCTGAAGGACACGAGCTCCCCTCCAGCTGCAGCAAACACCCACAGCCCCA-3'.

[0027] Among them, R is a T>G mutation site. When R is T, the chicken has a lower feed conversion rate; 5'- and -3' respectively represent the 5' end and 3' end of the nucleotide sequence.

[0028] Example 2: Validation of SNP molecular genetic markers 1. The verification method of the SNP molecular genetic marker chr27-6493284 specifically includes the following steps: (1) The SNP molecular genetic marker chr27-6493284 was verified in another yellow-feathered broiler chicken population. A total of 1773 healthy yellow-feathered broiler chickens were fed a full diet for 49 days. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. 150 individuals with low feed conversion rate (negative value) and high feed conversion rate (positive value) were selected, and blood was taken for DNA extraction.

[0029] (2) Using the DNA extracted in step (1) as a template, a PCR reaction was performed using the primers shown in SEQ ID NO. 2-3.

[0030] SEQ ID NO.2: 5'-CCTCAGAGCCATCCTCCAAC-3'; SEQ ID NO. 3: 5'-GTCTCAGAGGTCCCATTGCC-3'.

[0031] The PCR reaction system was a 20 μL system, including 10 μL of 2× Taq Master Mix, 1 μL each of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL.

[0032] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; 35 cycles of denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s; and extension at 72°C for 5 min.

[0033] (3) Sequence the PCR products using the Sanger sequencing method.

[0034] 2. Results Analysis Analyze the sequencing results and record the corresponding genotype of each individual according to the sequencing peak graph of each sample (such as Figure 2 ), the corresponding site in the TT genotype sequencing plot had only one peak, indicating the alleles were identical, both T; the corresponding site in the TG genotype sequencing plot had two peaks, indicating different alleles, one G and one T; and the corresponding site in the GG genotype sequencing plot had only one peak, indicating the alleles were identical, both G. One-way analysis of variance (ANOVA) using SPSS 26.0 was used to analyze the relationship between SNP molecular marker genotypes and alleles and feed conversion rate. The results are shown in Tables 1 and 2.

[0035] Table 1 Statistical table of the distribution differences of SNP molecular genetic marker genotypes between low feed conversion rate and high feed conversion rate

[0036] Table 2 Statistical table of the distribution differences of SNP molecular genetic marker alleles between low feed conversion rate and high feed conversion rate

[0037] As shown in the table, the genotype and allele frequencies of the SNP molecular genetic marker chr27-6493284 were highly significantly different between the low and high feed conversion efficiency groups (P < 0.01). In the low feed conversion efficiency group, the frequency of the T allele was higher than that of the G allele, and the frequency of the TT genotype was higher than that of the GG genotype, indicating that individuals with the TT genotype at position 201 have a better feed conversion phenotype than those with the GG genotype. This further demonstrates that the polymorphism of the selected molecular marker is significantly associated with feed conversion efficiency, indicating that it is a SNP locus associated with feed conversion efficiency and can be used for breeding yellow-feathered broilers with low feed conversion efficiency.

[0038] Example 3: Assisted molecular breeding method for feed conversion efficiency traits of yellow-feathered broiler chickens using SNP molecular genetic markers The invention provides a kit for detecting a SNP molecular genetic marker chr7-22401119. The kit comprises 2×Taq Master Mix, forward and reverse primers as shown in SEQ ID NO. 2-3, and ddH2O.

[0039] The specific method includes the following steps: (1) Blood was collected from the wing vein of the yellow-feathered broiler chickens to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.

[0040] (2) PCR was performed on the DNA extracted product from step (1). The PCR reaction system was a 20 μL system, including 10 μL of 2×TaqMaster Mix, 1 μL of forward and reverse primers, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, and extension at 72°C for 30 s, for 35 cycles; and extension at 72°C for 5 min.

[0041] (3) Sequence the PCR product from step (2) using the Sanger sequencing method.

[0042] (4) Genotyping was performed based on the sequencing results, and homozygous individuals with the SNP molecular genetic marker chr27-6493284 genotype of TT were screened for breeding to reduce feed conversion rate, effectively reduce feed consumption and breeding costs; the individuals with this marker were selected to join the core breeding group, which can achieve rapid homozygosity of the alleles related to this trait and provide technical support for accelerating the progress of genetic selection.

[0043] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A SNP molecular genetic marker of the NFE2L1 gene associated with chicken feed conversion efficiency, characterized in that: The SNP molecular genetic marker is located at position 6493284 of chromosome 27, with the sequence number being rs731344472, and the position is a G>T mutation.

2. The SNP molecular genetic marker of the NFE2L1 gene related to chicken feed conversion efficiency according to claim 1, characterized in that: The mutation site and upstream and downstream sequences of the SNP molecular genetic marker are shown in SEQ ID NO. 1, wherein R is the mutation site, and when R is T, it indicates a chicken with low feed conversion rate.

3. A primer for detecting the SNP molecular genetic marker according to claim 1 or 2, characterized in that: The forward primer sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular genetic marker according to claim 1 or 2, characterized in that: Comprising the primer according to claim 3.

5. Use of the SNP molecular genetic marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in screening chicken individuals or parents with low feed conversion efficiency.

6. A method for screening chickens with low feed conversion rate, characterized in that: The SNP molecular markers of claim 1 or 2 of the individuals to be screened are amplified and sequenced by PCR technology, and homozygous individuals with the SNP molecular marker genotype of TT are screened as low feed conversion rate chickens.

Images