KASP molecular marker primer combination for identifying rose fragrance character of grape fruit and application of KASP molecular marker primer combination
By providing a new KASP molecular marker primer combination, the problem of insufficient sensitivity and specificity in the detection of rose fragrance traits in grape fruits in the existing technology is solved, efficient screening and identification of rose fragrance traits is achieved, and the detection accuracy is improved.
Patent Information
- Application Number
- CN202511005694.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-22
- Publication Date
- 2025-09-16
AI Technical Summary
The KASP molecular marker primer set used in the prior art to identify the rose fragrance trait of grape fruit has insufficient sensitivity and specificity in high-throughput detection, making it difficult to effectively screen and identify the rose fragrance trait.
A new KASP molecular marker primer combination is provided, including forward primer F1, forward primer F2 and reverse primer R, which is used for PCR amplification and fluorescence signal determination, and is used to determine whether grape fruits have rose fragrance through genotype, screen parents and breed offspring.
The identification ability and high-throughput screening ability of rose fragrance traits have been significantly improved, with a detection accuracy rate of 83.04%, which is better than the 62.50% of the existing technology.
Smart Images

Figure CN120648847A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant molecular genetics and crop molecular breeding, and in particular to a KASP molecular marker primer combination for identifying the rose fragrance trait of grape fruit and its application in grape germplasm resource screening, variety identification and assisted breeding. Background Art
[0002] The aroma characteristics of grape (Vitis vinifera L.) fruit directly impact its commercial value and consumer acceptance. Rose aroma is a key aroma type. Its formation is highly correlated with a specific single nucleotide polymorphism (SNP) site (e.g., VvDXS422 G / T) in the VvDXS (1-deoxy-Dxylulose 5-phosphate synthase) gene. Existing KASP molecular marker primer sets based on this site suffer from insufficient sensitivity and specificity in high-throughput detection. Therefore, there is an urgent need for a KASP marker primer set with high sensitivity and specificity to enhance rapid screening capabilities for rose aroma traits. Summary of the Invention
[0003] The present invention focuses on the problems existing in the above-mentioned prior art. By providing a KASP molecular marker primer set for identifying the rose aroma trait of grape fruit and its application in grape germplasm resource screening, variety identification and assisted breeding, the present invention solves the problem that the existing KASP molecular marker primer set based on the VVDXS422G / T site in the prior art has insufficient sensitivity and specificity for detecting the rose aroma trait of grape varieties, thereby improving the identification ability of grape varieties with rose aroma traits and high-throughput breeding screening capabilities.
[0004] The purpose of the present invention is achieved through the following technical solutions:
[0005] A primer combination is provided, comprising a forward primer F1, a forward primer F2 and a reverse primer R,
[0006] The nucleotide sequence of the forward primer F1 is SEQ ID No. 1;
[0007] The nucleotide sequence of the forward primer F2 is SEQ ID No. 2;
[0008] The nucleotide sequence of the reverse primer R is SEQ ID No. 3.
[0009] The forward primer F1, the forward primer F2 and / or the reverse primer R are used in preparing a product for identifying whether grape fruits have rose fragrance.
[0010] The primer combination is used in grape breeding to screen parents with rose fragrance traits or to breed offspring with rose fragrance traits.
[0011] A kit is provided, comprising the forward primer F1, the forward primer F2 or the reverse primer R. Further, the kit comprises the forward primer F1, the forward primer F2 and the reverse primer R. Furthermore, the kit further comprises a KASP enzyme reaction system.
[0012] A method for identifying whether grapes have rose aroma is provided. The method comprises the step of performing PCR amplification using the primer combination. The method further comprises the steps of determining the genotype using the fluorescence signal and determining the aroma trait based on the genotype: GT or TT predicts rose aroma, while GG predicts the absence of rose aroma. Furthermore, the method further comprises the step of extracting DNA from the grapes to be tested.
[0013] Provided is a grape breeding method, comprising performing typing analysis on hybrid offspring and selecting individuals with a VvDXS-422G / T genotype of GT or TT as parents for breeding; wherein GT is a heterozygous type and TT is a homozygous type, and both GT and TT correspond to fruits having a rose fragrance trait.
[0014] Compared with the existing technology, the primer set provided by the present invention has higher amplification efficiency and significantly improved sensitivity and specificity of the detection method, which can greatly enhance the identification ability and high-throughput screening ability of rose aroma traits of grape varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The KASP genotyping diagrams for the rose aroma trait of 112 grape varieties in Table 1 are shown, along with the primer combination of the present invention (left) and the primer combination of the comparative example (right). DETAILED DESCRIPTION
[0016] The embodiments of the present invention will be further described in detail below with reference to the examples. However, those skilled in the art will appreciate that the following examples are intended only to illustrate the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the experiments were performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the materials, reagents, and instruments used were all commercially available.
[0017] Example 1: Preparation of the primer mixture of the present invention
[0018] The forward primer F1, forward primer F2 and reverse primer R of the present invention were synthesized according to the following nucleotide sequences, wherein:
[0019] The sequence of the forward primer F1 (shown in SEQ ID NO: 1) is:
[0020] 5'- GAAGGTGACCAAGTTCATGCT tagagaattacgagaggttgccaaG-3' (the underline indicates the FAM linker sequence);
[0021] The sequence of forward primer F2 (as shown in SEQ ID NO: 2) is:
[0022] 5'- GAAGGTCGGAGTCAACGGATT tagagaattacgagaggttgccaaT-3' (wherein the underline indicates the HEX linker sequence);
[0023] The sequence of the reverse primer R (as shown in SEQ ID NO: 3) is:
[0024] 5′-TTATCTATTCTAAAGATCACAAGTAATAC-3.
[0025] The above three primers were dissolved in TE buffer (pH 8.0) to 50 μM respectively, and then mixed in a ratio of forward primer F1: forward primer F2: reverse primer R = 1:1:3 to obtain a primer mixture.
[0026] Example 2: Preparation of a primer mixture for comparative example
[0027] The forward primer F1', forward primer F2' and reverse primer R' of the comparative example were synthesized according to the following nucleotide sequences, wherein:
[0028] The sequence of the forward primer F1' (as shown in SEQ ID NO: 4) is:
[0029] 5'- GAAGGTGACCAAGTTCATGCT gagaattacgagaggttgccaaG-3' (the underline indicates the FAM linker sequence);
[0030] The sequence of the forward primer F2' (as shown in SEQ ID NO: 5) is:
[0031] 5'- GAAGGTCGGAGTCAACGGATT tagagaattacgagaggttgccaaT-3' (wherein the underline indicates the HEX linker sequence);
[0032] The sequence of the reverse primer R' (as shown in SEQ ID NO: 6) is:
[0033] 5′-CCAATTCATGCATCGGGTCCGCC-3.
[0034] The above three primers were dissolved in TE buffer (pH 8.0) to 50 μM respectively, and then mixed in a ratio of forward primer F1′:forward primer F2′:reverse primer R′=1:1:3 to obtain a primer mixture.
[0035] Example 3: Preparation of DNA samples
[0036] The grape varieties used in this experiment were grown at the North Experimental Base of the Zhengzhou Fruit Research Institute of the Chinese Academy of Agricultural Sciences and the Xinxiang Comprehensive Experimental Base. These included 112 grape varieties, including 'Zaoheibao,' 'Honggao,' 'Yangguangmei,' 'Ruiduxiangyu,' 'Miguang,' and hybrid populations: 64 plants of 'Christmas Rose x Rose Fragrance,' 90 plants of 'Summer Solstice Red x Rose Fragrance,' and 391 plants of 'Red Globe x Rose Fragrance.' Fresh leaf samples were collected from the plants in August 2024 and April 23, 2025, respectively.
[0037] Grape leaf DNA was extracted using a plant genomic DNA extraction kit, and the DNA concentration and quality were detected using a NanoDrop UV spectrophotometer (A260 / 280 was between 1.7-1.9). The DNA was diluted to 10-50 ng / L for later use.
[0038] Example 4: PCR amplification and labeling detection
[0039] Prepare the PCR reaction system according to the following formula:
[0040]
[0041] The PCR reaction conditions are as follows:
[0042]
[0043] Example 5, KASP typing verification results
[0044] like Figure 1 As shown, the genotype clustered near the X-axis is the allele type (T / T) connected to the TT fluorescent tag sequence, the genotype clustered near the Y-axis is the allele type (G / G) connected to the FAX fluorescent tag sequence, the genotype displayed in green in the middle is the heterozygous type (G / T) of the two alleles, and the sample displayed in black is the blank control without adding DNA template.
[0045] KASP markers were used to detect the genotyping of rose aroma in berries of 112 grape germplasms. The test results are shown in Table 1.
[0046] Table 1: KASP marker genotyping results for the presence or absence of rose aroma in grape germplasm
[0047]
[0048]
[0049]
[0050]
[0051] By verifying the 112 known grape varieties with aroma phenotypes in Table 1, the detection accuracy of the primer combination of the present invention reached 83.04% (correctly judging 93 samples), which is significantly better than the primer combination of the comparative example (accuracy rate of 62.50%).
[0052] This was further validated in multiple hybrid populations, including combinations such as "Christmas Rose x Rose Fragrance," "Summer Solstice Red x Rose Fragrance," and "Red Globe x Rose Fragrance." The test results are shown in Tables 2-4.
[0053] Table 2 KASP verification of allelic variation in the presence / absence of rose aroma in 'Christmas Rose × Rose Fragrance' grapes
[0054]
[0055]
[0056] Table 3 KASP verification of allelic variation in the presence / absence of rose aroma in 'Xiazhihong×Rose Fragrance' grapes
[0057]
[0058]
[0059] Table 4 KASP verification of allelic variation in the presence / absence of rose aroma in 'Red Globe × Rose Fragrance' grape berries
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066] Verification in multiple hybridization populations in Table 2 showed that the total detection success rate of the primer combination of the present invention was 96.94%, which was superior to the 92.66% of the primer combination of the comparative example. The detection rates of the primer combination of the present invention in the "Christmas Rose × Rose Fragrance", "Summer Solstice Red × Rose Fragrance", and "Red Globe × Rose Fragrance" populations were 95.31%, 97.78%, and 97.70%, respectively, which were significantly superior to the primer combinations of the comparative example (93.75%, 88.89%, and 91.05%).
[0067] In summary, the primer set of the present invention can be used to identify whether grape berries possess rose fragrance, thereby screening parents with the rose fragrance trait or breeding offspring with the rose fragrance trait. In grape breeding methods, hybrid offspring are subjected to genotyping analysis, and individuals with the VvDXS-422G / T genotype of GT or TT are selected as parents for breeding; GT is a heterozygous genotype, and TT is a homozygous genotype; both GT and TT correspond to fruits possessing the rose fragrance trait.
Claims
1. A primer combination, characterized in that: The primer combination includes forward primer F1, forward primer F2 and reverse primer R, The nucleotide sequence of the forward primer F1 is SEQ ID No. 1; The nucleotide sequence of the forward primer F2 is SEQ ID No. 2; The nucleotide sequence of the reverse primer R is SEQ ID No.
3.
2. Use of the forward primer F1, forward primer F2 and / or reverse primer R according to claim 1 in preparing a product for identifying whether grape fruits have rose fragrance.
3. Use of the primer combination of claim 1 in grape breeding, for screening parents with rose fragrance traits or breeding offspring with rose fragrance traits. 4 . A kit comprising the forward primer F1, the forward primer F2 or the reverse primer R according to claim 1 . The kit according to claim 4 , comprising the primer combination according to claim 1 .
6. The kit according to any one of claims 4-5, further comprising a KASP enzyme reaction system.
7. A method for identifying whether grapes have rose fragrance, characterized in that: The method comprises the step of performing PCR amplification using the primer combination according to claim 1.
8. The method according to claim 7, further comprising the steps of: The genotype was determined by the fluorescence signal, and the fragrance trait was determined based on the genotype: GT or TT was predicted to have rose fragrance, and GG was predicted to have no rose fragrance.
9. The method according to claim 8, further comprising the step of extracting DNA from the grape to be tested.
10. A grape breeding method, characterized in that: The hybrid offspring are subjected to typing analysis using the method described in any one of claims 7 to 9, and individuals with a VvDXS-422G / T genotype of GT or TT are selected as parents for breeding; wherein GT is a heterozygous type and TT is a homozygous type, and both GT and TT correspond to fruits having a rose fragrance trait.
Citation Information
Cited By
SNP (Single Nucleotide Polymorphism) molecular marker related to grape terpenoid aroma substances as well as detection method and application of SNP molecular marker
CN122128468A