Melon whole genome 4K liquid phase breeding chip and special single nucleotide polymorphism variation site and application thereof
Through the melon whole genome 4K liquid phase breeding chip and liquid phase chip technology, the problem of long cycle and low efficiency in melon breeding has been solved, and efficient and accurate variety identification and kinship analysis have been achieved, supporting the upgrading of the melon industry.
Patent Information
- Application Number
- CN202511092418.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Traditional breeding methods have problems of long cycles and low efficiency in melon breeding, and the existing molecular marker technology has limited application in the melon field, which makes it difficult to meet the needs of variety identification and quality improvement.
A melon whole-genome 4K liquid-phase breeding chip has been developed, which contains a combination of 4002 single nucleotide polymorphism variation site probes. Liquid-phase chip technology is combined with genotype detection to construct a variety fingerprint database, realizing high-throughput, low-cost variety identification and kinship analysis.
It has achieved efficient and accurate identification and kinship analysis of melon varieties, shortened breeding time, improved breeding efficiency, protected variety intellectual property rights, and supported the upgrading of the melon industry.
Smart Images

Figure CN120648849A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of melon variety identification, and in particular to a melon whole-genome 4K liquid-phase breeding chip and its dedicated single nucleotide polymorphism variation sites (SNP sites) and applications. Background Art
[0002] Muskmelon (Cucumis melo L.) is an important melon crop widely cultivated worldwide. Its sweet taste and rich nutritional value are deeply loved by consumers, and it plays a vital role in the development of the agricultural economy. In recent years, consumer demand for diverse and high-quality melon varieties has increased. However, traditional breeding methods, due to their inherently long cycles and low efficiency, have been unable to effectively meet the market's diverse and high-standard demands for melon quality, yield, and disease resistance. The complex genetic diversity of melon germplasm resources further exacerbates the complexity and difficulty of breeding. Furthermore, with over 2,000 melon varieties registered in China, the dozens of SSR loci currently used cannot meet the needs of market regulatory authorities for varietal identity and derivative variety identification. Therefore, there is an urgent need to introduce modern biotechnology to accelerate melon breeding, strengthen intellectual property protection for melon varieties, and provide support for the high-quality development of the melon seed industry.
[0003] Molecular markers, defined as DNA sequence fragments that can reflect specific genomic differences between organisms or populations, include various types, including RAPD, RFLP, SSR, SCAP, InDel, and single nucleotide polymorphisms. SNPs offer advantages such as stability, high density, wide distribution, and suitability for large-scale screening, significantly shortening breeding time and improving breeding efficiency. Liquid microarrays, an innovative technology for SNP detection, utilize probe hybridization and targeted capture sequencing to achieve higher typing accuracy, greater throughput, lower costs, and more flexible design compared to traditional solid-phase microarrays, making them a highly efficient and preferred solution for SNP typing. Liquid microarray technology has been widely used in crop breeding, including wheat, rice, and rapeseed, but its application in melon has been limited. Therefore, the development of an economical and practical liquid microarray for melons is crucial. This will not only promote innovation and advancement in melon breeding technology, but also provide a powerful tool for the upgrading and development of the melon seed industry. Summary of the Invention
[0004] To address the shortcomings of the prior art, the present invention aims to provide a melon whole-genome 4K liquid-phase breeding chip, its dedicated single nucleotide polymorphism (SNP) variant sites, and its application. This liquid-phase breeding chip can accurately obtain the genotypes of 4002 SNP variant sites across the entire melon genome.
[0005] In order to achieve the above object, the present invention adopts the following technical solutions:
[0006] Option 1:
[0007] A probe combination for detecting single nucleotide polymorphism (SNP) variation site combinations in the whole melon genome, wherein each SNP variation site corresponds to a probe, and the SNP variation site combination includes 4002 SNP variation sites. The positions and base types of the 4002 SNP variation sites in the genome are shown in Table 1 of the present invention specification, wherein the number on the left represents the chromosome number where the SNP variation site is located, the value in the middle represents the physical position of the chromosome where the SNP variation site is located, and the letters on the right represent the two base types of the SNP variation site; the positions of the 4002 SNP variation sites in the genome are determined based on the melon reference genome version "DHL92 V4.0".
[0008] In the probe combination of scheme 1 of the present invention, as a preferred embodiment, the corresponding positions of the sequences of each probe in the probe combination in the genome are shown in Table 2 of the present invention specification. The corresponding positions are determined based on the melon reference genome "DHL92 V4.0". In Table 2, the information on the corresponding position of each probe contains three data. From left to right, the first data represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data represents the starting position on the chromosome where the probe is located, and the third data represents the ending position on the chromosome where the probe is located.
[0009] Option 2:
[0010] A melon whole-genome 4K liquid-phase breeding chip comprises the probe combination for detecting the combination of single nucleotide polymorphism variation sites in the melon whole genome according to the first embodiment of the present invention.
[0011] The liquid-phase breeding chip targeting scheme 1 is used to detect single nucleotide polymorphism variation sites in the whole genome of melon to obtain base information of the polymorphic sites.
[0012] The liquid-phase breeding chip may also include other commonly required reagents or equipment.
[0013] Option 3:
[0014] The use of the probe combination for detecting single nucleotide polymorphism variation site combinations in the whole genome of melon according to the above-mentioned scheme 1 includes any one of the following (1) to (7):
[0015] (1) A kit for preparing a method for identifying muskmelon varieties;
[0016] (2) A kit for preparing a kit for identifying the authenticity of melon varieties;
[0017] (3) a kit for preparing a method for analyzing the genetic relationship of melon varieties;
[0018] (4) Used to identify melon varieties;
[0019] (5) Used to identify the authenticity of melon varieties;
[0020] (6) Used to analyze the genetic relationship of melon varieties;
[0021] (7) Used to construct a fingerprint database of the melon varieties to be tested.
[0022] Option 4:
[0023] The use of the melon whole genome 4K liquid phase breeding chip of the above-mentioned scheme 2 includes any one of the following (A) to (D);
[0024] (A) Used to identify melon varieties;
[0025] (B) Used to identify the authenticity of melon varieties;
[0026] (C) Used to analyze the genetic relationship of melon varieties;
[0027] (D) Used to construct a fingerprint database of the melon varieties to be tested.
[0028] Option 5:
[0029] A method for constructing a fingerprint database of test melon varieties comprises the following steps:
[0030] S1-1: Obtaining genomic DNA of the tested melon varieties;
[0031] S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library;
[0032] S1-3: The DNA library is combined with the probes of the above scheme 1 to form a hybridization system and hybridization capture is performed, and the sequencing library is obtained after purification;
[0033] S1-4: Sequencing the sequencing library and performing data analysis to obtain the genotyping information of the 4002 single nucleotide polymorphism variation sites shown in Table 1 of the present specification, and constructing a fingerprint database of the test melon varieties based on the genotyping information of the 4002 single nucleotide polymorphism variation sites.
[0034] Option 6:
[0035] A method for identifying a muskmelon variety to be tested comprises the following steps:
[0036] S2-1: Obtaining genomic DNA of the test melon variety and the standard melon variety respectively;
[0037] S2-2: The genomic DNA of each species obtained in step S2-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library of the corresponding species;
[0038] S2-3: The DNA library of each species is combined with the probe of the above scheme 1 to form a hybridization system and perform hybridization capture, and the sequencing library of each species is obtained after purification;
[0039] S2-4: Sequencing and data analysis are performed on the sequencing libraries of each variety to obtain genotyping information of the 4002 single nucleotide polymorphism variation sites shown in Table 1 of the present specification in each variety;
[0040] S2-5: The genotyping results of the 4002 single nucleotide polymorphism variation sites of the tested melon variety are compared with the genotyping results of the 4002 single nucleotide polymorphism variation sites of the standard melon variety, and the similarity LS of the single nucleotide polymorphism variation sites of the two melon varieties is calculated. The LS is calculated as follows: LS = (1-D / T) × 100%, where D is the number of different single nucleotide polymorphism variation sites between the two varieties, and T is the total number of single nucleotide polymorphism variation sites compared; then the following judgment is made:
[0041] If the site similarity between the tested melon variety and a standard melon variety is ≥98.0%, the tested melon variety and the standard melon variety are the same variety or suspected to be the same variety; the fewer the number of different sites, the higher the site similarity;
[0042] If the site similarity between the tested melon variety and a standard melon variety is between 96.0% and 98.0% but does not include 98%, the tested melon variety and the standard melon variety are similar varieties;
[0043] If the site similarity between the tested melon variety and a certain standard melon variety is less than 96.0%, the tested melon variety and the standard melon variety are different varieties.
[0044] The standard melon varieties described in the present invention refer to known melon varieties, such as the 104 melon varieties recorded in Table 2 of the present invention.
[0045] In the method for constructing a fingerprint database of test melon varieties of the above-mentioned scheme five or the method for identifying the test melon varieties of the above-mentioned scheme six, as an implementable method, in step S1-2 or S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, and the system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water is used to make up the system to 20 μL.
[0046] In the method for constructing a fingerprint database of test melon varieties of the above-mentioned scheme five or the method for identifying the test melon varieties of the above-mentioned scheme six, as an implementable embodiment, in step S1-2 or S2-2, the reaction system for the adapter ligation is 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina Trueseq universal adapter sequence, and ultrapure water is added to 20 μL.
[0047] In the method for constructing a fingerprint database of test melon varieties of the above-mentioned scheme five or the method for identifying the test melon varieties of the above-mentioned scheme six, as an implementable embodiment, in step S1-3 or S2-3, the hybridization system is 2.5 μg of the concentrated DNA library obtained in step S2-2, 4 μL of a probe working solution with a concentration of 50 ng / μL, and ultrapure water is added to the system to 16 μL.
[0048] Beneficial effects of the present invention:
[0049] (1) The single nucleotide polymorphism variation site combination provided by the present invention has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers, and convenience for statistics, and can accurately reflect the genetic relationship of the tested melon varieties to the greatest extent possible.
[0050] (2) The material background of the single nucleotide polymorphism variation site combination involved in the liquid-phase breeding chip of the present invention covers a wider range of melon varieties, with high representativeness and rich diversity information.
[0051] (3) The 4K liquid-phase breeding chip provided by the present invention can be applied to authenticity identification, kinship identification, hybrid breeding, and fingerprint map construction of melon varieties, which is conducive to accelerating the progress of melon research and breeding.
[0052] (4) The present invention provides for the first time a method for constructing a DNA fingerprint database for identifying the authenticity of melon varieties based on high-throughput sequencing. This method can be used to conduct early identification of melon varieties at the seed or seedling stage, ensure the authenticity of the varieties, effectively protect the rights and interests of producers and breeders, and provide technical support for the protection of melon germplasm resources and new varieties.
[0053] (5) The method for identifying melon varieties provided by the present invention can be used to identify unknown melon varieties as well as to identify the authenticity of known varieties.
[0054] (6) The method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, saving manpower and material resources, etc., and has a very broad application prospect. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] Figure 1 This is a distribution map of the single nucleotide polymorphism variation sites of the 4K liquid-phase breeding chip of the present invention on the melon genome.
[0056] Figure 2 It is the genotype deletion rate of the 4K liquid-phase breeding chip of the present invention in 104 representative melon varieties.
[0057] Figure 3 : MAF value of the genotype of the 4K liquid-phase breeding chip of the present invention in 104 representative melon varieties.
[0058] Figure 4 This is a gene mapping map of the melon peel mottled trait of single nucleotide polymorphism variation sites on the 4K liquid-phase breeding chip of the present invention.
[0059] Figure 5 This is a distribution diagram of the background recovery rate of 125 individual plants in the BC2F1 population using the 4K liquid phase chip of the present invention. DETAILED DESCRIPTION
[0060] The following examples and figures are provided to facilitate a better understanding of the present invention. They are intended to explain certain aspects or features of the present invention in detail, but are not intended to limit the present invention.
[0061] Unless otherwise defined, technical and scientific terms used herein have the same meanings as commonly used in the art.
[0062] Without departing from the spirit or scope of the present invention, improvements made to the embodiments of the present invention or extensions of technical applications shall fall within the scope of protection of the present invention.
[0063] The experimental methods in the following examples are all conventional methods unless otherwise specified. For liquid phase chip application methods not described in detail in the specification, please refer to (Targeted Genotyping by Sequencing (GBTS) Technology and Its Applications, 2020).
[0064] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0065] Example 1: Acquisition of Single Nucleotide Polymorphism Variation Sites from the Melon Whole Genome 4K Liquid Phase Breeding Chip
[0066] The present invention is based on the 149 melon resequencing data and "DHL92 V4.0" reference genome information disclosed in the vegetable whole genome single nucleotide polymorphism variation big data platform VegSNP DB (www.vegsnp db.cn), to screen high-quality single nucleotide polymorphism variation sites that can represent the genetic information of the whole genome and are suitable for targeted sequencing. Specifically, the single nucleotide polymorphism screening criteria are as follows: minimum allele frequency MAF>0.05, genotype heterozygosity <0.1, genotype deletion rate <0.1, and no other single nucleotide polymorphisms, SSRs, Indels and other variations within 50bp on both sides of the single nucleotide polymorphism. Finally, the inventors of the present invention screened out 4002 single nucleotide polymorphism variation sites that are evenly distributed throughout the melon genome, which are used for the melon 4K liquid phase breeding chip with a high polymorphism information content (PIC value). The positions and variant bases of these 4002 single nucleotide polymorphism variation sites on the melon chromosomes are shown in Table 1, and their distribution on the 12 chromosomes of melon is shown in Table 1. Figure 1 The base types and physical locations of the above-mentioned single nucleotide polymorphism variant sites on the chromosome were determined based on the melon reference genome "DHL92 V4.0" version (http: / / http: / / cucurbitgenomics.org / v2 / ftp / genome / melon / DHL92 / v4.0 / DHL92_genome_v4.fa.gz).
[0067] The single nucleotide polymorphism variation sites involved in the melon 4K breeding liquid phase chip are evenly distributed on the chromosome, with an average physical distance of 89.46kb between each site, and 58.35% of the variation sites are located in the gene exon region.
[0068] Table 1. Chromosome location and base information of 4002 single nucleotide polymorphisms
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087] Note: In the SNP variation site information, the data on the left of “_” is the chromosome where the SNP variation site is located, the middle value is the physical position of the chromosome where the SNP variation site is located, and the data on the right of “_” is the two genotypes of the SNP variation site, where “-” in the two genotypes indicates base deletion.
[0088] Example 2: Preparation of probes for the melon 4K liquid-phase breeding chip
[0089] The melon 4K liquid-phase breeding chip includes 4002 probe combinations, each of which hybridizes to a single nucleotide polymorphism variant site to form a double strand. Based on the principle of complementary base pairing, oligonucleotide probes are designed to complement the target sequence. The probe combination design principles are as follows:
[0090] (1) The average probe length is 160 bp, the SNP variant site is located in the middle of the probe, and the probe sequence length ranges from 109 to 214 bp;
[0091] (2) The region where the probe is located is relatively conservative (no other variations in the 50 bp on both sides), avoiding areas with repetitive sequences and structural variations;
[0092] (3) The GC content of the probe is 40%-60%, with a stronger capture ability in the 50% region, avoiding high GC and high AT regions.
[0093] The unknown information of the 4002 probes in the melon 4K liquid-phase breeding array is shown in Table 2.
[0094] The probe sequences in Table 2 were synthesized from single-stranded nucleotides, with lengths ranging from 109 bp to 214 bp, with an average of 159.4 bp, and polystyrene microspheres modified with a biotin group at the 5' end and covalently coupled to biotin.
[0095] Table 2 Probe position information of melon 4K liquid phase breeding chip
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114] Note: In the SNP variation site information, the leftmost data is the chromosome where the SNP variation site is located, the middle value is the starting position on the chromosome where the probe is located, and the rightmost data is the ending position on the chromosome where the probe is located.
[0115] Example 3: Evaluation of the genotype detection efficiency of the melon 4K liquid-phase breeding chip
[0116] A melon whole-genome 4K liquid-phase breeding chip involves single nucleotide polymorphism (SNP) variation sites listed in Table 1 of Example 1, and includes the probe combination of Example 2. The 4002 SNP variation sites correspond to 4002 probes, each of which hybridizes with a SNP variation site to form a double strand.
[0117] In order to evaluate the genotype capture efficiency of 4002 single nucleotide polymorphism variation sites, single nucleotide polymorphism genotyping was performed on 104 melon hybrids collected from China using the melon 4K liquid phase breeding chip of the present invention.
[0118] The basic information of the 104 test melon varieties in this example is shown in Table 3. The 104 test melon varieties are all excellent varieties commonly used in production or some varieties introduced from abroad.
[0119] Table 3. Information on 104 melon varieties
[0120]
[0121]
[0122] The experimental method for detecting melon 4K liquid-phase breeding chips includes the following steps: obtaining genomic DNA, library construction, hybridization capture, sequencing, and data analysis.
[0123] 1. Obtaining genomic DNA of test melon varieties
[0124] The genomic DNA of the test melon varieties was obtained by extracting genomic DNA from leaves of 104 test melon varieties using the CTAB method.
[0125] The quality and concentration of the genomic DNA of the test melon varieties must meet the PCR requirements. The standards are: 1% agarose electrophoresis shows a single DNA band without obvious diffusion; the A260 / A280 value detected by the UV spectrophotometer Nanodrop2000 (Thermo) is between 1.8-2.1 (indicating that the genomic DNA of the test melon varieties is free of protein contamination); the A260 / A230 value is between 1.8-2.1 (indicating that the salt ion concentration of the genomic DNA of the test melon varieties is low); the concentration of the genomic DNA of the test melon varieties is >50ng / μL.
[0126] 2. Library construction
[0127] Take 300 ng of DNA that has passed quality control, add 2.6 μL of fragmentation and end-repair enzyme, 4 μL of end-repair reaction buffer, and make up the volume to 20 μL with ultrapure water. Then, treat at 37°C for 30 minutes and 72°C for 30 minutes. After DNA is fragmented and repaired by the end-repair enzyme, an A is added to the 3' end.
[0128] Use 10 ng of the repaired DNA from the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of the Illumina TrueSeq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and ultrapure water to make up to 20 μL. Incubate at 22°C for 60 min. Ligate the A-added DNA fragments to the adapters. Use PCR amplification to connect the index and sequencer-compatible sequences to the ends of the adapter-containing DNA fragments to form a complete library structure. Add purification magnetic beads and pipette or vortex to mix thoroughly to purify the library and select fragments. Mix equal amounts of the purified and selected fragments to form a mixed library.
[0129] 3. Hybridization capture
[0130] Concentrate the mixed library to a dry powder and then add it to the hybridization system for hybridization capture. Add 2.5 μg of the concentrated library to 4 μL of 50 ng / μL probe working solution, and bring the system up to 16 μL with ultrapure water. Incubate at 95°C for 10 minutes and then at 65°C for 2-4 hours. After hybridization, transfer 16 μL of the hybridization capture solution to the prepared magnetic beads. Purify the enriched product to complete the sequencing library preparation.
[0131] 4. Sequencing and Data Analysis
[0132] Equal amounts of the purified products were mixed to generate sequencing libraries, which were then sequenced using a BGI T7 sequencer. The raw sequencing bases were split according to the barcodes of the different samples, and low-quality sequencing data were filtered. The data were then aligned with the melon reference genome ("DHL92 V4.0") to mine single nucleotide polymorphism (SNP) variation information. Based on this SNP variation information, the corresponding SNP genotypes were derived, thereby constructing fingerprints for the test varieties.
[0133] 5. Efficiency evaluation
[0134] After testing 104 melon samples, the genotype data detection rate of the melon 4K liquid phase breeding chip averaged 98.75% ( Figure 2 By counting the minimum allele frequencies (MAF) of 4002 single nucleotide polymorphism variants, 97.7% of the single nucleotide polymorphism variant sites had MAF values greater than 0.05, and the average MAF value was 0.35 ( Figure 3), indicating that the melon 4K liquid-phase breeding chip developed by the present invention has high polymorphism in 104 melon test varieties.
[0135] Example 4: Application of the 4K Liquid Microarray in Localizing the Gene for the Peel Variegation Trait in Melon
[0136] By investigating the peel phenotypic data of 104 melon varieties and combining them with 4K liquid phase array genotyping data for genome-wide association analysis, the gene controlling the melon peel piebald trait was located between 25,621,981 and 25,806,448 on chromosome 2 ( Figure 4 ), a key gene regulating chlorophyll synthesis, ARR5 (MELO3C017128, two-component response regulator), is located in this region. In research on melon peel mottle, Lü Jianchun's results indicate that peel mottle and non-peel mottle traits are controlled by a single gene, CmSP-1, located at the end of chromosome 2, 22,160,000-26,180,000 bp, with a total length of 3.94 Mb (Lü Jianchun, Genetic Analysis and Gene Mapping of Peel Mottle in Thin-Skinned Melon, Dissertation of the Chinese Academy of Agricultural Sciences, 2018). This is consistent with the results of Lü Jianchun's published article, demonstrating the accuracy of this liquid phase microarray in genetic map construction and QTL localization for important agronomic traits of peel mottle.
[0137] Example 5: Method for Detecting Whether a Tested Muskmelon Variety Belongs to a Certain Variety Among 104 Tested Muskmelon Varieties
[0138] 1. Obtaining genomic DNA of the melon varieties to be tested
[0139] The leaves of the melon variety “Jingyu Huapicui” to be tested were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.
[0140] According to the method of step 1 in Example 3, the genomic DNA of the melon variety to be tested was obtained by replacing the "leaves of the test melon variety" with the "leaves of the melon variety to be tested" and keeping the other steps unchanged.
[0141] 2. Preparation of Sequencing Library
[0142] According to the method of step 2 in Example 3, the "genomic DNA of the test melon variety" was replaced with the "genomic DNA of the melon variety to be tested", and the other steps remained unchanged to obtain the sequencing library of the melon variety to be tested.
[0143] 3. Hybridization capture
[0144] Proceed according to the method of step 3 in Example 3.
[0145] 4. Sequencing
[0146] Take the sequencing library of the melon variety to be tested and sequence it.
[0147] The sequencing results of 4002 single nucleotide polymorphism amplification products of the tested melon varieties in the melon 4K liquid phase breeding array were compared with the 4002 single nucleotide polymorphism variation sites of 104 tested melon varieties (shown in Table 3), and the site similarity LS between the two melon varieties was calculated, where:
[0148] The LS calculation formula is: LS = (1-D / T) × 100%, where D is the number of differential sites between the two samples being compared, and T is the total number of sites being compared. The following judgment is then made:
[0149] If the site similarity between the tested melon variety and a standard melon variety (test melon variety) is ≥98.0%, the tested melon variety and the standard melon variety are suspected to be the same variety; the fewer the number of different sites, the higher the site similarity;
[0150] If the site similarity between the tested melon variety and a certain standard melon variety (test melon variety) is between 96.0% and 98.0% and does not include 98%, the tested melon variety and the standard melon variety are similar varieties.
[0151] If the site similarity between the tested melon variety and a certain standard melon variety is less than 96.0%, the tested melon variety and the standard melon variety are different varieties.
[0152] The results showed that the genetic similarity between the tested melon variety and the 104 tested melon varieties at 4002 single nucleotide polymorphism variation sites was 91%. Therefore, the tested melon variety did not belong to any of the 104 tested melon varieties, that is, the tested melon variety "Jingyu Huapicui" was different from any of the 104 tested melon varieties.
[0153] Example 6: Construction of a DNA fingerprint database of 104 muskmelon varieties
[0154] The melon 4K liquid-phase breeding chip developed by the present invention can be used to construct a DNA fingerprint database of 104 melon varieties, establishing a unique DNA fingerprint molecular identity card for each variety resource.
[0155] Based on the 4002 nucleotide variation information in Example 1 and the 104 test melon varieties in Implementation Case 3, the method of Example 3 can be used to quickly construct a DNA fingerprint database of 104 melon varieties, providing data support for whether newly collected variety resources will be introduced into the DNA fingerprint database in the future.
[0156] Example 7: Screening for Individual Plants with Rapid Recovery Background in Backcross Breeding
[0157] The melon 4K liquid-phase breeding chip developed in the present invention can be used to identify and quickly determine the genomic percentages of the donor and recipient of each individual plant in backcross breeding progeny, providing data support for screening backcross progeny with a high background recovery rate.
[0158] Based on the 4002 nucleotide variation information in Example 1, 125 individuals of the BC2F1 population constructed by the donor parent TZ1126 and the recurrent parent TZ83 were identified at the seedling stage. 2565 SNP variations that differed between the donor parent and the recurrent parent were screened, and the proportion of the 125 individuals that were consistent with the recurrent parent genotype was calculated. The recurrent parent genotype accounted for 96% as the selection criterion for restoring the recurrent parent background. Finally, 4 individuals were selected (see Figure 5 ), and its field phenotype has no significant difference from that of the recurrent parent, which significantly improves the identification efficiency and saves field planting costs.
Claims
1. A probe combination for detecting single nucleotide polymorphism variation site combinations in the whole melon genome, wherein each single nucleotide polymorphism variation site corresponds to a probe, and the single nucleotide polymorphism variation site combination includes 4,002 single nucleotide polymorphism variation sites. The positions and base types of the 4,002 single nucleotide polymorphism variation sites in the genome are shown in the following table, wherein: The number on the left indicates the chromosome number where the single nucleotide polymorphism variation site is located, the number in the middle indicates the physical position of the chromosome where the single nucleotide polymorphism variation site is located, and the letters on the right indicate the two base types of the single nucleotide polymorphism variation site: The locations of the 4,002 single nucleotide polymorphism variation sites in the genome were determined based on the melon reference genome version "DHL92 V4.0".
2. The probe combination for detecting single nucleotide polymorphism variation site combinations in the whole melon genome according to claim 1, characterized in that: The corresponding positions of the nucleotide sequences of the probes in the probe combination in the genome are shown in the table below. The information of the corresponding position of each probe contains three data. From left to right, the first data represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data represents the starting position of the probe on the chromosome, and the third data represents the ending position of the probe on the chromosome: The corresponding positions are determined based on the melon reference genome "DHL92 V4.0" version.
3. A melon whole genome 4K liquid phase breeding chip, characterized in that: The invention comprises the probe combination for detecting the single nucleotide polymorphism variation site combination of the whole melon genome as described in claim 1 or 2.
4. A use of a probe combination, characterized in that, The probe combination is the probe combination for detecting single nucleotide polymorphism variation site combinations in the whole genome of melon according to claim 1 or 2, and the use includes any one of the following (1) to (7): (1) A kit for preparing a method for identifying muskmelon varieties; (2) A kit for preparing a kit for identifying the authenticity of melon varieties; (3) a kit for preparing a method for analyzing the genetic relationship of melon varieties; (4) Used to identify melon varieties; (5) Used to identify the authenticity of melon varieties; (6) Used to analyze the genetic relationship of melon varieties; (7) Used to construct a fingerprint database of the melon varieties to be tested.
5. A use of a melon whole genome 4K liquid phase breeding chip, characterized in that: The melon whole genome 4K liquid phase breeding chip is the melon whole genome 4K liquid phase breeding chip according to claim 3, and the uses include the following (A) to (D) any of the following: (A) Used to identify melon varieties; (B) Used to identify the authenticity of melon varieties; (C) Used to analyze the genetic relationship of melon varieties; (D) Used to construct a fingerprint database of the melon varieties to be tested.
6. A method for constructing a fingerprint database of test melon varieties, characterized in that: The steps include: S1-1: Obtaining genomic DNA of the tested melon varieties; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: combining the DNA library with the probe combination for detecting single nucleotide polymorphism variation sites in the whole genome of melon according to claim 1 or 2 to form a hybridization system and performing hybridization capture, and obtaining a sequencing library after purification; S1-4: Sequencing the sequencing library and performing data analysis to obtain the genotyping information of the 4,002 single nucleotide polymorphism variation sites described in claim 1, and constructing a fingerprint database of the test melon varieties based on the genotyping information of the 4,002 single nucleotide polymorphism variation sites.
7. A method for identifying a melon variety to be tested, characterized in that: The steps include: S2-1: Obtaining genomic DNA of the test melon variety and the standard melon variety respectively; S2-2: The genomic DNA of each species obtained in step S2-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library of the corresponding species; S2-3: The DNA library of each variety is respectively combined with the probe combination for detecting the single nucleotide polymorphism variation site combination of the whole melon genome according to claim 1 or 2 to form a hybridization system and perform hybridization capture, and the sequencing library of each variety is obtained after purification; S2-4: Sequencing the sequencing libraries of each variety and performing data analysis to obtain genotyping information of the 4,002 single nucleotide polymorphism variant sites described in the table of claim 1 in each variety; S2-5: The genotyping results of the 4,002 SNP variant sites of the test melon variety are compared with the genotyping results of the 4,002 SNP variant sites of the standard melon variety, and the similarity LS of the SNP variant sites of the two melon varieties is calculated. The LS is calculated as follows: LS = (1-D / T) × 100%, where D is the number of SNP variant sites that differ between the two varieties, and T is the total number of SNP variant sites compared. Then, the following judgment is made: If the site similarity between the tested melon variety and a certain standard melon variety is greater than or equal to 98.0%, the tested melon variety and the standard melon variety are the same variety; If the site similarity between the tested melon variety and a standard melon variety is between 96.0% and 98.0% but does not include 98%, the tested melon variety and the standard melon variety are similar varieties; If the site similarity between the tested melon variety and a certain standard melon variety is less than 96.0%, the tested melon variety and the standard melon variety are different varieties.
8. The method for identifying the melon variety to be tested according to claim 7, wherein: In step S2-2, the fragmentation and end repair are completed by a system containing fragmentation and end repair enzymes, which includes: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to make up the system to 20 μL.
9. The method for identifying a tomato variety according to claim 7, wherein: In step S2-2, the reaction system for the adapter ligation is 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina Trueseq universal adapter sequence, and ultrapure water to 20 μL.
10. The method for identifying tomato varieties according to claim 7, characterized in that: In step S2-3, the hybridization system is 2.5 μg of the concentrated DNA library obtained in step S2-2, 4 μL of a probe working solution with a concentration of 50 ng / μL, and ultrapure water is added to make up the system to 16 μL.
Citation Information
Patent Citations
Method for identifying authenticity of melon varieties and special SSR primer combinations of method
CN110331226A
Melon SNP site marker combination, SNP site marker detection probe combination, liquid phase chip and application
CN117210596A
Melon liquid phase chip and application thereof
CN118421817A