Construction of human liver organoid and fatty liver organoid models
The liver organoid model constructed by co-culturing multiple cells solves the problem of lack of effective models for NAFLD in existing technologies, provides effective support for drug screening and toxicity assessment, and is closer to the human environment, making it suitable for drug development and mechanism research.
Patent Information
- Application Number
- CN202410315715.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-19
- Publication Date
- 2025-09-19
AI Technical Summary
Existing non-alcoholic fatty liver disease (NAFLD) lacks effective in vitro models and drugs, and existing liver organoid models cannot effectively simulate the cell-to-cell ratios and drug responses during the disease process.
By co-culturing human hepatic stellate cells, human hepatic parenchymal cells, and human hepatic non-parenchymal cells without hepatic stellate cells in accordance with in vivo proportions, a 3D human liver organoid microsphere model was constructed, and then induced in fatty liver induction medium to form a non-alcoholic fatty liver organoid model.
The constructed liver organoid model is closer to the human environment, can effectively simulate the disease process, support drug screening and toxicity assessment, and has a short culture time, making it suitable for drug development and mechanism research.
Smart Images

Figure CN120665798A_ABST
Abstract
Description
[0001] Technology
[0002] The present invention relates to the field of biomedicine technology, and in particular to the construction of human liver organoids and fatty liver organoid models. Background Art
[0003] Non-alcoholic fatty liver disease (NAFLD) is a common chronic liver disease affecting at least 25% of the global population. NAFLD can be diagnosed through imaging or liver biopsy assessment. Patients have at least 5% of their hepatocytes infiltrated with steatosis, consume little or no alcohol, and have no secondary causes of hepatic steatosis, such as other metabolic liver diseases (e.g., Wilson's disease, congenital or acquired lipodystrophy) or medications (e.g., amiodarone, steroids, tamoxifen, valproic acid, etc.). NAFLD can be broadly divided into non-alcoholic fatty liver disease (NAFL) and non-alcoholic steatohepatitis (NASH). The NAFLD stage can further progress to liver fibrosis, cirrhosis, and liver cancer. However, there are no effective treatments for all stages of NAFLD. Key factors contributing to the lack of effective in vitro human NAFLD models and the complexity of NAFLD pathogenesis.
[0004] Organoid technology is a revolutionary innovation. It allows researchers to understand the body's direct response to drugs without the risk of toxicity. Therefore, developing a suitable liver organoid system could be a crucial aid in drug development and mechanistic research for NAFLD.
[0005] Since 2013, Hans Clever et al. have established a method for generating mouse liver organoids. The construction of liver organoids has gradually developed. There are liver organoids that are formed by inducing differentiation from pluripotent stem cells and proliferating through passage. There are also liver microsphere organoids constructed using primary hepatocytes. Furthermore, primary fetal hepatocytes have been used to achieve gene editing with fatty degeneration characteristics while maintaining a passaged organoid model. However, these organoid models are all composed of a single cell, which cannot well reflect the ratio between cells during the disease process and can only explore drugs that target hepatocytes. Summary of the Invention
[0006] In light of this, the present invention aims to develop a technology for co-culturing multiple cell types to form liver organoids and a non-alcoholic fatty liver disease model. This multi-cell co-culture liver organoid model system is of great value in target discovery, drug screening, and drug toxicity assessment for non-alcoholic liver disease.
[0007] In a first aspect, the present invention provides a method for constructing a human liver organoid, the method comprising the following steps:
[0008] Human hepatic stellate cells, human hepatic parenchymal cells, and human hepatic non-parenchymal cells without hepatic stellate cells were cultured according to the in vivo proportion of liver cells to obtain a 3D human liver organoid microsphere model.
[0009] In some embodiments, human hepatic stellate cells are added separately, i.e., human hepatic stellate cells are extracted and purified by a specific method, and then the purified human hepatic stellate cells are mixed and incubated with other cells, rather than mixing the human hepatic stellate cells with non-parenchymal liver cells. In some embodiments, the human hepatic stellate cells are derived from a donor with fatty liver.
[0010] In some embodiments, the ratio of the number of human hepatic parenchymal cells: human hepatic stellate cells: human hepatic non-parenchymal cells excluding hepatic stellate cells is 10:1-5:1-5.
[0011] In some embodiments, the total number of human hepatic parenchymal cells, human hepatic stellate cells, and human hepatic non-parenchymal cells excluding hepatic stellate cells is 3,000-10,000 cells.
[0012] In some embodiments, the culture is performed in a plating medium containing fetal bovine serum. In some embodiments, the culture is performed in a 96-well ultra-low attachment culture plate; preferably, the plating medium comprises: fetal bovine serum, basal medium, dexamethasone, insulin-transferrin-selenium, HEPES, and double antibody (P / S).
[0013] In some embodiments, the method further comprises, after forming the human liver organoid microsphere model, using a maintenance medium for half-medium change to maintain the culture of the human liver organoid; preferably, the maintenance medium is a plating medium that does not contain fetal bovine serum, and the maintenance medium comprises: basal culture medium, dexamethasone, insulin-transferrin-selenium, HEPES, and double antibody (P / S).
[0014] In some embodiments, the culture is performed on the plating medium for 70-170 hours, preferably 5 days; and on the maintenance medium for 20-60 hours, preferably 2 days.
[0015] In some embodiments, the human hepatic stellate cells and the human hepatic non-parenchymal cells not containing hepatic stellate cells are derived from a fatty liver donor, preferably a non-alcoholic fatty liver donor.
[0016] In some embodiments, the 3D human liver organoid microsphere model is a microsphere without a carrier scaffold formed by cell focused self-assembly.
[0017] In some embodiments, a method for constructing a human liver organoid comprises the following steps:
[0018] Human hepatic stellate cells were digested and prepared into a cell suspension;
[0019] Resuscitated hepatic parenchymal cells and human hepatic non-parenchymal cells without stellate cells were prepared into cell suspensions;
[0020] Primary human hepatocytes, hepatic stellate cells, and non-hepatic cells were cultured in the same proportion as in vivo liver cells in the culture medium and placed in a humidified atmosphere at 37°C and 5% CO. 2 Culture in an incubator for 5 days to form 3D liver organoid microspheres;
[0021] After approximately 5 days of organoid formation, the liver organoids were maintained by performing a half-medium change of the maintenance medium.
[0022] In a second aspect, the present invention provides a human liver organoid constructed by using the method of the first aspect.
[0023] In a third aspect, the present invention provides a method for constructing a human fatty liver organoid model, the method comprising:
[0024] The human liver organoid constructed by the method of the first aspect or the human liver organoid of the second aspect is cultured in a fatty liver induction medium to obtain a fatty liver organoid model.
[0025] In some embodiments, the human hepatic stellate cells and the human hepatic non-parenchymal cells not containing hepatic stellate cells are derived from a fatty liver donor, preferably a non-alcoholic fatty liver donor.
[0026] In some embodiments, the fatty liver induction medium is a maintenance medium containing a fatty liver inducer; preferably, the fatty liver inducer is a non-alcoholic fatty liver inducer; more preferably, the non-alcoholic fatty liver inducer is selected from NASH Cocktail YZ-NASH. The fatty liver induction medium simulates factors inducing unhealthy lifestyles, such as excessive intake of high-sugar and high-fat foods and induced intestinal flora disturbances. By adding a non-alcoholic fatty liver inducer, the fatty liver induction medium simulates the in vivo environment of patients with non-alcoholic steatohepatitis, who consume excessive high-sugar and high-fat foods and induced intestinal flora disturbances.
[0027] In some embodiments, a non-alcoholic fatty liver disease inducer (NASH Cocktail YZ-NASH) is used for half-fluid exchange, preferably on the seventh, ninth, and twelfth days.
[0028] In some embodiments, the culture is carried out on the induction medium for 20-170 hours, preferably 7 days.
[0029] In a fourth aspect, the present invention provides a human fatty liver organoid model, which is constructed by using the method of the third aspect; preferably, the human fatty liver organoid model is a human non-alcoholic fatty liver organoid model.
[0030] In a fifth aspect, the present invention provides a method for evaluating a test substance, comprising: contacting a human liver organoid constructed by the method of the first aspect, a human liver organoid model constructed by the method of the second aspect, a human fatty liver organoid model constructed by the method of the third aspect, or a human fatty liver organoid model of the fourth aspect with the test substance, and evaluating the metabolically activated liver organoid response.
[0031] In a sixth aspect, the present invention provides a method for evaluating the efficacy of clinical drugs for fatty liver, the method comprising: contacting the human liver organoid constructed by the method of the first aspect, the human liver organoid model constructed by the method of the second aspect, the human fatty liver organoid model constructed by the method of the third aspect, or the human fatty liver organoid model of the fourth aspect with the clinical drug for fatty liver, and evaluating the lipid degeneration, inflammation and fibrosis levels of the liver organoids.
[0032] In some embodiments, the clinical drug is selected from Firsocostat (acetyl-CoA carboxylase (ACC) inhibitor), Cilofexor (non-steroidal farnesoid X receptor (FXR) agonist), and PF-06424439 (imidazopyridine diacylglycerol acyltransferase 2 (DGAT2) inhibitor).
[0033] In some embodiments, the evaluation method comprises incubating the human non-alcoholic fatty liver organoid model with a clinical drug, performing half-medium changes on days 14, 16, and 19, and evaluating the levels of lipid degeneration, inflammation, and fibrosis in the liver organoids on day 21.
[0034] The liver organoid construction method of the present invention has the following advantages:
[0035] 1) The method for constructing liver organoids of the present invention first mixes and cultures multiple primary liver cells, especially human hepatic stellate cells, without using any auxiliary materials such as scaffolds. These cells self-assemble to form scaffold-free microspheres to induce disease models. Disease organoid models can be used for clinical drug screening and development.
[0036] 2) In the construction method of the present invention, various cells are mixed in specific proportions, so that the organoids formed are closer to the human body environment.
[0037] 3) The organoid construction time of the present invention is short, and compact scaffold-free microspheres can be obtained in only 3-7 days.
[0038] 4) This method allows for long-term liver organoid culture. The entire process involves 7 days of organoid model construction (24-48 hours is also possible), 7 days of fatty liver disease model construction, and 7 days of drug treatment. The culture period can be up to 21 days, which facilitates downstream clients in predicting the effects of non-alcoholic fatty liver disease drug treatments and exploring drug targets and mechanisms of action.
[0039] 5) The cells used to construct organoids include primary hepatic parenchymal cells, hepatic stellate cells, and human liver non-parenchymal cells. Among them, human liver non-parenchymal cells contain Kupffer cells, endothelial cells, etc., which are not cells differentiated from iPSCs and have stronger physiological relevance.
[0040] 6) The present invention uses hepatic stellate cells and non-parenchymal liver cells from non-alcoholic fatty liver disease donors and adds non-parenchymal liver cells without stellate cells to construct organoids, and then conducts tests after modeling non-alcoholic fatty liver disease. It was found that the disease model induced by adding hepatic stellate cells from non-alcoholic fatty liver disease donors and non-parenchymal liver cells without stellate cells is closer to the actual situation of disease onset.
[0041] 7) The present invention uses 96-well plates to construct organoids, with a single microsphere formed in a single well. The number of cells in each well is fixed, which is more conducive to downstream users to conduct quantitative experiments; while the existing technology uses 6-well plates to construct organoids, with multiple microspheres formed in a single well.
[0042] 8) The entire culture process is a serum-free culture system with clear and controllable ingredients, little batch-to-batch variation, and a low risk of contamination by pathogenic microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS
[0043] In order to make the content of this application easier to understand, the following further describes this application in detail based on the specific embodiments of this application and in conjunction with the accompanying drawings, wherein:
[0044] Figure 1 The method and process of constructing human liver organoids and human non-alcoholic fatty liver organoid models are shown.
[0045] Figure 2 The characteristics of organoids during culture day 1-21 are shown, where A is the tissue structure on culture day 21, B is the size of the organoid, and C is the expression of albumin and protein secretion levels.
[0046] Figure 3 The cell types in the organoids are shown, where A is the immunofluorescence result, which includes hepatocytes (HNF4A+), hepatic stellate cells (VIM+), and Kupffer cells (CD68+); B is the expression of liver parenchymal marker HNF4A, endothelial cell marker PECAM1, Kupffer cell markers CD11b and CD68, and hepatic stellate cell markers VIM and NGFR.
[0047] Figure 4 The lipid profile of the non-alcoholic fatty liver organoid model is shown, where A is lipid droplet staining of the NASH model and B is lipid droplet quantification.
[0048] Figure 5 The expression of genes related to inflammation, fibrosis, and metabolism in the NASH model is shown. A is the KEGG gene pathway enrichment result after sequencing analysis of the NASH model, B is a heat map of genes related to inflammation, fibrosis, and metabolism, and the real-time fluorescence quantitative PCR results of genes related to metabolism (C), fibrosis (D), and inflammation (E).
[0049] Figure 6 The lipid droplet staining and quantification of clinical trial drugs are shown, wherein A is the lipid droplet staining of several clinical trial drugs, Firsocostat, Cilofexor, and PF-06424439, and B is the lipid droplet quantification.
[0050] Figure 7 Shown are the KEGG gene pathway enrichment results after Firsocostat sequencing analysis.
[0051] Figure 8 Shown are the KEGG gene pathway enrichment results after Cilofexor sequencing analysis.
[0052] Figure 9 Shown are the KEGG gene pathway enrichment results after PF-06424439 sequencing analysis.
[0053] Figure 10 The effect of different treatment regimens on the expression level of ALB, a liver parenchymal function marker, is shown.
[0054] Figure 11 Shown are the effects of different regimens on the expression level of inflammatory marker IL6. DETAILED DESCRIPTION
[0055] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. Table 1 below lists some of the reagents used in the examples, and Table 3 lists the primer sequences used in the examples.
[0056] Table 1: Reagents and their sources
[0057]
[0058] Example 1: Construction of human liver organoids, construction of human fatty liver organoid model and drug efficacy evaluation Phase 1: According to Figure 1Stage 1 of the method shown is to mix and plate various primary liver cells (Day 0)
[0059] 1. Isolate and purify human hepatic stellate cells and non-parenchymal liver cells from livers with non-alcoholic steatohepatitis according to the method described in Liu et al., STAR Protocols 4, “Isolation of primary human liver cells from normal and nonalcoholic steatohepatitis livers” (https: / / www.sciencedirect.com / science / article / pii / S2666166723003581?via%3Dihub) on September 25, 2023. Isolate hepatic parenchymal cells from normal livers and cryopreserve the isolated cells.
[0060] 2. Use YZ-HSC-M medium to resuscitate human hepatic non-parenchymal cells that do not contain hepatic stellate cells. Proceed to conventional cell culture with the isolated and purified human hepatic stellate cells using YZ-HSC-M medium. Once the cell density reaches 80-90%, digest the human hepatic stellate cells with 0.25% trypsin to prepare a homogenous cell suspension. Centrifuge at 500g for 5 minutes, discard the supernatant, resuspend in plating medium, count, calculate the cell density, and set aside.
[0061] 3. Use YZ-NPC-M medium to resuscitate human liver non-parenchymal cells without hepatic stellate cells and prepare a uniform cell suspension. Centrifuge at 500g for 5 minutes, discard the supernatant, resuspend in plating medium, count, calculate the cell density, and set aside.
[0062] 4. Use YZ-HEP-M medium to resuscitate human hepatocytes and prepare a uniform cell suspension. Perform gradient separation with 30% Percoll cell separation medium, 100g, 10 minutes of 9-fold increase and 0-fold decrease. After washing once with plating medium, calculate the cell viability using trypan blue and obtain a hepatocyte viability of more than 90%. Calculate the cell density and set aside.
[0063] 5. The cells obtained in steps 1-4 above are mixed according to a human liver parenchymal cells: human liver non-parenchymal cells without hepatic stellate cells: human hepatic stellate cells at a ratio of, for example, 6000:1200:1200, and then 3000-10000 cells are plated in each well of a 96-well ultra-low adsorption round-bottom plate with a total of 200 ul. The culture medium in the round-bottom plate is 3D plating medium (3D plating medium = 3D maintenance medium + 10% fetal bovine serum. The components of 3D maintenance medium: basal culture medium, dexamethasone, insulin-transferrin-selenium, HEPES, double antibody (P / S)).
[0064] 6. Centrifuge the plate at 100 g for 2-10 minutes and place in a 5% 37°C constant temperature incubator.
[0065] Phase 2: Follow the Figure 1 Stage 2 of the protocol shown for organoid formation (Days 1-7)
[0066] 7. On the first day, shake the cells at 200-600 rpm for 2-10 minutes and culture in a 5% 37°C constant temperature incubator.
[0067] 8. On the second day, shake the cells at 200-600 rpm for 2-10 minutes and incubate in a 5% 37°C constant temperature incubator. Process again on the fifth day of incubation.
[0068] 9. On day 5, the microspheres will have reached their minimum diameter, indicating that the organoids have essentially formed. Perform a half-medium change with 3D Maintenance Medium (YZ-3D-MM) (components: basal medium, dexamethasone, insulin-transferrin-selenium, HEPES, and double-stranded polysaccharide (P / S)). Incubate at 5% CO at 37°C. Incubate for two days before proceeding to the next stage of treatment.
[0069] Phase 3: Follow the Figure 1 Stage 3 of the method shown is for induction of non-alcoholic fatty liver disease organoid model (Day 7-14)
[0070] 10. On days 7, 9, and 12, perform a half-medium change using a non-alcoholic fatty liver disease inducer (NASH Cocktail YZ-NASH).
[0071] Phase 4: Follow the Figure 1 Stage 4 of the method shown is for drug efficacy evaluation (Day 14-21)
[0072] Treatment with potential clinical target drugs, including Firsocostat (an acetyl-CoA carboxylase (ACC) inhibitor), Cilofexor (a nonsteroidal farnesoid X receptor (FXR) agonist), and PF-06424439 (an imidazopyridine diacylglycerol acyltransferase 2 (DGAT2) inhibitor), was performed. Half-medium changes of drug-containing NASH culture medium were performed on days 14, 16, and 19, and samples were collected and analyzed on day 21. Table 2 shows the dosages of the different drugs.
[0073] Table 2: Preparation of culture medium for efficacy evaluation of different drugs
[0074]
[0075] ImageJ was used to measure the tissue structure and size of the organoids cultured for 1-21 days, and to detect the expression and protein secretion levels of albumin during the organoid culture process. The results are as follows: Figure 2 As shown. Figure 2 As can be seen, these organoids can maintain microspheres with a diameter of 150-350 μm during culture. Long-term culture can also maintain the expression and secretion of albumin, indicating that hepatocytes cultured in these organoids over the long term can maintain normal function.
[0076] The organoids obtained on day 14 were subjected to immunofluorescence detection and marker expression level detection. The results are as follows Figure 3 As shown, HNF4A monoclonal antibody, Vimentin polyclonal antibody, Anti-CD68 antibody, Cy TM 3AffiniPure Donkey Anti-Goat IgG(H+L), Alexa 647AffiniPure F(ab')2Fragment Donkey Anti-Rabbit IgG(H+L) and Alexa 488AffiniPure Donkey Anti-Mouse IgG(H+L). Figure 3 It can be seen that the organoids have hepatocytes (HNF4A+), hepatic stellate cells (VIM+), Kupffer cells (CD68+), and this culture system contains hepatocytes, hepatic stellate cells, Kupffer cells and endothelial cells.
[0077] Lipid droplet staining (using Bodipy and DAPI) and lipid droplet quantification analysis were performed on organoids obtained on days 14 and 21. Figure 4 The primers in Table 3 were used to detect the expression of genes related to inflammation, fibrosis, metabolism, etc. The results are shown in Table 3. Figure 5 As shown. Figure 4and Figure 5 It can be seen that the non-alcoholic fatty liver organoid model constructed by the above method has obvious lipid degeneration, fibrosis, inflammation and metabolic abnormalities.
[0078] from Figure 6 It can be seen that treatment with Firsocostat, Cilofexor, and PF-06424439 significantly inhibited lipid droplet accumulation.
[0079] from Figure 7-9 It can be seen that Firsocostat and Cilofexor also have the effect of inhibiting fibrosis and inflammation, while PF-06424439 has the effect of inhibiting apoptosis.
[0080] Table 3: Primer list
[0081] Gene Primer (5'→3') HPRT Forward:CCTGGCGTCGTGATTAGTGAT Seq ID No:1 Reverse:AGACGTTCAGTCCTGTCCATAA Seq ID No:2 ALB Forward:TTTATGCCCCGGAACTCCTTT Seq ID No:3 Reverse:AGTCTCTGTTTGGCAGACGAA Seq ID No:4 CYP1A2 Forward:ACTTCTTCCCCATCCTTCGC Seq ID No:5 Reverse:CCCCTTCTTGCTGTGCTTGA Seq ID No:6 CYP3A4 Forward:ATGGAACCCATTCACATGGAC Seq ID No:7 Reverse:GCTGTTGACCATCATAAAAGCC Seq ID No:8 IL6 Forward:AATTCGGTACATCCTCGACGG Seq ID No:9 Reverse:TTGGAAGGTTCAGGTTGTTTTCT Seq ID No:10 CCL2 Forward:TGCAATCAATGCCCCAGTCA Seq ID No:11 Reverse:GGGTCAGCACAGATCTCCTT Seq ID No:12 COL1A1 Forward:AAGAGGAAGGCCAAGTCGAG Seq ID No:13 Reverse:CACACGTCTCGGTCATGGTA Seq ID No:14 CTGF Forward:ACCCGGGTTACCAATGACAA Seq ID No:15 Reverse:GTACGGATGCACTTTTTGCCC Seq ID No:16 PAI-1 Forward:ACCGCAACGTGGTTTTCTCA Seq ID No:17 Reverse:TTGAATCCCATAGCTGCTTGAAT Seq ID No:18
[0082] Example 2: Effects of different cells on the construction of human fatty liver organoid model
[0083] A human fatty liver organoid model was constructed using the method of Example 1, with the differences shown in Table 4. In Table 4, protocol a used only human hepatocytes and normal human hepatic stellate cells for model construction, protocol b used human hepatocytes and hepatic stellate cells from NASH patients for model construction, and protocol c used human hepatocytes, hepatic stellate cells from NASH patients, and non-parenchymal liver cells for model construction.
[0084] The expression levels of ALB, a liver parenchymal function marker, and IL6, an inflammatory marker, were analyzed in different protocols. Figure 10 and Figure 11 As shown. Figure 10 and Figure 11 As can be seen, only in protocol c, ALB expression remained high, and it decreased significantly after NASH. Therefore, the addition of non-parenchymal liver cells will help maintain the ability of parenchymal liver cells. Inflammation actually decreased in protocol a, while protocol c increased more significantly than protocol b. Therefore, protocol c is more suitable for NASH model construction.
[0085] Table 4: Culture protocols for different cell conditions
[0086] Plan A Plan B Plan C Human hepatocytes + + + Normal human hepatic stellate cells + - - Hepatic stellate cells in NASH patients - + + Non-parenchymal liver cells - - +
[0087] It is understood that the examples and implementations described herein are for illustrative purposes only, and that various modifications or variations thereon will be suggested to those skilled in the art and should be included within the spirit and scope of this application and the scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated in their entirety for all purposes.
Claims
1. A method for constructing human liver organoids, characterized in that: The method comprises the following steps: Human hepatic stellate cells, human hepatic parenchymal cells, and human hepatic non-parenchymal cells without hepatic stellate cells were cultured according to the in vivo proportion of liver cells to obtain a 3D human liver organoid microsphere model.
2. The method according to claim 1, characterized in that The human hepatic stellate cells were added separately.
3. The method according to claim 1 or 2, characterized in that The ratio of the number of human hepatic parenchymal cells: human hepatic stellate cells: human hepatic non-parenchymal cells excluding hepatic stellate cells is 10:1-5:1-5.
4. The method according to any one of claims 1 to 3, characterized in that The total number of the human hepatic parenchymal cells, human hepatic stellate cells and human hepatic non-parenchymal cells excluding hepatic stellate cells is 3,000-10,000 cells.
5. The method according to any one of claims 1 to 4, characterized in that The culture is carried out on a plating medium containing fetal bovine serum; preferably, the culture is carried out on a 96-well ultra-low adsorption culture plate; more preferably, the plating medium comprises: fetal bovine serum, basal culture medium, dexamethasone, insulin-transferrin-selenium, HEPES, and double antibody (P / S).
6. The method according to any one of claims 1 to 5, characterized in that The method further comprises, after forming the human liver organoid microsphere model, performing a half-medium change using a maintenance medium to maintain the culture of the human liver organoid; preferably, the maintenance medium is a plating medium that does not contain fetal bovine serum.
7. The method according to any one of claims 1 to 7, characterized in that The cells were cultured on the plating medium for 70-170 hours and on the maintenance medium for 20-60 hours.
8. The method according to any one of claims 1 to 7, characterized in that The 3D human liver organoid microsphere model is a microsphere without a carrier scaffold formed by cell focused self-assembly.
9. A human liver organoid, characterized in that The human liver organoid is constructed by using the method of any one of claims 1 to 8.
10. A method for constructing a human fatty liver organoid model, characterized in that: The method comprises: The human liver organoid constructed according to any one of claims 1 to 8 or the human liver organoid according to claim 9 is cultured in a fatty liver induction medium to obtain a fatty liver organoid model.
11. The method according to claim 10, characterized in that The human hepatic stellate cells and the human hepatic non-parenchymal cells not containing hepatic stellate cells are derived from a fatty liver donor, preferably a non-alcoholic fatty liver donor; The fatty liver induction medium is a maintenance medium containing a fatty liver inducer; preferably, the fatty liver inducer is a non-alcoholic fatty liver inducer; more preferably, the non-alcoholic fatty liver inducer is selected from NASH Cocktail YZ-NASH.
12. The method according to claim 10 or 11, characterized in that The cells were cultured on the induction medium for 20-170 hours.
13. A human fatty liver organoid model, characterized in that: The human fatty liver organoid model is constructed by using the method of any one of claims 10 to 12; preferably, the human fatty liver organoid model is a human non-alcoholic fatty liver organoid model.
14. A method for evaluating a test substance, characterized in that: The method comprises: contacting a human liver organoid constructed by the method of any one of claims 1 to 8, a human liver organoid according to claim 9, a human fatty liver organoid model constructed by the method of any one of claims 10 to 12, or a human fatty liver organoid model according to claim 13 with the test substance, and evaluating the metabolically activated liver organoid response.
15. A method for evaluating the efficacy of clinical drugs for fatty liver disease, characterized in that: The method comprises: contacting a human liver organoid constructed by the method of any one of claims 1 to 8, a human liver organoid according to claim 9, a human fatty liver organoid model constructed by the method of any one of claims 10 to 12, or a human fatty liver organoid model according to claim 13 with the clinical drug for fatty liver, and evaluating the levels of lipid degeneration, inflammation, and fibrosis in the liver organoid.