Cytochrome P450 monooxygenase gene derived from ramie, protein coded by cytochrome P450 monooxygenase gene, recombinant plasmid and application of cytochrome P450 monooxygenase gene

Abstract

The invention provides a ramie-derived cytochrome P450 monooxygenase gene, a protein coded by the ramie-derived cytochrome P450 monooxygenase gene, a recombinant plasmid and application of the ramie-derived cytochrome P450 monooxygenase gene, the sequence of a coding region of the ramie-derived cytochrome P450 monooxygenase gene is shown as SEQ ID NO: 1, and the amino acid sequence of the protein coded by the ramie-derived cytochrome P450 monooxygenase gene is shown as SEQ ID NO: 2. According to the invention, ramie is taken as a research object, and the ramie cytochrome P450 monooxygenase gene (BnMAX1) is obtained through three-generation sequencing and gene annotation comparison. A longer coding sequence of a target gene is obtained through PacBio Sequel sequencing, and the method is simple, rapid and high in operability. The gene is subjected to cloning identification, bioinformatics, expression pattern and genetic transformation analysis and the like to verify the function of the gene, which indicates that the gene has the effect of relieving plant cadmium toxicity. The acquisition and application of the gene provide basic theoretical support for molecular improvement of cadmium tolerance of ramie, and provide a new technical means for improving ecological restoration ability of ramie under the stress of heavy metal cadmium.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a cytochrome P450 monooxygenase gene derived from ramie, a protein encoded by the gene, a recombinant plasmid and applications thereof. Background Art

[0002] Cadmium is a highly toxic heavy metal. As a non-essential nutrient for plant growth and development, it is easily absorbed and accumulated by plants. Cadmium can disrupt water homeostasis, chlorophyll structure, and chlorophyll synthesis in plants, inhibiting photosynthesis and thus affecting normal plant growth.

[0003] Ramie (Boehmeria nivea (L.) Gaudich), also known as "Chinese grass," is a fiber-producing economic crop native to my country and a soil and water conservation plant in southern China. Ramie exhibits strong tolerance and accumulation of cadmium, making it an excellent plant for in situ remediation of cadmium-contaminated soils. However, current technical and fundamental research on ramie remediation of contaminated soils is relatively weak, with no substantial breakthroughs achieved. Further research into its molecular mechanisms is needed. Therefore, identifying genes associated with cadmium stress and accurately identifying their functional roles is crucial for improving ramie's cadmium tolerance and enhancing its ecological restoration capacity. Summary of the Invention

[0004] The present invention aims to provide a cytochrome P450 monooxygenase gene derived from ramie, a protein encoded by the gene, a recombinant plasmid, and applications thereof. Ramie was used as the research object, and sequencing was performed using the PacBio platform and correction was performed using the sequencing results of the Illumina platform to obtain a longer transcript. After gene annotation and comparison, the CDS sequence of the ramie BnMAX1 gene was obtained. The function of the gene was verified by cloning and identification, bioinformatics, expression pattern, and genetic transformation analysis, indicating that the gene has the effect of alleviating cadmium toxicity in plants.

[0005] The present invention solves the technical problem by adopting the following technical solutions.

[0006] The present invention provides a cytochrome P450 monooxygenase gene derived from ramie. The coding region sequence of the cytochrome P450 monooxygenase gene derived from ramie is shown in SEQ ID NO: 1. The present invention obtained a longer coding sequence (average length 1933 bp) through PacBio Sequel sequencing. The high-quality full-length transcript data provides important genomic information for ramie, which lacks a reference genome.

[0007] The present invention provides a protein encoded by a cytochrome P450 monooxygenase gene derived from ramie. The amino acid sequence of the protein is shown in SEQ ID NO: 2.

[0008] The invention provides a recombinant plasmid containing a cytochrome P450 monooxygenase gene derived from ramie.

[0009] Furthermore, in a preferred embodiment of the present invention, the plasmid is pCAMBIA.

[0010] The present invention proposes the application of the cytochrome P450 monooxygenase gene derived from ramie in alleviating cadmium stress of ramie.

[0011] The beneficial effects of the cytochrome P450 monooxygenase gene derived from ramie and the protein encoded therein, the recombinant plasmid, and the application thereof according to the embodiments of the present invention are:

[0012] The present invention uses ramie as the research object, obtains the ramie cytochrome P450 monooxygenase gene (BnMAX1) through third-generation sequencing and gene annotation comparison. A longer coding sequence of the target gene is obtained through PacBio Sequel sequencing. This method is simple, fast and highly operable.

[0013] The sequence obtained in this study represents a novel cytochrome P450 monooxygenase gene (BnMAX1) amplified from ramie. Through steps such as BnMAX1 gene cloning, bioinformatics analysis, expression pattern analysis, and gene function verification, it was demonstrated to possess the corresponding gene function. The acquisition and application of this ramie cytochrome P450 monooxygenase gene provides fundamental theoretical support for molecularly improving ramie's cadmium tolerance, offering new technical means for enhancing ramie's ecological restoration capacity under heavy metal cadmium stress, and also provides an important reference for improving drought resistance in other plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0015] Figure 1 This is a sequence alignment of proteins encoded by homologous genes of ramie cytochrome P450 monooxygenase genes;

[0016] Figure 2 This is the phylogenetic analysis diagram of BnMAX1;

[0017] Figure 3 is the hydrophilicity diagram of BnMAX1;

[0018] Figure 4 is the secondary structure diagram of BnMAX1;

[0019] Figure 5 The tertiary structure diagram of BnMAX1;

[0020] Figure 6 Prediction of the transmembrane domain and subcellular localization of BnMAX1;

[0021] Figure 7 This is a diagram of BnMAX1 expression pattern analysis;

[0022] Figure 8 This is the RT-qPCR validation diagram of BnMAX1 gene overexpression in Arabidopsis;

[0023] Figure 9 Plant traits and staining reactions of overexpressing Arabidopsis under Cd stress. DETAILED DESCRIPTION

[0024] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0025] The following describes in detail the ramie-derived cytochrome P450 monooxygenase gene, the protein encoded by the gene, the recombinant plasmid, and the application thereof.

[0026] Example 1

[0027] This example provides a ramie BnMax1 gene transcript sequence, which was prepared according to the following steps:

[0028] (1) Preparation of ramie materials: Select ramie seedlings with consistent growth (ramie germplasm preserved by Guizhou Grassland Research Institute), wash away the soil around the roots, and transfer them to a hydroponic device with Hoagland nutrient solution. The culture conditions were 25℃ / 20℃, with a light / dark period of 14h / 10h. Hoagland aqueous solution was used as the control group (Control, CK), and Hoagland aqueous solution + 0.75M CdCl2 was used as the treatment group, with the solution replenished regularly. After 60 days of treatment, samples from the two treatment groups were selected for transcriptome sequencing.

[0029] (2) Construction of sequencing library: Total RNA was extracted according to the instructions of RNA extraction kit (OMEGA, China), and Nano Drop 2000 (Thermo, USA) and agarose gel electrophoresis were used to check whether RNA was degraded and contaminated. RNA was reverse transcribed into cDNA using the PCR cDNA Synthesis Kit, and PCR amplification was performed using KAPA HiFi PCR Kits. Fragments were screened using BluePippin, and finally, the SMRTbell template prep kit 1.0 was used to construct the SMRTbell library.

[0030] (3) Sequencing data assembly and quality control: The constructed library was sequenced using a PacBio Sequel sequencer. The raw data were filtered to remove low-quality and short-read sequences (minimum raw data length was 50 bp, and minimum raw data accuracy was 0.8). Based on the characteristics of random errors in PacBio sequencing, self-correction was performed (minimum full passes: 1; minimum prediction accuracy: 0.8; minimum ROI length: 200 nt) to obtain high-quality insert sequences (Reads of Insert, ROI). The lima software was used to identify and remove adapter sequences to obtain complete insert sequences. The ICE algorithm was used to cluster redundant sequences together, and then the incomplete insert sequences were aligned back to the consensus sequence. Then, quiver was used for correction to obtain high-quality transcripts (high-quality isoforms, HQ) and low-quality transcripts (low-quality isoforms, LQ) with an accuracy greater than 0.99.

[0031] (4) Transcript function annotation: The obtained transcript sequences were compared in databases such as GO (Gene Ontology), KEGG (Kyoto Encyclopedia of Genes and Genomes), KOG (Clusters of Orthologous Groups), Pfam (Protein family), eggNOG (Evolutionary Genealogy of Genes: Non-supervised Orthologous Groups), NT (Non-Redundant Nucleotide sequence database), NR (Non-Redundant Protein Sequence Database), and TmHMM (Transmembrane Helix Hidden Markov Model) to obtain transcript annotation information.

[0032] (5) Fragment acquisition: The BnMax1 gene transcript sequence was obtained using the PacBio platform, and specific amplification primers were designed. The amplification primers are as follows:

[0033] Forward primer sequence (5′→3′): AGCTTTCGCGAGCTCGGTACCATGGCAGA GACTTGGC (SEQ ID NO: 3);

[0034] Reverse primer sequence (5'→3'): CTCGAGCTTGCATGCCTGCAGTTAAGCCC TGTTGATGAC (SEQ ID NO: 4).

[0035] After PCR amplification and sequencing verification, the full-length 1611bp BnMax1 gene coding region sequence (CDS, as shown in SEQ ID NO: 1) was cloned and the amino acid sequence of the encoded protein (BnMAX1) was shown in SEQ ID NO: 2, with a length of 536aa.

[0036] Example 2

[0037] This example performs homology comparison on BnMAX1, and the specific steps are as follows:

[0038] Sequence alignment was performed using the blastn tool on the NCBI website to search for homologous proteins of BnMAX1 in species such as Arabidopsis, tomato, petunia, and rice. A phylogenetic tree was constructed using MEGA4.1, and multiple sequence alignment analysis was performed using DNAMAN.

[0039] like Figure 1Shown is a sequence alignment of proteins encoded by homologous genes of ramie cytochrome P450 monooxygenase gene (BnMAX1). Figure 2 This is the phylogenetic analysis diagram of BnMAX1. Figure 1 and Figure 2 It can be seen that ramie is grouped together with dicotyledonous plants such as hemp, pea, rose, and apple ( Figure 1 ), the amino acid sequence homology of these plants is as high as over 80% ( Figure 2 ), indicating that MAX1 is evolutionarily conserved.

[0040] Example 3

[0041] In this example, EXPASY was used to analyze the physical and chemical properties of BnMAX1 online. Table 1 shows the physical and chemical properties of BnMAX1. As can be seen from Table 1, the molecular formula of BnMAX1 is C 2729 H 4304 N 736 O 767 S 17 The relative molecular mass is 60.24kD, the theoretical isoelectric point is 9.12, there are 54 negatively charged amino acid residues, 61 positively charged amino acid residues, the instability coefficient is 41.31, the fat solubility coefficient is 94.57, and the average hydrophilicity coefficient is -0.095. In summary, BnMAX1 is a positively charged unstable hydrophilic protein.

[0042] Table 1 Physicochemical properties of BnMAX1

[0043]

[0044] Furthermore, the hydrophilicity and hydrophobicity of BnMAX1 were analyzed online using Protscale. Figure 3 The hydrophilicity diagram of BnMAX1 is shown. Figure 3 It can be seen that among all the amino acid residues, the most hydrophilic is glutamic acid at position 462, while the most hydrophobic is isoleucine at position 252; the total score of hydrophobic amino acids is 199.544, while the total score of hydrophilic amino acid residues is -249.534, indicating that BnMAX1 is a hydrophilic protein.

[0045] Example 4

[0046] In this example, Prabi was used to analyze the secondary structure of BnMAX1 online.

[0047] like Figure 4 The secondary structure of BnMAX1 is shown. Figure 4The secondary structure of BnMAX1 is composed of 43.28% α-helix, 16.79% extended chain, 6.72% β-turn and 33.21% random coil (SOPM method).

[0048] Example 5

[0049] In this example, SWISS-MODEL was used to perform tertiary structure homology modeling of BnMAX1 online, and VMD was used to render the model and color it according to the secondary structure.

[0050] like Figure 5 The three-level structure diagram of BnMAX1 is shown. Figure 5 The highest match to BnMAX1 was found in tobacco, with a sequence similarity of 74.53%, 99% sequence coverage, and a GMQE confidence level of 0.88. The model was evaluated online using SAVES (https: / / saves.mbi.ucla.edu / ), achieving an ERRAT score of 97.10, indicating the reliability of the model. In the tertiary structure of BnMAX1, the N-terminus is composed of an α-helix, followed by a β-sheet at the 84th amino acid (isoleucine).

[0051] Example 6

[0052] This example uses TMHMM and Cell-Ploc to analyze the BnMAX1 transmembrane domain and subcellular localization online. Figure 6 The diagram shows the transmembrane domain and subcellular localization prediction of BnMAX1. Figure 6 It can be seen that BnMAX1 has no transmembrane signal, no transmembrane structure, and is located in the chloroplast.

[0053] Example 7

[0054] This example analyzes the expression pattern of BnMAX1, and the specific steps are as follows:

[0055] Ramie seeds were sown in nutrient pots (humus soil: vermiculite = 3:1), and the culture conditions were 25℃ / 20℃, relative humidity 50-70%, and light / dark time of 14h / 10h. After 30 days of growth, plants with consistent growth were selected and transferred to Hoagland nutrient solution to slow down the growth. After 7 days, plants with consistent growth were selected and treated with Cd by adding 60mg / L CdCl2 to the Hoagland solution. At the same time, plants with Hoagland solution without CdCl2 were continued to be planted. At 0h, 8h, 16h, 24h, and 48h, the aboveground and underground parts of the ramie treated with Cd were taken; and the roots, stems, and leaves of the plants planted in Hoagland solution without CdCl2 were taken at 48h. The above samples were all used for RT-qPCR. The steps of RT-qPCR are as follows:

[0056] (1) Specific primer design for RT-qPCR

[0057] BnMAX1-specific primers were designed online using Primer-Blast on the NCBI website.

[0058] Table 2 RT-qPCR primers

[0059]

[0060] (2) Sample addition system and reaction conditions

[0061] The reaction system is shown in Table 3.

[0062] Table 3 RT-qPCR reaction system

[0063]

[0064] Using CFX96 TM RT-qPCR was performed using a real-time quantitative PCR instrument (Bio-Rad, USA) under the following reaction conditions:

[0065] Table 4 RT-qPCR reaction conditions

[0066]

[0067] (3) Data processing method

[0068] Use 2 -ΔΔCT Method to process the data.

[0069] like Figure 7 The figure shows the analysis of BnMAX1 expression pattern. Figure 7 -A is the expression diagram of different tissue parts; Figure 7 -B is the expression diagram of the aboveground part at different times under Cd stress; Figure 7 -C is the expression diagram of the underground part at different times under Cd stress; letters represent significant differences at the P < 0.05 level. Figure 7 It can be seen that BnMAX1 is expressed in roots, stems, and leaves ( Figure 7 -A), indicating that BnMAX1 is involved in the growth and development of ramie, among which BnMAX1 is expressed at the highest level in the roots, which may be related to the synthesis of SLs in the roots. In addition, BnMAX1 is induced to express under cadmium stress ( Figure 7 -B. Figure 7 -C), indicating that BnMAX1 plays a role in the response of ramie to cadmium stress.

[0070] Example 8

[0071] This example uses the overexpression vector pCAMBIA-2300S stored by the Guizhou Grassland Research Institute, and uses homologous recombination to construct the ORF of BnMAX1 into the pCAMBIA-2300S vector. The specific process is as follows:

[0072] (1) The vector was linearized by double enzyme digestion. The reaction system was as follows:

[0073]

[0074] The reaction solution was mixed evenly and centrifuged, then placed in a PCR instrument and subjected to enzyme digestion at 37°C for 60 min. After the enzyme digestion reaction was completed, 1% agarose gel electrophoresis was performed, and the gel was cut for recovery and purification.

[0075] (2) Obtaining the gene coding sequence with restriction enzyme cleavage sites, the amplification system is as follows:

[0076]

[0077]

[0078] After the components are mixed and centrifuged, the PCR reaction is performed. The system is as follows:

[0079]

[0080] After the PCR reaction was completed, electrophoresis was performed using 1% agarose gel, and the correct band was excised and recovered.

[0081] (3) Homologous recombination reaction between the vector and the product. The reaction system is as follows (carried out on ice):

[0082]

[0083] After the system is prepared, use a pipette to mix and place it in a PCR instrument at 50°C for 30 minutes.

[0084] (4) Transformation of recombinant products into competent E. coli

[0085] After the reaction in step (3) is completed, the reaction solution is added to 100 μL of Escherichia coli (DH5α) competent cells, gently mixed, placed on ice for 30 min, activated at 42°C for 60 s, ice bathed for 5 min, 800 μL of liquid culture medium is added, and the cells are placed in a shaker at 37°C and 200 rpm for 1 h. An appropriate amount of bacterial liquid is applied to LB solid culture medium containing Kan, and the cells are placed in a 37°C constant temperature incubator for 16 h.

[0086] (5) Bacterial liquid PCR

[0087] A single colony was selected with a pipette tip and added to 1 mL of LB liquid medium containing Kan. The culture was shaken at 37°C and 200 rpm for 6 h until the culture became turbid. PCR reaction was performed using the BnMAX1 gene cloning primers. The reaction system and reaction procedure were referred to step (2). After the reaction, agarose gel electrophoresis was performed and the culture with the correct band size was selected for testing. After sequencing was correct, the culture was shaken and the recombinant plasmid was extracted according to the instructions of the plasmid extraction kit (Tiangen, Beijing).

[0088] (6) Transformation of recombinant plasmid into Agrobacterium

[0089] 2-3 μL of recombinant plasmid was added to 100 μL of Agrobacterium (GV3101) competent cells, followed by ice bath for 5 min, quick freezing in liquid nitrogen for 5 min, water bath at 37°C for 5 min, and ice bath for 5 min. Then, blank LB liquid culture medium was added and shaken at 28°C and 220 rpm for 2-3 h. The culture was evenly spread on LB solid culture medium containing Kan and Rif. After incubation at 28°C in the dark for 2-3 days, the bacteria were picked. The reaction system was the same as (2) for bacterial solution PCR verification. The bacterial solution with the correct band size was added with glycerol and stored in a -80°C refrigerator.

[0090] (7) Transformation of Arabidopsis plants using the floral dipping method

[0091] After activating BnMAX1-2300S Agrobacterium tumefaciens glycerol culture on LB solid medium containing Kan and Rif for 2 days, the cells were scraped and placed in 15 mL of LB liquid medium containing Kan and Rif. The culture was shaken at 28°C and 200 rpm for 8-10 hours, followed by centrifugation at 5000 rpm for 5 minutes. The supernatant was removed and the cells were resuspended in 1 / 2 MS medium and adjusted to an OD600 of 0.8-1.0. Silwet L-77 (Solarbio) was added to a final concentration of 200 μL / L. Arabidopsis thaliana buds at full flowering (Col-0, Guizhou Grassland Research Institute) were immersed in the bacterial suspension and allowed to stand for 1 minute. After infection, the cells were placed in a lighted incubator for incubation. A second infection was performed 7 days later, and a third infection was performed 14 days later. After seed maturity, T0 seeds were collected and placed in a 37°C constant-temperature incubator for 14 days before storage in a seed cabinet.

[0092] The T0 generation seeds were disinfected with 75% alcohol for 1 minute, 5% sodium hypochlorite for 15 minutes, and washed 5 times with sterile water before being spotted on MS medium containing 36 mg / L Hyg and 100 mg / L Kan for screening. After 20 days, the normally growing Arabidopsis thaliana was transplanted into a peat: vermiculite (1:2) matrix for culture. After 28 days of growth, DNA was extracted for identification. The seeds harvested from the identified plants were T1. After multiple generations of screening, homozygous seeds were obtained for subsequent experiments. . Using AtActin as the internal reference gene, RT-qPCR was used to identify the positive plants. The specific implementation method of the identification was the same as in Example 7. Among them, the primer sequences are as follows:

[0093] AtActin2-F: ACCTTGCTGGACGTGACCTTACTGAT (SEQ ID NO: 9);

[0094] AtActin2-R: ACCTTGCTGGACGTGACCTTACTGAT (SEQ ID NO: 10).

[0095] like Figure 8 The figure shows the RT-qPCR verification of BnMAX1 gene overexpression in Arabidopsis. Figure 8 It can be seen that the BnMAX1 gene can be stably expressed in Arabidopsis thaliana.

[0096] Example 9

[0097] In this example, wild-type Arabidopsis (WT), max1 Arabidopsis mutant (mutant number: SALK_209654C, from: Chinese Arabidopsis Mutant Sharing Center, https: / / www.arashare.cn / ) and overexpressing BnMAX1 Arabidopsis (BnMAX1-OE) were spotted in MS medium and MS+25mg / LCdCl2 medium. After 7 days of culture, the root length of each Arabidopsis material was observed, and the plants were transplanted into nutrient pots (humus soil: vermiculite = 3:1). After further culture for 21 days, Cd treatment (25mg / L CdCl2) was performed, and CdCl2 solution was sprayed every other day. The control group was sprayed with the same volume of water. After 7 days of treatment, the leaves were taken for nitro blue tetrazolium chloride (NBT) staining and dithizone staining. The specific method is as follows:

[0098] (1) NBT staining: Arabidopsis leaves were stained in 0.1 g / L NBT solution for 12 to 18 h. After staining, the leaves were placed in 75% ethanol and heated at 60°C until the leaves were completely chlorotic and discolored.

[0099] (2) Dithizone staining: Arabidopsis leaves were stained in 0.4 g / L NBT solution for 4 to 6 h. After staining, the leaves were placed in 75% ethanol for 1 to 2 h to decolorize until the leaves completely turned green.

[0100] like Figure 9 Shown are the plant traits and staining reactions of overexpressed Arabidopsis under Cd stress. Figure 9 -A~ Figure 9 -B is a diagram of plant growth on MS medium; Figure 9 -C~ Figure 9 -D is the growth graph of plants on MS+25mg / L CdCl2 medium; Figure 9 -E is the NBT staining result; Figure 9 -F is the result of dithizone staining. Figure 9 It can be seen that under Cd stress, the root length of BnMAX1-OE plants is longer than that of WT and max1. After NBT and dithizone staining, the staining degree of BnMAX1-OE is lower than that of WT and max1, indicating that the accumulation of reactive oxygen species in BnMAX1-OE plants is reduced under Cd stress, and the amount of Cd complexes in the body is less than that of WT and max1. This proves that the expression of BnMAX1 improves the plant's ability to eliminate reactive oxygen species and reduces the accumulation of Cd in the plant. Transgenic Arabidopsis thaliana with BnMAX1 can alleviate Cd toxicity.

[0101] The embodiments described above are some, but not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are also within the scope of protection of the present invention.

Claims

1. A cytochrome P450 monooxygenase gene derived from ramie, characterized in that: The coding region sequence of the cytochrome P450 monooxygenase gene derived from ramie is shown in SEQ ID NO:

1.

2. A protein encoded by the cytochrome P450 monooxygenase gene derived from ramie according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO:

2.

3. A recombinant plasmid containing the ramie-derived cytochrome P450 monooxygenase gene according to claim 1.

4. The recombinant plasmid according to claim 3, characterized in that The plasmid is pCAMBIA.

5. Use of the cytochrome P450 monooxygenase gene derived from ramie according to claim 1 in alleviating cadmium stress in ramie.

Images