A SNP molecular marker related to egg production of chicken and application thereof
By using the SNP molecular marker at position 1141 of exon 6 of the chicken ERα gene for early breeding selection, the problem of slow genetic progress in egg production in chicken breeding was solved, egg production was increased and breeding costs were reduced.
Patent Information
- Application Number
- CN202510692114.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-27
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2045-05-27
AI Technical Summary
Current technologies have made slow progress in the genetic study of egg production in chicken breeding, resulting in high breeding costs and insufficient market competitiveness.
Early breeding selection was achieved by using SNP molecular markers at position 1141 of exon 6 of the chicken ERα gene. By detecting the CC genotype population and eliminating the TT and CT genotype populations, PCR amplification and Sanger sequencing were performed using primers F and R to achieve early selection of chicken egg production.
It increased the average egg production of chicken flocks, reduced breeding costs, and achieved high efficiency and reliability in early selection.
Smart Images

Figure CN120666032B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetics and animal breeding technology, and specifically relates to a SNP molecular marker related to chicken egg production and its application. Background Technology
[0002] my country's egg-laying hen industry is the world's largest producer and consumer market, providing a high-quality protein source for improving the national diet. Genetic improvement of egg production performance remains a core objective of breed innovation in the egg-laying hen industry. Egg count is the most important indicator affecting the economic traits of chickens, but its heritability parameter is only 0.18-0.22. Under current breeding conditions, many breeding institutions still use traditional phenotypic selection techniques, resulting in less than 1.5 genetic advances per year, leading to slow genetic progress and severely restricting the market competitiveness of domestically developed breeds. Summary of the Invention
[0003] To genetically increase the egg production of laying hens, this invention provides a SNP molecular marker related to egg production, located in the ERα gene. This SNP molecular marker can be used for early breeding selection of chickens based on egg production, effectively increasing the average egg production of the flock and reducing breeding costs.
[0004] This invention also provides the application of SNP molecular markers related to chicken egg production in genetic breeding to improve chicken egg production performance.
[0005] This invention is achieved through the following technical solution:
[0006] This invention provides an SNP molecular marker related to chicken egg production, wherein the SNP molecular marker is located at position 1141 of the ERα gene cDNA sequence in the chicken genome, corresponding to position 136 bp in the sequence shown in SEQ ID NO.1, and the base here is C or T.
[0007] Based on the same inventive concept, this invention provides the application of SNP molecular markers related to chicken egg production in genetic breeding to improve chicken egg production performance.
[0008] Based on the same inventive concept, the present invention provides an early selection method for the chicken egg production trait, the early selection method comprising early selection of the chicken egg production trait based on the genotype of the aforementioned SNP molecular marker related to chicken egg production.
[0009] Furthermore, the early selection method specifically includes:
[0010] Detect the genotype of the SNP molecular markers in the genome of the chicken to be tested;
[0011] Early selection of the egg production trait in the target chickens based on the genotype of the SNP molecular markers;
[0012] In this process, the number of eggs laid by the CC genotype population with the SNP molecular marker is greater than that laid by the TT or CT genotype population. The CC genotype population is retained and the TT and CT genotype populations are eliminated during the early selection process.
[0013] Furthermore, the detection of the genotype of the SNP molecular marker in the genome of the chicken to be tested specifically includes:
[0014] PCR amplification of the genomic DNA of the chicken to be tested was performed using primers F and R;
[0015] The PCR amplification products were sequenced to obtain the genotypes of the SNP molecular markers in the chicken genome to be tested;
[0016] The nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3.
[0017] Based on the same inventive concept, this invention provides a primer for detecting SNP molecular markers related to chicken egg production in genetic breeding to improve chicken egg production performance.
[0018] Furthermore, the detection primers include primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3.
[0019] Based on the same inventive concept, this invention provides a detection kit for SNP molecular markers related to chicken egg production and its application in genetic breeding to improve chicken egg production performance.
[0020] Furthermore, the detection kit contains primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3.
[0021] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:
[0022] 1. The present invention provides a SNP molecular marker related to the number of eggs laid in chickens. The SNP molecular marker is a C / T mutation at position 1141 of the ERα gene cDNA sequence in the chicken genome. This SNP is related to the number of eggs laid in chickens and can be used for early breeding selection of the egg production trait in chickens, effectively increasing the average number of eggs laid in chicken flocks and reducing breeding costs.
[0023] 2. This invention relates to the application of SNP molecular markers related to chicken egg production in genetic breeding for improving chicken egg production performance. The SNP molecular markers are associated with chicken egg production. Through the SNP molecular markers and their detection primers, a rapid, efficient, and accurate molecular marker-assisted breeding technology can be established using Sanger sequencing to perform early selection of egg production, which can accelerate genetic progress. This provides a convenient technical means for establishing molecular marker-assisted breeding for selecting chicken egg production, and has the advantages of simple operation and high reliability. It can achieve early selection and greatly reduce breeding costs. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0025] Figure 1 This is a gel image of the PCR amplification product of the chicken ERα gene containing exon 6.
[0026] Figure 2 Reference peak diagram for base mutation at position 1141 in the CDS region of the chicken ERα gene. Detailed Implementation
[0027] The present invention will be described in detail below with reference to specific embodiments and examples, thereby making the advantages and various effects of the present invention more clearly apparent. Those skilled in the art should understand that these specific embodiments and examples are for illustrative purposes only and are not intended to limit the present invention.
[0028] Throughout this specification, unless otherwise specified, the terminology used herein should be understood as having the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In the event of any conflict, this specification shall prevail.
[0029] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.
[0030] The overall concept of this invention is as follows:
[0031] ERα is the estrogen receptor gene. Estrogen forms a complex by binding to ERα. As a nuclear transcription factor, ERα promotes or inhibits the transcription of target genes by binding to the estrogen element response (ERE) of the target genes, thereby regulating the changes in cellular function affected by the target genes. Based on the important regulatory role of ERα in reproduction, the inventors designed primers for the coding sequence of ERα (Gene ID: 396099) that can amplify the regions of all eight exons. Using pooled sequencing technology, they unexpectedly discovered for the first time a mutation in ERα at position 1141 of the CDS region in the L3 strain of green-shelled chickens. Based on this, primers that can fully amplify the sixth exon were designed, and PCR amplification produced a 326bp PCR product. Sanger sequencing was performed on the PCR products of all individuals, and genotyping was performed on the mutation position at 136bp of the PCR product. Using a general linear model, association analysis was conducted on the different genotypes and egg production traits, and a breakthrough was found that different genotypes at this site are closely related to the number of eggs laid by chickens at 40 weeks of age, which is of great potential as a molecular marker.
[0032] The mutation is located in exon 6 of the chicken ERα gene (nucleotide sequence as shown in SEQ ID NO.1), at position 1141 of the CDS region with GenBank accession number NM_205183.2, where a C→T base mutation occurs.
[0033] Based on this, the present invention provides a SNP molecular marker related to egg production in chickens and its application in genetic breeding to improve egg production performance. Applying the SNP molecular marker of exon 6 of the ERα gene to early breeding selection for the egg production trait in chickens effectively increases the average egg production of the flock and reduces breeding costs.
[0034] The following will provide a detailed description of an SNP molecular marker related to chicken egg production and its application, in conjunction with embodiments and experimental data.
[0035] Example 1
[0036] This embodiment provides an early selection method for the trait of egg production in chickens, as detailed below:
[0037] 1. Experimental materials, reagents and instruments
[0038] (1) Experimental materials: The L3 fifth generation of green-shelled egg chickens from Jiangsu Provincial Institute of Poultry Science was used as the material. All chickens had a record of laying eggs at 40 weeks of age. 155 hens were randomly selected and their blood was collected.
[0039] (2) Main reagents: Proteinase K solution (Sangon Biotech); 2×Accurate Taq premix (containing dye, Acrel Biotech); agarose (Sangon Biotech); DNA marker (Acrel Biotech).
[0040] (3) Main instruments: PCR amplification instrument (Bio-Rad), gel imaging analysis system (WD-9413B, Beijing Liuyi).
[0041] 2. Detection Method
[0042] (1) Chicken blood collection: Blood was collected from the wing veins of laying hen breeding lines or breed selection groups, and anticoagulated with ACD.
[0043] (2) Genomic DNA extraction: Take the chicken blood sample from step (1) and extract genomic DNA using the phenol-formaldehyde method to determine the DNA concentration and purity.
[0044] (3) PCR amplification: PCR reaction was performed using the genomic DNA obtained in step (2) as a template. Primers were synthesized as follows: F: 5'-CCTGGTTCTCTGGATGCTGT-3' (SEQ ID NO.2), R: 5'-TCAGAAGCCATCAAATTGTAGCA-3' (SEQ ID NO.3), with primer positions as shown in the bolded sequences at the beginning and end of SEQ ID NO.1. The PCR reaction system consisted of: 25 μL of 2×AccurateTaq Master Mix, 1 μL each of 10 μM primers F and R, 2 μL of DNA template (final concentration ≤ 500 ng), and sterile water to a final volume of 50 μL.
[0045] The PCR reaction program was as follows: 94℃ pre-denaturation for 30 seconds, 98℃ denaturation for 10 seconds, 58℃ annealing for 30 seconds, 72℃ extension for 1 minute, for a total of 30 cycles, followed by a final extension at 72℃ for 5 minutes. The obtained PCR products were detected by agarose gel electrophoresis; a clear 326 bp amplified band was identified as the target band. Figure 1 ).
[0046] (4) Sanger sequencing of PCR products: The correctly amplified PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional sequencing.
[0047] (5) Identify the mutation sequence in the 6th exon of the individual's ERα gene: Use SnapGene software to view the sequencing results in step (4) and compare them with the following Seq ID No:1 sequence.
[0048] Seq ID No:1:
[0049] CCTGGTTCTCTGGATGCTGTTGTTCCACTTACAAAAGTGGAATATTTTACTGTCTCCTATTTATTCTTTCAGGA TTTGTGGATTTAACACTCCATGATCAGGTCCATCTGCTGGAATGTGCCTGGTTAGAGATA C / T TGATGATCGGCTTAG TCTGGCGCTCCATGGAACACCCAGGAAAGCTTTTATTTGCACCTAATCTATTACTGGACAGGTCAGTCTGTGTATTGCTGTTAATTATTTAAGTAAATTAATTTGTTTCTACCACAATCAGATTAATTTTTAGTTTTTAGTCATCTCATTGATGCTACAATTTGATGGCTTCTGA
[0050] In Seq ID No:1, the underlined sites are C / T mutation sites. Sequencing peak diagrams for different CC, TT, and CT genotypes are shown below. Figure 2 As shown.
[0051] (6) The distribution of egg production at this locus in L3 breed laying hens was statistically analyzed, and the results are shown in Table 1 below. As can be seen from the results in Table 1, the CC homozygous genotype is the dominant genotype, with an egg production of 95.92 eggs at 40 weeks of age, which is 6.72 and 6.07 more eggs than the TT and CT heterozygous genotypes, respectively.
[0052] Table 1. Differences in egg production among different genotypes with base mutations at position 1141 in the CDS region of the ERα gene.
[0053]
[0054] Note: Different lowercase letters in the shoulder inscription indicate significant differences (P<0.05).
[0055] (7) Egg production number selection: In the process of egg production number selection breeding, CC genotype is retained and TT and CT genotypes are eliminated.
[0056] Finally, it should be noted that the terms “comprising,” “including,” or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.
[0057] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0058] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. The application of a SNP molecular marker related to egg production in chickens in genetic breeding to improve egg production performance, characterized in that, The SNP molecular marker is located at position 1141 of the ERα gene cDNA sequence in the chicken genome, corresponding to position 136 bp in the sequence shown in SEQ ID NO. 1, where the base is C or T; The breed of chicken is the green-shelled egg chicken.
2. A method for early selection of the egg production trait in chickens, characterized in that, The early selection method includes early selection of chickens for the egg production trait based on the genotype of a SNP molecular marker associated with egg production; The SNP molecular marker is located at position 1141 of the ERα gene cDNA sequence in the chicken genome, corresponding to position 136 bp in the sequence shown in SEQ ID NO. 1, where the base is C or T; The breed of chicken is the green-shelled egg chicken.
3. The method for early selection of egg production trait in chickens according to claim 2, characterized in that, The early selection method specifically includes: Detect the genotype of the SNP molecular markers in the genome of the chicken to be tested; Early selection of the egg production trait in the target chickens based on the genotype of the SNP molecular markers; In this process, the number of eggs laid by the CC genotype population with the SNP molecular marker is greater than that laid by the TT or CT genotype population. The CC genotype population is retained and the TT and CT genotype populations are eliminated during the early selection process.
4. The method for early selection of egg production trait in chickens according to claim 3, characterized in that, The detection of the genotype of the SNP molecular marker in the chicken genome specifically includes: PCR amplification of the genomic DNA of the chicken to be tested was performed using primers F and R; The PCR amplification products were sequenced to obtain the genotypes of the SNP molecular markers in the chicken genome to be tested; The nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.
3.
5. The application of a primer for detecting SNP molecular markers related to egg production in chickens in genetic breeding to improve egg production performance, characterized in that, The SNP molecular marker is located at position 1141 of the ERα gene cDNA sequence in the chicken genome, corresponding to position 136 bp in the sequence shown in SEQ ID NO. 1, where the base is C or T; The breed of chicken is the green-shelled egg chicken.
6. The application according to claim 5, characterized in that, The detection primers include primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.
3.
7. The application of a detection kit for SNP molecular markers related to egg production in chickens in genetic breeding to improve egg production performance, characterized in that... The SNP molecular marker is located at position 1141 of the ERα gene cDNA sequence in the chicken genome, corresponding to position 136 bp in the sequence shown in SEQ ID NO. 1, where the base is C or T; The breed of chicken is the green-shelled egg chicken.
8. The application according to claim 7, characterized in that, The detection kit contains primer F and primer R, the nucleotide sequence of primer F is shown in SEQ ID NO.2, and the nucleotide sequence of primer R is shown in SEQ ID NO.3.