Particle coupled with PCR (Polymerase Chain Reaction) primer containing index and application of particle

Abstract

The invention belongs to the technical field of biology, and particularly relates to high-throughput multi-mode index marking and sequencing detection on single-cell or subcellular nucleic acid substances. According to the invention, a microbead-coupled particle of a PCR primer containing a bar code is designed, the microbead-coupled particle can be delivered to a plurality of different reaction systems in a single reaction by means of droplet microfluidics and the like, and a specific bar code of the reaction system is added to a target nucleic acid molecule in the reaction system in a high-flux parallel manner; the single cell transcriptome or multi-omics sequencing database building is completed. The method disclosed by the invention has the advantages of large cell flux, simplicity and convenience in operation, low price, low pseudosingle cell rate, low no-load rate of a micro-reaction system, high data quality and strong applicability.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to high-throughput multimodal indexing and sequencing detection of single-cell or subcellular nucleic acid substances. Background Art

[0002] The rapid development of single-cell precision sequencing technology has greatly deepened our understanding of cellular diversity and heterogeneity, revolutionizing the discovery of biological laws and the development of new diagnostics and treatments in medicine. The essence of single-cell sequencing is to measure the sequence, copy number, modification status, and interactions with other molecules of nucleic acid target molecules in individual cells, revealing information such as genomic variation, gene expression abundance, epigenetic modification sites, and regulatory elements. Nucleic acid target molecules can be all or specific subsets of DNA and / or RNA. For example, using the Tn5 enzyme to cleave DNA in the chromatin state can selectively enrich for open chromatin regions. Using reverse transcription primers containing PolyT can selectively enrich for mRNA. Using sequence-specific primer hybridization can target and enrich specific genes and elements.

[0003] Nucleic acid targets can also be non-endogenous, artificially synthesized nucleic acids. For example, Perturb-seq uses viral transfection to deliver sgRNAs into cells for expression. Single-cell transcriptome sequencing simultaneously detects the sgRNA sequence, thereby identifying the target gene perturbed in each cell.

[0004] Single-cell multi-omics sequencing refers to the joint detection of different modal information of the same cell. There are two main ideas. One is to design two or more capture sequences to capture signals of different modalities respectively, but through coupled delivery and pairing, to achieve the integration of different modal information. For example, 10X Genomics' Multiome product realizes RNA and ATAC dual-omics detection of the same cell by coupling the reverse complementary sequence of PolyT and Tn5 insertion sequence on the microspheres. The second is modal signal conversion. For example, CITE-seq uses protein-specific antibodies to couple pre-encoded nucleic acid molecules to convert the determination of specific protein modalities into the detection of transcriptome modalities, thereby realizing the simultaneous determination of RNA and protein information at the same time through single-cell transcriptome sequencing.

[0005] There are over 400 reported library construction technologies for bulk sequencing. Their unique challenges lie in selectively labeling target nucleic acid molecules, while their common core technical challenge is converting target nucleic acid molecules into nucleic acid fragments suitable for amplification (PCR, RCA, IVT). Furthermore, the core technical challenge of high-throughput single-cell sequencing or high-throughput single-cell multi-omics sequencing is to add cell-specific cell barcodes to all target nucleic acid molecules within the same cell. Currently, there are two main technical approaches.

[0006] The first involves single-round, high-density microreaction systems and coded microbead capture. Taking the GEM (Gel in Emulsion) technology (PMID: 28091601) from the 10X Genomics Chromium platform as an example, the core concept is to physically partition the oil and water phases within a droplet microfluidic system to create approximately 100,000 or more droplets of approximately 1 nanoliter volume, each serving as an independent microreaction system. Each droplet encapsulates reaction reagents, individual cells, and microparticles (particles) coupled to barcodes. Microreaction systems can also be implemented using high-density nanopores. Millions of capture sequences (e.g., PolyT) coupled to the same microbead share the same barcode, while each microparticle possesses a different barcode. Since a single cell exists within a reaction system, the barcode coupled to the microbead is both reaction-system-specific and cell-specific. A limitation is that throughput is nearly proportional to the pseudo-single-cell rate, making it difficult to increase throughput to approximately 10,000 cells, resulting in high costs.

[0007] The second type: high-throughput single-cell library construction technology with multiple rounds of label combination labeling. Represented by the split-pool-based SPLiT-seq technology established by AB Rosenberg's team in 2018, this technology can achieve ultra-high throughput, without the need for microfluidics and micropore preparation equipment, nor the need to prepare particles. It uses fixed cells or cell nuclei themselves as microreaction systems, and through 3 to 4 rounds of reactions (including RT, ligation, PCR, etc.), partial cell barcodes are added to the target nucleic acid molecules in situ in the cells one by one. The complete cell barcode is formed by the combination of multiple rounds of barcodes. In each round of reaction, the barcode specific to the reaction system is shared by multiple intracellular and target nucleic acid molecules, and the types are usually dozens to hundreds. The limitations are complex operation and inflexible throughput.

[0008] Current high-throughput single-cell omics methods all have their own shortcomings and pain points. In particular, the throughput and technical maturity of single-cell multi-omics lag far behind that of single-cell transcriptomics. The core problem of omics technology is to convert the target nucleic acid molecules within the cell into amplifiable nucleic acid fragments through molecular biological methods, and finally to add sequencing adapters through PCR to create a library for sequencing using a sequencer. There are already hundreds of mature bulk-sequencing technologies that can be used to detect specific modalities within cells, but most have not yet achieved single-cell precision. High-density microreactor systems and encoded microbead capture are the mainstream technical routes for commercial single-cell sequencing. However, designers of existing technologies prefer to couple cell barcodes with modality-specific capture sequences. This means that the development of single-cell sequencing for a new modality requires the high cost of re-synthesizing new encoded microbeads, hindering the development of new technologies. Therefore, it is necessary to develop a single-cell barcoding technology that is simple to operate, low-cost, flexible in cell throughput, and suitable for multimodal detection. Summary of the Invention

[0009] The existing technology of single-cell sequencing mainly focuses on the addition of cell barcodes in the early steps of capturing target nucleic acid molecules and forming amplifiable nucleic acid fragments. PCR is the inevitable last step in all omics library construction methods. Currently, there is a lack of methods and products for adding cell barcodes or partial cell barcodes through PCR with a parallel number of about 100,000 or more. The present invention designs a microparticle of microbeads coupled with PCR primers containing barcodes, which can be delivered to 2 to 1 million or more different reaction systems in a single reaction by means including but not limited to droplet microfluidics, and the reaction system-specific barcodes are added to the target nucleic acid molecules in the reaction system in high-throughput and parallel manner to complete the construction of the transcriptome or multi-omics sequencing library of single cells.

[0010] Based on this, the present invention has been completed.

[0011] In a first aspect, the present invention provides a microparticle coupled with an indexed PCR primer, wherein the microparticle comprises a microbead and an indexed PCR primer, wherein the microbead and the primer are coupled via a chemical bond; the microbead acts as a carrier to carry the indexed PCR primer, which is delivered to a specific conventional reaction system or microreaction system, and then the primer is released in a controlled manner.

[0012] Furthermore, the material of the microbeads is selected from gel, synthetic polymer or magnetic beads.

[0013] Furthermore, the gel is a natural polymer material, including but not limited to alginate, chitosan, agarose, gelatin, fibrinogen and / or polypeptide.

[0014] Furthermore, the synthetic polymer includes but is not limited to polyethylene glycol, polyacrylic acid, polyvinyl alcohol, polyacrylamide, polyhydroxylated methacrylic acid and / or polyacrylamide.

[0015] Furthermore, the magnetic beads are made of ferroferric oxide magnetic material.

[0016] Furthermore, the diameter of the microbeads is 5-50 μm.

[0017] Furthermore, the diameter of the microbeads is 10 μm-40 μm.

[0018] Furthermore, the indexed PCR primer comprises three parts: fixed sequence 1, index sequence and fixed sequence 2; wherein fixed sequence 1 is a sequencing adapter, fixed sequence 2 is a capture sequence, and the index sequence is a particle-specific barcode sequence.

[0019] Furthermore, the sequencing adapter is selected from the adapter of the Illumina sequencer or the sequence of the cluster generated by combining the sequencing library with the sequencing chip.

[0020] Furthermore, the sequencing library is combined with the sequencing chip to generate a cluster sequence selected from the P5 sequence, the P7 sequence, or partial sequences of both the P5 and P7 sequences.

[0021] Furthermore, the capture sequence is selected from the sequencing primer binding site sequence of the Illumina sequencer or any targeted sequencing capture sequence.

[0022] Furthermore, the sequencing primer binding site sequence of the Illumina sequencer is selected from TruSeq read1, TruSeq read2, Nextera read1, Nextera read1 or partial sequences thereof.

[0023] Furthermore, the fixed sequence 1 and the fixed sequence 2 can be adjusted according to the sequencer used in the subsequent sequencing reaction.

[0024] Furthermore, the nucleotide sequence of the index sequence is random, and each site can be any one of the four bases A / T / C / G.

[0025] Furthermore, the length of the index sequence is 1-25 bp.

[0026] Furthermore, the connection between the microbeads and the indexed PCR primers includes, but is not limited to, a releasable chemical bond connection, a polyacrylcystamine connection cleaved by a strong reducing agent, or a biotin-streptavidin connection.

[0027] Furthermore, the releasable chemical bond linkage includes dU releasable by USER enzyme or amino modification releasable by photocleavage.

[0028] Furthermore, the ratio of the number of coupled copies between the microbeads and the indexed PCR primers is 1:N, where N is greater than or equal to 1, preferably N is 10 7 -10 8 .

[0029] Furthermore, different types of PCR primers can be coupled to the same microbead to which the microparticles containing indexed PCR primers are coupled, preferably 1 to 5 types of PCR primers can be coupled.

[0030] Furthermore, the same microbead coupled to the microparticles containing indexed PCR primers can be coupled to 2-5 different types of PCR primers.

[0031] Furthermore, the different types of PCR primers refer to primers in which at least one of the fixed sequence 1 and the fixed sequence 2 contained in the primers is different.

[0032] Furthermore, the index sequences in primers of the same type coupled to the same microbead of the microparticles coupled to the indexed PCR primers are the same, the index sequences in primers of different types may be the same or different, and the index sequences in primers of different microbeads are different.

[0033] Furthermore, the fixed sequence 2 coupled to the microparticle containing the indexed PCR primer hybridizes with the consensus sequence of the target nucleic acid molecule.

[0034] Furthermore, the target nucleic acid molecule refers to a modified target nucleic acid molecule, wherein the modification is to add a sequence capable of hybridizing with the fixed sequence 2 at one or both ends of the target nucleic acid molecule.

[0035] In a second aspect, the present invention provides a method for preparing microparticles coupled to PCR primers containing an index according to the first aspect, the method comprising the following steps:

[0036] S1: chemically synthesize fixed sequence 1, and chemically modify the 5' end of fixed sequence 1;

[0037] S2: The modified fixed sequence 1 is affinity-linked to specific microbeads, and then random bases of the index sequence are synthesized in a split-pool manner using a two-step cyclic enzymatic DNA synthesis method or a ligation method;

[0038] S3: After the index sequence is synthesized, the fixed sequence 2 is synthesized enzymatically. Specific bases are added to a reaction pool to complete the synthesis of the fixed sequence 2, thereby obtaining the microbead-coupled microparticles containing the indexed PCR primers of the present invention.

[0039] Furthermore, in step S1, the chemical synthesis refers to the solid phase phosphoramidite triester method, in which DNA is fixed on a solid phase support to complete the synthesis of the DNA chain, and the synthesis extends from the 3' end to the 5' end of the primer to be synthesized, and adjacent nucleotides are connected by 3'→5' phosphodiester bonds.

[0040] Furthermore, in step S1, the chemical modification includes Acrydite or Biotin modification.

[0041] Furthermore, in step S1, the fixed sequence 1 is a sequencing adapter, which is selected from the adapter of an Illumina sequencer or a sequencing library combined with a sequencing chip to generate a cluster sequence.

[0042] Furthermore, the sequencing library is combined with the sequencing chip to generate a cluster sequence selected from the P5 sequence, the P7 sequence, or partial sequences of both the P5 and P7 sequences.

[0043] Furthermore, in step S2, affinity linking of the fixed sequence 1 to specific microbeads refers to using acrylic acid-modified primers to bind to polyacrylamide hydrogel microspheres, and linking biotinylated primers to gel beads or magnetic beads with streptavidin on the surface.

[0044] Furthermore, in step S2, the microbeads coupled with fixed sequence 1 are divided into four reaction pools, each of which contains only one synthetic base raw material. TdT enzyme is used to synthesize a base at the 3' end of fixed sequence 1. The microbeads in the four reaction pools after the reaction are mixed and then evenly distributed into 3-4 reaction pools containing only one synthetic base raw material. This cycle is repeated multiple times to generate barcodes with different throughputs.

[0045] Furthermore, the reaction pool contains one of the base materials dATP, dTTP, dCTP or dGTP.

[0046] Furthermore, in step S2, the length of the index sequence is 1-25 bp.

[0047] Further, in step S3, the fixed sequence 2 is selected from Truseq read1, Truseq read1, Nextera read1, Nextera read2 or partial sequences thereof.

[0048] Furthermore, the 5' end of the fixed sequence 2 is phosphorylated.

[0049] In a third aspect, the present invention provides an application of the microparticles coupled with indexed PCR primers described in the first aspect in the construction of high-throughput single-cell sequencing libraries of multiple omics modalities; wherein, when cells undergo PCR amplification, at least one of the amplifications is indexed-PCR amplification of the sequencing cells using the microparticles coupled with indexed PCR primers described in the first aspect.

[0050] Furthermore, the multiple omics modalities include but are not limited to single modalities such as scRNA-seq, scVDJ-seq, scATAC-seq, sc-whole genome sequencing, scCUT&Tag, and combinations of single modalities, such as scRNA-seq+scATAC-seq single-cell dual-omics modality.

[0051] Furthermore, the indexed-PCR labels the nucleic acid while amplifying it, that is, the fixed sequence 2 of the indexed-PCR primer specifically captures the target sequence, which is a sequence complementary to the fixed sequence 2 introduced into the target RNA and DNA molecules in situ in the cell by reactions such as reverse transcription, ligation, and transposition. Through indexed-PCR, the cellular origin of the molecules in the final sequencing library can be distinguished.

[0052] Furthermore, the microbeads are coupled to fixed sequences 2 of microparticles containing indexed PCR primers to hybridize with target nucleic acid molecules.

[0053] Furthermore, the target nucleic acid molecule refers to a modified target nucleic acid molecule, wherein the modification is to add a sequence capable of hybridizing with the fixed sequence 2 at one or both ends of the target nucleic acid molecule.

[0054] In a fourth aspect, the present invention provides a method for constructing a high-throughput single-cell sequencing library of multiple omics modalities, the method comprising the following steps:

[0055] S1: Prepare single cell suspension, fix and permeabilize cells;

[0056] S2: performing indexed-PCR amplification on the cells, wherein the primers used in the indexed-PCR are the microparticles coupled with the indexed PCR primers described in the first aspect of the present invention.

[0057] Furthermore, the cell index introduced by the indexed-PCR can be a unique cell index or the last round index of multiple rounds of combined indexing.

[0058] Furthermore, before the cells are subjected to indexed-PCR to introduce partial cellular barcodes, the cells / cell nuclei are pre-labeled with target molecules in situ for multiple rounds, and the number of rounds of introduction of partial cellular barcodes for the same target molecule can be 1 round, 2 rounds, 3 rounds or more.

[0059] Furthermore, the cell segmentation method when introducing the cell barcode includes but is not limited to microfluidics, manual and machine pipetting or flow sorting.

[0060] Furthermore, the partition carrier for cell segmentation when introducing the cell barcode can be oil-in-water microdroplets, nano-microwells or micro-well PCR plates.

[0061] In a fifth aspect, the present invention provides a high-throughput single-cell sequencing library construction system for multiple omics modalities, comprising a tissue sample processing module and a cell indexing module;

[0062] The tissue sample processing module is used to prepare the tissue into a single cell suspension, and then perform cell fixation and permeabilization;

[0063] The cell indexing module refers to a high-density micro-reaction system indexed-PCR indexing of the treated cells, and the primers used in the indexed-PCR are the microparticles coupled with the indexed PCR primers described in the first aspect of the present invention.

[0064] Furthermore, the cell indexing is performed by GEM indexed-PCR indexing in droplet microfluidics or indexed-PCR indexing of cells in a microplate device.

[0065] In one embodiment of the present invention, when the target cell library is less than 20,000 cells, the GEM indexed-PCR of the droplet microfluidics of the present invention can be used independently.

[0066] In one embodiment of the present invention, when the target cell library is 20,000-200,000 cells, it can be achieved through two rounds of labeling using the publicly available droplet microfluidics GEM indexed-RT and the droplet microfluidics GEM indexed-PCR of the present invention.

[0067] In one embodiment of the present invention, when the target cell library is 200,000-2 million cells, it can be achieved by three rounds of labeling using 96-well plate indexed Tn5 or published droplet microfluidic GEM indexed-ligation and the droplet microfluidic indexed-PCR of the present invention.

[0068] In a sixth aspect, the present invention provides a reagent kit for single-cell or subcellular indexing, the reagent kit comprising the microparticles coupled to indexed PCR primers as described in the first aspect of the present invention; the microparticles comprising microbeads and indexed PCR primers, wherein the microbeads and primers are coupled via chemical bonds; the microbeads act as carriers to carry the indexed PCR primers, deliver them to a specific conventional reaction system or microreaction system, and then release the primers in a controlled manner.

[0069] Beneficial effects

[0070] The present invention has developed a new single-cell sequencing method strategy. First, cells or subcells are fixed and permeabilized, or semi-permeable shells are constructed using polymer materials to encapsulate cells or subcells to form a nucleic acid aggregate that can react in multiple steps, which allows the steps before PCR to be performed in bulk reactions. Based on this premise, a microparticle of microbeads coupled with PCR primers containing barcodes is designed, which can be delivered to 2 to 1 million or more different reaction systems in a single reaction by means including but not limited to droplet microfluidics, and high-throughput and parallel addition of reaction system-specific barcodes to the target nucleic acid molecules in the reaction system. One embodiment of the present invention achieves single-cell transcriptome sequencing by GEM indexed-PCR instead of the prior art GEM indexed-RT, proving the feasibility of this transformation from bulk sequencing to single-cell sequencing. At the same time, since PCR is the last step in all omics library construction, by using a large-scale indexed PCR step instead of the conventional PCR step, this transformation is also universal, which will enable a large number of modal detections that have not yet reached single-cell accuracy to enter the single-cell era.

[0071] In addition, the present invention and existing single-cell sequencing technology can be used in combination to achieve ultra-high throughput because their principles are orthogonal. When the required cell throughput is not high, the present invention can be used independently to complete the library construction of single-cell sequencing by one round of indexing in which only one cell is expected in a reaction system. When the required cell throughput is high, it can be used in combination with the technology of adding cell barcodes using existing non-indexed-PCR, and the final cell barcode is defined by combining the indexes to complete the library construction of ultra-high throughput single-cell sequencing. In particular, for the existing multimodal detection that has achieved single-cell accuracy, the present invention can also be integrated to achieve two or more rounds of indexing through extremely simple steps, thereby significantly improving cell throughput, effectively reducing pseudo-single cell rate and cost, while maintaining high data quality and high stability. This solves the problem that the existing method cannot take into account large cell throughput, easy operation, low price, low pseudo-single cell rate, low micro-reaction system empty rate, high data quality, and strong applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1Schematic diagram of microparticles coupled to indexed PCR primers. a represents the microparticle and sequence structure; bi represents examples of specific primer sequences. Each microparticle can independently perform the function of single-cell sequencing library construction.

[0073] Figure 2 This single-cell omics library construction (single-round labeling) protocol is based on microparticles coupled to indexed PCR primers. Fixed, permeabilized cells or nuclei undergo in situ reverse transcription (RT) or transposition (Tn5) reactions, or a Tn5 reaction followed by RT is performed. Microreactions are then connected using droplet microfluidics, allowing each droplet to contain a microparticle coupled to an indexed PCR primer and a cell. Using different upstream reactions and different PCR sequences, single-cell transcriptome analysis (RNA-seq), chromatin accessibility analysis (ATAC-seq), and RNA+ATAC-seq co-omics can be achieved.

[0074] Figure 3 The library construction process and library structure for conventional single-cell omics (1-round labeling) using droplet microfluidics based on 1 round of labeling are shown in the following table: a. The library construction process and library structure for single-cell transcriptomics, including 3' RNA-seq and 5' RNA; b. The library construction process and library structure for single-cell ATAC-seq; c. The library construction process and library structure for RNA+ATAC co-omics.

[0075] Figure 4 A two-round labeling scheme for single-cell omics library construction based on microparticles coupled to indexed PCR primers.

[0076] Figure 5 The library structure is based on microparticles coupled with indexed PCR primers for single-cell omics sequencing (2 rounds of labeling).

[0077] Figure 6 A scheme for single-cell omics library construction (3 rounds of labeling) based on microparticles coupled with indexed PCR primers.

[0078] Figure 7 The library structure is based on microparticles coupled with indexed PCR primers for single-cell omics library construction (3 rounds of labeling).

[0079] Figure 8 This is a visualization of dimensionality reduction from a single-cell transcriptome sample pooling experiment from round 1 of labeling. A 1:1:10 ratio of human Hela cell lines to HEK293T cells to mouse cerebral cortex cells was used. Unsupervised clustering of the resulting single-cell transcriptome data revealed three distinct clusters: clusters 1 and 2 are Hela and HEK293T cells, respectively, and cluster 3 is mouse cerebral cortex cells. DETAILED DESCRIPTION

[0080] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below may be combined with each other as long as they do not conflict with each other.

[0081] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0082] The present invention relates to microparticles coupled with indexed PCR primers. The microparticles comprise microbeads and indexed PCR primers, wherein the microbeads and primers are coupled via chemical bonds. The microbeads act as carriers carrying the indexed PCR primers, which are delivered to a specific conventional reaction system or microreaction system, and then controllably release the primers. The indexed PCR primers comprise three parts: fixed sequence 1, index sequence, and fixed sequence 2. Fixed sequence 1 is a sequencing adapter, fixed sequence 2 is a capture sequence, and the index sequence is a microparticle-specific barcode sequence. For details on the structure, see [ 1 ]. Figure 1 a.

[0083] The application scenario of the present invention is single-cell sequencing, but the smallest unit of the labeled object needs to be a nucleic acid collection that is coupled together to perform multi-step molecular biological reactions. The unit can be a cell or a subcell, such as a cell nucleus, organelle, vesicle, exosome, etc., or any artificially defined nucleic acid collection. For simplicity, the terminology of single-cell sequencing is used uniformly. Achieving coupling of the target nucleic acid includes but is not limited to treating natural cells or subcells with a fixative, and also includes but is not limited to using a polymer material to form a semi-permeable shell so that the nucleic acid macromolecules of the same cell are encapsulated and cannot flow out, but small molecules and reagent components such as enzymes can pass through.

[0084] The template for the PCR primer of the present invention can be an amplifiable nucleic acid fragment converted from a target nucleic acid molecule by molecular biological means using any publicly available omics technology, and can be a molecule of either single or multimodal origin.

[0085] The microparticle-specific barcode (index) of the present invention can be used as a whole-cell barcode, where only one cell is expected in each reaction. The template for the PCR primers is an amplifiable nucleic acid fragment that does not carry any cellular barcode. The microparticle barcode can also be used as a partial-cell barcode, where 2-1000 or more cells are allowed in each reaction. The template for the PCR primers is an amplifiable nucleic acid fragment to which a partial-cell barcode has been added in a previous step using other published methods.

[0086] In the context of the present invention, the terms "barcode" and "index" have the same meaning and are used interchangeably.

[0087] Example 1 Microbead Preparation

[0088] The present invention provides a method for preparing primer-coupled gel beads, using highly monodisperse, degradable gel beads as a solid phase carrier to covalently link PCR primers. The specific experimental process includes:

[0089] (1) Reagent preparation

[0090] Aqueous phase: Mix acrylamide solution, N,N'-bis(acryloyl)cystamine BAC solution (cross-linker), ammonium persulfate APS solution (catalyst), TBSET buffer, and modified fixed sequence 1 (the fixed sequence is Illumina P5 / P7, with an acrydite modification at the 5' end followed by an Int HS-SH C6 modification) to a final concentration of 0.392% acrylamide, 0.6% cross-linker, and 25 μM Oligo DNA.

[0091] Oil phase: Add 12 μL of catalytic accelerator: tetramethylethylenediamine (TEMED) to 3 mL of droplet generation oil (Drop-Surf droplet generation oil) and shake to mix.

[0092] (2) Preparation and curing of adhesive beads

[0093] The microdroplet generator was installed and connected to an air source, power supply, and PDMS chip (PDMS-FF-50 superhydrophobic chip). The aqueous and oil phases were added to their respective reservoirs. The air source was turned on, the system was purged of air, and the flow rates were set at 20 μL / min for the oil phase and 10 μL / min for the aqueous phase. After stable microdroplet formation, the microdroplets were allowed to stand, then transferred to a centrifuge tube, capped with mineral oil, and oven-cured overnight.

[0094] (3) Rubber bead demulsification and cleaning

[0095] Remove the oil phase and mineral oil from the centrifuge tube, add a demulsifier at a 1:2 volume ratio, shake, and centrifuge repeatedly until the microspheres become transparent. Wash with 1% Span 80 in n-hexane and then with TET buffer. Finally, disperse the microspheres in TET buffer to obtain immobilized microspheres containing the fixed sequence.

[0096] Example 2 Generation of PCR primers on microbeads

[0097] In Example 1, the fixed sequence 1 of the PCR primer has been covalently bound to the polyacrylamide backbone of the microbeads through 5'-Acrydite modification, and then random sequences and fixed sequence 2 can be generated on the microbeads by various methods.

[0098] Method 1: Through multiple rounds of enzymatic DNA synthesis, random bases of the index sequence are gradually added to the beads. Specifically, equal amounts of beads are added to four TDT enzyme synthesis reactions, each containing only one nucleotide (3'-ONH2-dATP, 3'-ONH2-dGTP, 3'-ONH2-dCTP, or 3'-ONH2-dTTP). After the extension of one base, the reaction is terminated and the reaction solution is removed by washing. The beads from the four reactions are then mixed and then equally divided into four synthesis reactions containing only one nucleotide. Twelve rounds of extension (split)-pool reactions generate 12-bp random sequences, allowing for over 700,000 possible index sequence combinations. Finally, a fixed sequence 2 (fixed sequence 2 is Truseq read1, Truseq read1, Nextera read1, Nextera read2, or a portion thereof, with a phosphorylated 5' end) is ligated to the random sequence.

[0099] Method 2: Multiple rounds of ligation reactions are used to construct tag sequences in a step-by-step, modular manner. The random sequence is actually composed of 96*96*96 combinations of tag sequences and two bridge sequences. The specific steps are:

[0100] (1) Six primer sequences were synthesized, each with 96 tags. Primer 1 contained the terminal 6nt of fixed sequence 1 and 8nt tag sequence 1 (e.g., 5'p-CCGATCT[tag sequence 1]-3'); sequence 2 contained 14nt complementary sequence to the terminal of fixed sequence 1, the complementary sequence of tag sequence 1 of 8nt primer 1, and the complementary sequence of 4nt bridge sequence 1 (e.g., 3'-GCGAGAAGGCTAGA[tag sequence 1]CAGT-5'p); primer 3 contained 4nt bridge sequence 1, 8nt tag sequence 2 (e.g., 5'p-GTCA [Tag sequence 2]-3'); Primer 4 contains the complementary sequence of the 8nt tag sequence 2 and the complementary sequence of the 4nt bridge sequence 2 (for example: 3'-[Tag sequence 2]TGTC-5'p); Primer 5 contains the 4nt bridge sequence 2, the 8nt tag sequence 3, and the fixed sequence 2 or part of the fixed sequence 2 (for example: 5'p-ACAG[Tag sequence 3][Fixed sequence 2: ACACTCTTTCCCTACACGACGCTCTTCCGATCT]); Primer 6 is the complementary sequence of the tag sequence 3.

[0101] (2) First, in a 96-well plate, primers 1 and 2, primers 3 and 4, and primers 5 and 6 with the same tag sequence are annealed in pairs so that their complementary regions bind through base pairing.

[0102] (3) The microbeads containing fixed sequence 1 obtained in Example 1 were equally divided into a 96-well plate, T4 ligase reaction system was added to the 96-well plate, and the annealing product of primers 1 and 2 was added to each well to perform a ligation reaction.

[0103] (4) After the reaction is complete, the annealing products of the previous step are removed by centrifugation and washing. The beads in the 96-well plate are collected and mixed, and then distributed to a new 96-well plate. T4 ligase reaction system is added, and the annealing products of primers 3 and 4 are added to each well to perform the second ligation reaction.

[0104] (5) Following the same procedure as above, add the annealed products of primers 5 and 6 to perform the third ligation reaction.

[0105] (6) After centrifugation and washing to remove the reaction solution, collect all the microbeads in the 96-well plate into one tube.

[0106] Example 3: Conventional throughput single-cell omics library construction using independent GEM indexed PCR 1-round labeling

[0107] The microparticles coupled with indexed PCR primers of the present invention are introduced as single cell labels through droplet microfluidics GEM technology to achieve single cell omics sequencing of multiple omics modalities ( Figure 2 and Figure 4 ).

[0108] Primers Sequence (5'-3') IlluminaP5 AATGATACGGCGACCACCGAGATCTACAC Illumina P7 CAAGCAGAAGACGGCATACGAGAT Truseqread1 ACACTCTTTCCCTACACGACGCTCTTCCGATC Truseqread2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT Nexteraread1 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG Nexteraread2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG RT Primer 1 (capture 3' RNA) ACACTCTTTCCCTACACGACGCTCTCCGATCN10T30VN RT Primer 2 (capture 5' RNA) AAGCAGTGGTATCAACGCAGAGTACATT30VN TSO-1 (capture 3' RNA) AAGCAGTGGTATCAACGCAGAGTACATrGrG+G TSO-2 (capture 5' RNA) ACACTCTTTCCCTACACGACCGCTCTTCCGATCTrGrG+G RNA / TSO amplification primers AAGCAGTGGTATCAACGCAGAGTACAT

[0109] Note: N is any digit of ATCG; V is any digit of ACG; rG is riboguanosines; +G is LNA-modified guanosine

[0110] Compared with the original experimental method, the method of the present invention can greatly simplify the experimental operation and improve the data quality and stability.

[0111] The specific experimental process includes: fixing the permeabilized cells / nuclei and performing an in situ reverse transcription reaction (for RNA, scRNA-seq, scVDJ-seq); or performing an in situ transposition reaction (for chromatin open areas, scATAC-seq); or performing an in situ transposition reaction followed by an RT reaction (for dual-omics capture of RNA and chromatin open areas). After completing the above reactions, the cells / nuclei and the microparticles coupled with the indexed PCR primers of the present invention are packaged by droplet microfluidics or the like, so that each effective microdroplet, microwell, or PCR well plate contains 1 cell, 1 microbead, and the reaction components required for PCR amplification (including PCR enzyme, buffer, dNTP, and paired primers). The number of microreactions can be adjusted according to the actual required cell throughput, and the labeling of 1-10,000 cells can be achieved. Different omics modalities use different types of primers (see for details). Figure 2 , Figure 3 ). After the PCR reaction is completed, the target nucleic acid molecule of each cell is introduced into the microparticles coupled with the indexed PCR primers of the present invention as cell labels and sequencing adapters at at least one end, so that the products of all cells can be mixed and purified. The purified scRNA-seq is now a full-length cDNA product with a cell label and a sequencing adapter at one end. It is necessary to further build a library, and after random interruption, another sequencing adapter is loaded at the other end of the sequence loaded with the cell label. In addition, TCR / BCR can be enriched from the full-length cDNA product with specific primers or probes and a library can be built, thereby realizing the sequencing of the immune receptor sequence paired with the same cell ( Figure 3 .a); The purified scATAC-seq has a complete second-generation sequencing library structure and can be used for subsequent sequencing ( Figure 3 .b); scRNA-seq and scATAC-seq dual-omics further enrich the full-length cDNA product and chromatin open region library from the PCR pre-amplification product using specific primers, and scRNA-seq further builds the library to finally achieve single-cell dual-omics sequencing ( Figure 3 .c).

[0112] Specific experimental steps for high-throughput single-cell RNA+ATAC dual-omics:

[0113] (1) Prepare single cell suspension or cell nuclei and fix and permeabilize them;

[0114] (2) Add the treated cells or cell nuclei to the PCR tube and add Tn5 transposition reaction solution (including TN5 enzyme and Mg-containing 2+ Buffer), mix well and then transpose;

[0115] (3) After the reverse transcription reaction, the cells were centrifuged, the supernatant was removed, and the cells were resuspended in the reverse transcription solution (including reverse transcriptase, buffer, dNTP, RT primer, TSO sequence), and the reverse transcription reaction was performed after thorough mixing;

[0116] (4) After the reverse transcription reaction, the cells were centrifuged, the supernatant was removed, and the cells were resuspended in PBS. The cells were centrifuged again, the supernatant was removed, and the cells were resuspended in PBS and counted.

[0117] (5) Take 10,000 cells, add PCR reaction solution (including NEBNext UltraIIQ5 PCR enzyme, buffer, dNTP, TSO primer, P7 primer) and mix well;

[0118] (6) Cells and reaction solution, 150,000 microbeads with barcoded PCR primers (structure details see Figure 1 e) Mineral oil is loaded into the corresponding wells of one channel of the microfluidic chip to prepare water-in-oil microdroplets;

[0119] (7) Collect the prepared microdroplets (about 100,000) in a PCR tube and perform indexed PCR reaction;

[0120] (8) After the PCR reaction is completed, the oil-water structure is broken and the water phase is used Purify with SILANE genomic DNA Kit (ThermoFisher, 37012D) and then with 1.8x XP beads (Beckman Coulter, A63881);

[0121] (9) 1 / 4 indexed PCR product was amplified using P5 primer + P7 primer to specifically enrich the scATAC-seq library (where the i5 end of the library was loaded with a barcode primer), and purified using 1.2x XPbead to obtain the final scATAC-seq library;

[0122] (10) Take 1 / 4 of the indexed PCR product and perform PCR amplification with P5 primer + TSO primer to specifically enrich the full-length cDNA amplification product (where the RNA 3' end is loaded with a barcode primer);

[0123] (11) The full-field cDNA amplification product was inserted into the read2 sequencing adapter using the i7-only TN5 transposition, or the cDNA amplification product was randomly sheared with nuclease, end-repaired and A-tailed, and ligated to the read2 sequencing adapter;

[0124] (12) The product after read2 sequencing adapter introduction was purified with 1x XPbeads (Beckman Coulter, A63881), and further PCR amplified with P5 primer and P7 sample index primer, and purified with 0.8x XPbead to obtain the final scRNA-seq library;

[0125] (13) Sequence the constructed library (compatible with all second-generation sequencers). Perform paired-end sequencing, measuring 50k reads per cell.

[0126] In this example, a species mixed sample test was conducted using human cell lines Hela and HEK293T and mouse cerebral cortex cells at a cell number ratio of 1:1:10. The analysis results showed that 5753 cells were detected, with a cell capture rate of about 57%. Unsupervised clustering can clearly distinguish the three types of cells (see Appendix for details). Figure 6 The number of genes detected by scRNA-seq was greater than 1500; the scATAC-seq TSS enrichment score was greater than 6.5, and the reads inpeak / cell was greater than 8000.

[0127] Example 4: Combining well plate indexed RT with the present invention's GEM indexed PCR to achieve two-round labeling for high-throughput single-cell transcriptomic library construction

[0128] After one round of RT labeling in situ using a well plate, a second round of cell labeling is introduced using the microparticle-bound droplet microfluidics coupled with indexed PCR primers of the present invention, achieving single-cell omics sequencing with ultra-high throughput, sample multiplexing, and extremely low pseudo-single cell rate. For detailed experimental steps, see Figure 4 .

[0129] Based on the in situ loading labeling of cells by reverse transcription reaction in methods such as SPLiT-seq, cells and microbead primers of the present invention are subjected to indexed PCR reaction in droplet microfluidics, thereby achieving high-throughput single-cell transcriptome sequencing.

[0130] After data analysis, 200,000 cells were captured, with a cell capture rate of approximately 40%; the number of genes detected by scRNA-seq was greater than 1,500.

[0131] Example 5: Combining existing GEM indexed RT technology with the present invention's plate indexed PCR to achieve two-round labeling for high-throughput single-cell transcriptome library construction

[0132] On the basis of the existing droplet microfluidics technology for the first round of cell labeling in situ, the microparticles coupled with indexed PCR primers of the present invention are used to introduce the second round of cell labels through the well plate, thereby achieving ultra-high throughput, sample multiplexing, and single-cell transcriptomic sequencing with extremely low pseudo-single cell rate (see Figure 4 ).

[0133] The cells were fixed and loaded with the first round of cell labels using the 10x Genomics microfluidic platform and 5'RNA reagent. After the droplets were broken and remixed into a cell suspension, the cells and the microparticles coupled with indexed PCR primers of the present invention were subjected to indexed PCR reaction in a 96-well plate to achieve ultra-high-throughput sc5'RNA-seq (see the library structure for details). Figure 5 ). The specific steps are:

[0134] First, according to the 10x Genomics 5'RNA-seq instructions, the fixed and permeabilized cells / nuclei, related reagents and Gel beads are loaded into the microfluidic chip for oil-in-water preparation. The loaded cells can be, but are not limited to, 10,000-1 million (300,000 cells are loaded in the embodiment). The obtained oil-in-water product is subjected to a reverse transcription reaction so that the nucleic acid sequence on the 10x Genomics Gel beads is loaded onto the 3' end of the cDNA through reverse transcription and template displacement reaction, thereby achieving the first round of in situ cell labeling. The oil-in-water structure is then broken to separate the aqueous phase and the oil phase, and the cells are released from the oil-in-water droplets. The thoroughly mixed cell suspension is then evenly distributed into one 96-well plate, or less than one 96-well plate, or multiple 96-well plates (1000-3000 cells per well) according to the number of cells loaded. Each well plate contains microbeads with type-specific specific random sequence primers (for details of the primer structure, see Figure 1 b) and PCR reaction solution. After the PCR reaction is completed, all products in the 96-well plate are collected, mixed, and purified to obtain a full-length cDNA amplification product with two rounds of labeling. After random fragmentation using TN5 or nucleic acid, another sequencing adapter is added to the other end of the sequence loaded with the cell label, completing the construction of the sc5' RNA-seq second-generation sequencing library. After sequencing, the two rounds of molecular labeling jointly define a single cell.

[0135] In this example, the human cell line Hela was tested. Data analysis showed that 150,000 cells were detected, with a cell capture rate of approximately 50%. The number of genes detected by scRNA-seq was greater than 2,500 (see Table 1 for detailed data).

[0136] Table 1

[0137]

[0138] Example 6: Combining the existing GEM indexed RT&Tn5 technology with the plate indexed PCR of the present invention to achieve high-throughput single-cell RNA+ATAC dual-omics library construction with two rounds of labeling

[0139] The first round of cell labeling was performed using the 10x Genomics microfluidics platform and scRNA-seq and scATAC-seq Multiome reagents. The cells and the microparticles coupled with indexed PCR primers of the present invention were then introduced into the second round of labeling in a 96-well plate to achieve ultra-high-throughput scMultiome duo-omics (see the library structure for details). Figure 5 ). The specific experimental steps are:

[0140] First, according to the 10x Genomics Multiome instructions, the fixed and permeabilized cells / nuclei are subjected to Tn5 transposition. The transposed cells / nuclei and related reagents and Gelbeads are loaded into the microfluidic chip for oil-in-water preparation. The loaded cells can be but not limited to 10,000-1 million (300,000 cells are loaded in the embodiment). The obtained oil-in-water product is subjected to reverse transcription reaction (capturing RNA) and ligation reaction (capturing chromatin development zone gDNA), so that the nucleic acid sequence on the 10x Genomics Gelbeads is loaded to the 5' end of the cDNA through reverse transcription and loaded to the gDNA through ligation reaction, thereby achieving the first round of in situ cell labeling. The oil-in-water structure is then broken and the cells are released from the oil-in-water droplets. The fully mixed cell suspension is then evenly distributed into 96-well plates according to the number of cells loaded (1000-3000 cells per well), and each well plate contains microbeads with specific random sequence primers (for details of the primer structure, see Figure 1 h) and PCR reaction solution. After the PCR reaction is completed, all products in the 96-well plate are collected, mixed, and purified to obtain full-length cDNA amplification products with two rounds of labeling and gDNA in the chromatin development region. Specific primers (which can be modified with biotin) are then used to enrich and amplify the cDNA and gDNA, and scATAC-seq completes the library construction. The transcriptome part is the same as the first application scenario. After completing the subsequent library construction, sequencing can be performed. After sequencing, two rounds of molecular tags are used to jointly define a cell.

[0141] After data analysis, 200,000 cells were detected, with a cell capture rate greater than 40%; the number of genes detected by scRNA-seq was greater than 1,600; the scATAC-seq TSS enrichment score was greater than 6.5, and the reads in peak / cell was greater than 8,000.

[0142] Example 7: Combining existing GEM indexed RT&Tn5 technology with the GEM indexed PCR of the present invention to achieve high-throughput single-cell multi-omics library construction with two rounds of labeling

[0143] The first round of cell labeling was performed using the 10x Genomics microfluidic platform and Multiome reagents. The cells and the microparticles coupled with indexed PCR primers of the present invention were then introduced into the microfluidic droplets for the second round of labeling to achieve ultra-high throughput single-cell transcriptome library construction (see the library structure for details). Figure 5 ). The specific experimental steps are:

[0144] Example 6: After the first round of labeled cells were washed from the GEM using the 10x Genomics Multiome instructions, the cells were again mixed with the PCR reaction solution and PCR primer beads to prepare water-in-oil microdroplets. Each droplet contained microbeads with specific random sequence primers (for details on primer structure, see Figure 1 h) and PCR reaction solution. After the PCR reaction is completed, the emulsion is broken and the nucleic acid product is purified to obtain a full-length cDNA amplification product with two rounds of labeling and gDNA in the chromatin development region. Specific primers (which can be biotinylated) are then used to enrich and amplify the cDNA and gDNA, and scATAC-seq is completed. The transcriptome part is the same as the first application scenario. After completing the subsequent library construction, sequencing can be performed. After sequencing, two rounds of molecular tags are used to jointly define a cell.

[0145] After data analysis, 200,000 cells were detected, with a cell capture rate greater than 40%; the number of genes detected by scRNA-seq was greater than 1,500; the scATAC-seq TSS enrichment score was greater than 5.5, and the reads in peak / cell was greater than 7,000.

[0146] Example 8: Combining existing GEM technology with the GEM indexed PCR of the present invention to achieve high-throughput single-cell multi-omics library construction with three rounds of labeling

[0147] After two rounds of in situ labeling of cells, the third round of cell labels is introduced through the well plate using the microparticles coupled with indexed PCR primers of the present invention, achieving single-cell omics sequencing with ultra-high throughput, sample multiplexing, and extremely low pseudo-single cell rate ( Figure 6 ). The specific experimental steps are:

[0148] Before loading cell labels using the 10x Genomics microfluidics platform and scRNA-seq and scATAC-seq Multiome reagents, cells from different sample sources are first divided into different reaction pools and pre-indexed with different indexed Tn5s (indexed Tn5s can be but are not limited to 2-96 types). This allows cells in different reaction pools to load different labels on the open chromatin regions in situ, and the pre-indexed cells / nuclei are then subjected to 10x Genomics Multiome GEM preparation and cell labeling. The demulsified cells are then prepared again using droplet microfluidics, with each droplet generating a microparticle containing one PCR primer (see the primer structure for details). Figure 1 f) and PCR reaction solution, multiple cells are allowed to exist in each droplet ( Figure 6 right, Figure 7 Library structure). Subsequent library construction was the same as in Example 7, and after sequencing, three rounds of molecular tags were used to jointly define a cell.

[0149] After data analysis, the first round of indexedTn5 pre-indexing allowed tracing back to the cells of different sample origins. 300,000 cells were captured, with a cell capture rate exceeding 35%. The number of genes detected by scRNA-seq exceeded 1,500. The scATAC-seq TSS enrichment score exceeded 5.5, with reads in peak / cell exceeding 7,000.

Claims

1. A microparticle coupled with an indexed PCR primer, comprising a microbead and an indexed PCR primer, wherein the microbead and the primer are coupled via a chemical bond; the microbead acts as a carrier to carry the indexed PCR primer, is delivered to a specific conventional reaction system or microreaction system, and then releases the primer in a controlled manner.

2. The microparticle of claim 1 , wherein the indexed PCR primer comprises a fixed sequence 1, an index sequence, and a fixed sequence 2; wherein fixed sequence 1 is a sequencing adapter, fixed sequence 2 is a capture sequence, and the index sequence is a microparticle-specific barcode sequence.

3. The microparticles of claim 1 , wherein different types of PCR primers or the same type of PCR primers can be coupled to the same microparticle bead coupled to the microparticles containing indexed PCR primers; the index sequences in the primers of the same type coupled to the same microparticle bead are the same, the index sequences in the primers of different types can be the same or different, and the index sequences in the primers of different types coupled to different microparticles are different.

4. The method for preparing microparticles coupled with indexed PCR primers according to claim 1, comprising the following steps: S1: chemically synthesize fixed sequence 1, and chemically modify the 5' end of fixed sequence 1; S2: The modified fixed sequence 1 is affinity-linked to specific microbeads, and then random bases of the index sequence are synthesized in a split-pool manner using a two-step cyclic enzymatic DNA synthesis method or a ligation method; S3: After the index sequence is synthesized, the fixed sequence 2 is synthesized enzymatically. Specific bases are added to a reaction pool to complete the synthesis of the fixed sequence 2, thereby obtaining the microbead-coupled microparticles containing the indexed PCR primers as described in claim 1.

5. The preparation method according to claim 4, wherein in step S1, the chemical synthesis refers to the solid-phase phosphoramidite triester method, wherein DNA is fixed on a solid support to complete the synthesis of the DNA chain, and the synthesis extends from the 3' end to the 5' end of the primer to be synthesized, and adjacent nucleotides are connected by 3'→5' phosphodiester bonds; the chemical modification includes acrydite or biotin modification; the fixed sequence 1 is a sequencing adapter, which is selected from the adapter of an Illumina sequencer or a sequencing library combined with a sequencing chip to generate a cluster sequence; In step S2, the affinity linking of the fixed sequence 1 to the specific microbeads is achieved by using acrylic acid-modified primers to bind to polyacrylamide hydrogel microspheres, and biotinylated primers to link to gel beads or magnetic beads with streptavidin on the surface; In step S3, the fixed sequence 2 is selected from Truseq read1, Truseq read1, Nextera read1, Nextera read2 or partial sequences thereof.

6. Use of the microparticles coupled with indexed PCR primers as claimed in claim 1 in the construction of high-throughput single-cell sequencing libraries for multiple omics modalities; wherein, When the cells are subjected to PCR amplification, at least one of the amplifications is indexed-PCR amplification of the sequencing cells using the microparticles coupled to the indexed PCR primers according to claim 1.

7. The use as described in claim 6, wherein the multiple omics modalities include but are not limited to single modalities such as scRNA-seq, scVDJ-seq, scATAC-seq, sc-whole genome sequencing, scCUT&Tag, and combinations of single modalities.

8. A method for constructing a high-throughput single-cell sequencing library with multiple omics modalities, comprising the following steps: S1: Prepare single cell suspension, fix and permeabilize cells; S2: performing indexed-PCR amplification on the cells, wherein the primers used in the indexed-PCR are the microparticles coupled with the indexed PCR primers as claimed in claim 1.

9. A high-throughput single-cell sequencing library construction system for multiple omics modalities, including a tissue sample processing module and a cell indexing module; The tissue sample processing module is used to prepare the tissue into a single cell suspension, and then perform cell fixation and permeabilization; The cell indexing module refers to a high-density micro-reaction system indexed-PCR indexing of the treated cells, and the primers used in the indexed-PCR are the microparticles coupled with the indexed PCR primers as claimed in claim 1.

10. A reagent kit for single-cell or subcellular indexing, the reagent kit comprising the microparticles coupled to indexed PCR primers according to claim 1; the microparticles comprising microbeads and indexed PCR primers, wherein the microbeads and primers are coupled via chemical bonds; the microbeads act as carriers carrying the indexed PCR primers, are delivered to a specific conventional reaction system or microreaction system, and then release the primers in a controlled manner.

Images