Marker and kit for diagnosing artery blood vessel calcification and application

Abstract

The invention discloses a marker for diagnosing artery blood vessel calcification, a kit and application, and belongs to the technical field of biomedicine. The peripheral blood miR-221-3p disclosed by the invention is a biomarker with a specific screening value for vascular calcification, the peripheral blood miR-221-3p can be used for diagnosing a patient with vascular calcification by detecting the miR-221-3p, the AUC value of the miR-221-3p for diagnosing vascular calcification is 0.742, the sensitivity is 73.3%, and the specificity is 85.0%, so that the miR-221-3p as the biomarker has a relatively high diagnostic value for vascular calcification. Through development and application of the peripheral blood marker miR-221-3p related to vascular calcification and the diagnostic kit, the vascular calcification condition can be rapidly diagnosed and effectively treated in time, and a scientific basis is provided for exploring a novel and effective small molecule drug target.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical technology, and in particular relates to a marker, a kit and an application thereof for diagnosing arterial calcification. Background Art

[0002] Vascular calcification is a major contributor to increased morbidity and mortality from cardiovascular disease, with coronary artery calcification having the highest prevalence. Currently, the clinical diagnosis of coronary artery calcification relies primarily on imaging methods, with coronary computed tomography angiography (CT Angiography) being the primary noninvasive test for coronary artery calcification. However, by the time vascular calcification lesions are identified using imaging methods such as coronary angiography and dual-energy CT scanning, the patient's vascular calcification is often already advanced, making radical treatment difficult and expensive. Even the more recently developed rotational atherectomy or cutting balloon angioplasty are less than ideal for treating established calcified lesions. Furthermore, coronary CTA is plagued by issues such as contrast agent allergy, ionizing radiation, and high costs, hindering the early identification of coronary artery calcification. Therefore, identifying effective and specific early diagnostic markers and therapeutic targets is crucial for the timely prevention and treatment of vascular calcification.

[0003] MicroRNA (miRNA) is a non-coding RNA that is widely present in tissue cells and circulating blood throughout the body, regulating target genes at the post-transcriptional level. In peripheral blood, miRNAs are encapsulated in extracellular vesicles or complexed with high-density lipoproteins, acting as messenger molecules between different tissue cells to regulate distal biological activities. MiRNAs play a crucial role in the development and progression of vascular calcification. Aberrant expression of peripheral blood miRNAs may serve as a diagnostic marker for vascular calcification, making it possible to use peripheral blood miRNAs as diagnostic markers for diseases in clinical practice. Currently, there are no reports of using peripheral blood miR-221-3p as a marker for vascular calcification. Detecting significant differences in miR-221-3p expression in the peripheral blood of patients with vascular calcification would provide valuable guidance for the early diagnosis and treatment of vascular calcification. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a marker, a kit and an application for diagnosing arterial calcification, so as to solve the technical problem of poor early identification effect of vascular calcification.

[0005] To achieve the above-mentioned purpose, the technical solution adopted by the present invention is: to provide a miR-221-3p marker, the nucleotide sequence of miR-221-3p is shown in SEQ ID NO.1.

[0006] The present invention also discloses the use of the miR-221-3p marker in preparing a reagent for diagnosing and / or identifying arterial vascular calcification.

[0007] On the basis of the above technical solution, the present invention can also be improved as follows: Furthermore, arterial calcification becomes coronary artery calcification.

[0008] The present invention also discloses a kit for identifying arterial calcification based on peripheral blood samples, wherein the reagents used in the kit contain the miR-221-3p marker.

[0009] On the basis of the above technical solution, the present invention can also be improved as follows: Furthermore, the reagents also include primers and / or probes.

[0010] Furthermore, the reagent contains primers having nucleotide sequences as shown in SEQ ID NO. 2 to SEQ ID NO. 5.

[0011] The present invention has the following beneficial effects: The peripheral blood miR-221-3p disclosed herein is a biomarker with specific screening value for vascular calcification. Detection of miR-221-3p can be used to diagnose patients with vascular calcification. The AUC value for miR-221-3p in diagnosing vascular calcification is 0.742, with a sensitivity of 73.3% and a specificity of 85.0%. This demonstrates that miR-221-3p has high diagnostic value as a biomarker for vascular calcification. The development and application of the vascular calcification-related peripheral blood marker miR-221-3p and diagnostic kits enable rapid diagnosis of vascular calcification and timely and effective treatment, providing a scientific basis for the discovery of new and effective small molecule drug targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 To compare the imaging findings of the two groups of patients; Figure 2 is the relative expression level of miR-221-3p in peripheral blood of the two groups of patients; Figure 3 Correlation analysis between peripheral blood miR-221-3p and clinical indicators; Figure 4 This is the ROC curve for peripheral blood miR-221-3p in diagnosing coronary artery calcification. DETAILED DESCRIPTION

[0013] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. In the examples, where specific conditions are not specified, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. Reagents or instruments used where the manufacturer is not specified are conventional products that can be purchased commercially. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. It is obvious to those skilled in the art that various modifications are within the spirit and scope of the present invention as defined and determined by the appended claims, and all inventions and creations utilizing the present invention are protected.

[0014] Example 1 1. Research Subjects Fifty patients (25 men and 25 women) who underwent coronary CTA at the Second Affiliated Hospital of Chongqing Medical University between November 2024 and February 2025 were selected. Patients with a history of severe musculoskeletal disease, decompensated heart failure, malignant tumors, stroke or acute myocardial infarction within the past 3 months, severe arrhythmias, unstable angina, severe rheumatic disease, thromboembolic disease, pregnancy or lactation, severe infection, or other conditions deemed unsuitable for participation by the investigator were excluded. All data collection and blood sampling were performed with the informed consent of the subjects.

[0015] Coronary CTA was performed using 256-slice dual-source spiral CT (Simens Healthineers, SOMTOM, Drive). The subjects were divided into a coronary artery calcification group and a control group based on the CACS score. The non-calcification group (coronary artery calcium score = 0) consisted of 20 patients, including 9 males and 11 females; the calcification group (coronary artery calcium score > 0) consisted of 30 patients, including 16 males and 14 females. Basic information and biochemical markers of the patients in each group are shown in Table 1.

[0016] Table 1 Clinical indicator data

[0017] The bracketed data in Table 1 indicate non-normal distributions, which are statistically expressed as "median (interquartile range)." The median at the 50th percentile is shown before the brackets, while the data within the brackets are at the 25th and 75th percentiles. The difference between these two numbers is the interquartile range.

[0018] As can be seen from Table 1, the comparison of clinical indicators between the non-calcification group and the calcification group showed that there was a significant difference in BMI between the two groups of patients, P < 0.05.

[0019] All subjects underwent coronary artery CTA scan to confirm the presence of coronary artery calcification. Figure 1 As shown in the figure, the white highlighted area is the calcification area. Compared with the non-calcification group, the images of the calcification group patients showed obvious calcification areas.

[0020] 2. Research Methods During hospitalization, 1 mL of peripheral blood samples were collected from enrolled patients on an empty stomach in the morning and stored at -80°C. MicroRNA was extracted from peripheral blood using a column-based whole blood miRNA extraction kit (Solaibao Technology Co., Ltd.). cDNA was obtained using a tailing reverse transcription kit. Real-time quantitative PCR was used to determine the relative expression of miR-221-3p in the peripheral blood of patients with calcification and non-calcification. The specific steps were as follows: 1. Extraction of microRNA from peripheral blood (1) Add 100 μL of lysis buffer A, 150 μL of lysis buffer B, 4.5 μL of β-mercaptoethanol, and 200 μL of blood to a 1.5 mL centrifuge tube, vortex for 5 seconds, and let stand at room temperature for 3 minutes.

[0021] (2) Add 200 μL of anhydrous ethanol to the above lysed liquid, vortex for 20 seconds, and let it stand at room temperature for 3 minutes.

[0022] (3) Centrifuge at 12000 rpm for 3 min at 4°C.

[0023] (4) Slowly transfer 400 μL of supernatant to a new 1.5 mL centrifuge tube, add 400 μL of 95% ethanol, and vortex for 5 seconds.

[0024] (5) Add the above mixture to the adsorption column (the adsorption column is placed in the collection tube) at one time, centrifuge at 12000 rpm for 1 min, and discard the filtrate.

[0025] (6) Add 300 μL of rinse solution 1, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0026] (7) Repeat step 6.

[0027] (8) Add 300 μL of rinse solution 2, centrifuge at 12,000 rpm for 1 min, and discard the filtrate.

[0028] (9) Repeat step 8.

[0029] (10) Place the adsorption column in an empty collection tube and centrifuge at 12,000 rpm for 2 minutes. Discard the collection tube and leave the adsorption column uncovered for 2 minutes to remove any residual ethanol.

[0030] (11) Place the adsorption column in a new 1.5 mL centrifuge tube, add 25 μL of RNase-free ddH2O to the center of the adsorption column, place it at room temperature for 2 minutes, and centrifuge it at 12000 rpm at 4°C for 2 minutes to obtain the miRNA solution.

[0031] 2. Reverse transcription and real-time fluorescence quantitative PCR (1) Prepare the reverse transcription system in a 200 μL enzyme-free centrifuge tube. The reverse transcription system components are shown in Table 2.

[0032] Table 2 Reverse transcription system components

[0033] (2) Perform reverse transcription on a reverse transcription PCR instrument, and store the cDNA product in a -20°C refrigerator until use. The specific reverse transcription steps are shown in Table 3.

[0034] Table 3 Reverse transcription steps

[0035] (3) Add DEPC water to dilute the obtained cDNA approximately 30-fold, then add 20 μL of the system to each well on the ice block, with two replica wells. The specific operation is shown in Table 4.

[0036] Table 4 PCR system table

[0037] (4) Mix the sample and centrifuge briefly for 3-5 seconds, then load it into the PCR instrument and set the program as shown in Table 5.

[0038] Table 5 PCR program table

[0039] (5) After the reaction is completed, check whether the PCR amplification curve and melting curve are abnormal, then prepare a standard curve and perform quantitative analysis using U6 as the internal reference gene. The forward primer sequence for amplifying miR-221-3p is shown in SEQ ID NO. 2 (AGCTACATTGTCTGCTGGGTTTC), the sequence of miR-221-3p is shown in SEQ ID NO. 1 (AGCUACAUUGUCUGCUGGGUUUC), and the sequence of the reverse primer is shown in SEQ ID NO. 3 (AACGCTTCACGAATTTGCGT). Using U6 as the internal reference gene, the PCR forward primer sequence of the internal reference U6 is shown in SEQ ID NO. 4 (CTCGCTTCGGCAGCACA), and the reverse primer sequence is shown in SEQ ID NO. 5 (AACGCTTCACGAATTTGCGT).

[0040] The results are shown in Table 6 and Figure 2 As shown in the figure, there was a difference in the expression of miR-221-3p between the two groups of patients. The expression of miR-221-3p in the peripheral blood of patients in the calcification group was significantly increased, and the difference was statistically significant (P<0.01).

[0041] Table 6 Relative expression of miR-221-3p in peripheral blood of two groups of patients

[0042] Note: Data are expressed as mean ± standard error of the mean (SEM). **P < 0.01 compared with the control group.

[0043] Example 2 1. Correlation analysis between peripheral blood miR-221-3p and vascular calcification In order to clarify the relationship between peripheral blood miR-221-3p and clinical indicators such as calcification score, matrix analysis was performed using Spearman correlation analysis. The results are shown in Figure 2. Figure 3 As shown in the figure, miR-221-3p was positively correlated with calcification score (r=0.89, P<0.001) and BMI (r=0.34, P<0.05), and negatively correlated with HDL-C (r=-0.45, P<0.01). This suggests that miR-221-3p is significantly correlated with vascular calcification.

[0044] 2. Univariate binary logistic regression of risk factors for vascular calcification To screen for risk factors for vascular calcification, we performed univariate binary logistic regression analysis of the relative expression of miR-221-3p in peripheral blood and various clinical indicators. The results are shown in Table 7.

[0045] Table 7 Univariate logistic regression analysis of risk factors for vascular calcification

[0046] Table 7 shows that the regression analysis between each factor and the incidence of calcification showed that miR-221-3p and BMI were significantly associated with the incidence of calcification. P The values ​​were all less than 0.05 (the results were statistically significant), indicating that they were associated with the incidence of calcification, and miR-221-3p level (P<0.01) and BMI (P<0.05) might be risk factors for vascular calcification.

[0047] 3. Multivariate binary logistic regression of risk factors for vascular calcification To further explore whether the relative expression of miR-221-3p is a risk factor for vascular calcification, age, gender, and BMI and miR-221-3p relative expression, which showed significant differences in univariate regression analysis, were included in binary logistic regression. The results are shown in Table 8.

[0048] Table 8 Binary logistic regression analysis of risk factors for vascular calcification

[0049] As shown in the binary logistic regression results in Table 8, after excluding the influence of confounding factors such as age, gender, and BMI, the OR value of miR-2213p was 3.863, and p A value less than 0.05 had a statistically significant effect, indicating that the increased relative expression of miR-221-3p in peripheral blood was an independent risk factor for vascular calcification.

[0050] 4. Application value of peripheral blood miR-221-3p in vascular calcification ROC curve analysis was used to further explore the application value of miR-221-3p in vascular calcification. Figure 4 As shown in the data, the AUC value of miR-221-3p for diagnosing vascular calcification was 0.742, the sensitivity was 73.3%, and the specificity was 85.0%, indicating that miR-221-3p has a high diagnostic value for vascular calcification as a biomarker.

Claims

1. A miR-221-3p marker, characterized in that The nucleotide sequence of miR-221-3p is shown in SEQ ID NO.

1.

2. Use of the miR-221-3p marker according to claim 1 in the preparation of a reagent for diagnosing and / or identifying arterial vascular calcification.

3. The application according to claim 2, characterized in that: The arterial calcification is coronary artery calcification.

4. A kit for identifying arterial calcification based on peripheral blood samples, characterized in that: The reagents used in the kit include the miR-221-3p marker according to claim 1.

5. The kit for identifying arterial calcification based on peripheral blood samples according to claim 4, characterized in that: The reagents also include primers and / or probes.

6. The kit for identifying arterial calcification based on peripheral blood samples according to claim 5, characterized in that: The reagents contain primers with nucleotide sequences as shown in SEQ ID NO. 2 to SEQ ID NO. 5.

Images