Kit for detecting jewfish aeromonas veronii based on RPA-CRISPR / Cas12a, detection method and application
Through RPA-CRISPR/Cas12a technology, combined with RPA amplification and the trans-cleavage activity of Cas12a protein, rapid, highly specific, and low-cost detection of sea bass Aeromonas vicinarum was achieved, solving the detection problem in aquaculture and being suitable for on-site detection.
Patent Information
- Application Number
- CN202510716748.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-30
- Publication Date
- 2025-09-23
AI Technical Summary
Existing technologies make it difficult to quickly and accurately detect Aeromonas vesiculosus in sea bass in aquaculture. Traditional methods are time-consuming, lack sensitivity, and require professional equipment, which cannot meet the needs of efficient on-site detection.
Using RPA-CRISPR/Cas12a technology, after amplifying the gyrB gene of Aeromonas veseri through RPA, the trans-cleavage activity of the Cas12a protein and a fluorescent reporter probe are used to achieve rapid and highly specific detection.
The detection can be completed within 60 minutes with a sensitivity of 1fg/μL. It has strong specificity, is easy to operate, low cost, and does not require complex instruments. It is suitable for instant diagnosis at aquaculture sites.
Smart Images

Figure CN120683278A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of aquatic animal pathogen detection. More specifically, the present invention relates to a kit, a detection method, and an application for detecting Aeromonas vermiformis in sea bass based on RPA-CRISPR / Cas12a. Background Art
[0002] In recent years, the marine aquaculture industry has demonstrated significant growth, with both scale and output steadily increasing. Sea bass (Lateolabrax japonicus) is a key aquaculture species due to its high economic value and widespread consumer demand. However, with the expansion of intensive aquaculture, the frequent occurrence of bacterial diseases has become a core issue hindering the sustainable development of the industry. According to statistics, bacterial pathogens account for over 40% of aquatic diseases each year.
[0003] Aeromonas veronii is a Gram-negative short bacillus widely distributed in natural water bodies and aquaculture environments. It is highly pathogenic. It can cause bacterial septicemia in fish, with symptoms such as hyperemia at the base of the pelvic and pectoral fins, redness and swelling of the anus, and a significantly enlarged abdomen. Autopsy reveals a large amount of fluid in the abdominal cavity. In recent years, outbreaks of Aeromonas veronii have frequently occurred in high-density perciformes fish, resulting in high mortality rates, with cumulative mortality rates reaching 100% within 30 days. This disease severely impacts fish growth and quality, reduces feed conversion rates, increases aquaculture costs, and results in significant economic losses for fish farmers. Furthermore, Aeromonas veronii is a zoonotic pathogen that can infect humans through contact with wounds or consumption of contaminated seafood, causing symptoms such as bacteremia, meningitis, necrotizing fasciitis, or gastroenteritis, which can be life-threatening in severe cases.
[0004] At present, the detection of Aeromonas versicolor in sea bass mainly relies on the following three methods: (1) Traditional microbial culture method: using selective culture medium to isolate and identify strains, but it takes a long time, generally 5-7 days. For slow-growing bacteria such as Aeromonas versicolor (culture cycle ≥ 10 days), this method is not sensitive enough and cannot meet the needs of rapid response during epidemic outbreaks; (2) Immunological detection: including ELISA, immunofluorescence, etc., although the detection cycle is shortened to 24 hours, there are problems such as antibody cross-reaction, high false positive rate, and high cost; (3) PCR-based molecular detection technology: covering conventional PCR, real-time fluorescence quantitative PCR (qPCR) and multiplex PCR, etc., with a detection limit of up to 10 2 -10 3CFU / mL. However, traditional PCR relies on complex thermal cycling equipment, and qPCR reagents are expensive and require professional operation, which makes them difficult to promote in farms or grassroots laboratories. In addition, none of the above methods can simultaneously meet the needs of rapid on-site detection and high sensitivity, making it difficult to achieve early and accurate identification, which seriously restricts the timeliness of prevention and control. Patent CN105506153B discloses a method and kit for detecting Aeromonas vernix, and relates to a detection technology for Aeromonas vernix. The kit of the present invention for detecting fish pathogens comprises a pair of primer pairs for amplifying genes from Aeromonas vernix. The PCR technology involved in the above patents requires strict conditional restrictions, which limits the practical application of the patent. Patent CN116875715A discloses a method for detecting Aeromonas versicolor. The key points of the technical solution are: crRNA with the base sequence of UACAGGAUUCCAGACAUGUC is used to detect Aeromonas versicolor. First, the DNA of the target bacteria is extracted using a DNA kit, and then PCR amplification is performed to obtain the target double-stranded DNA. The Cas12a system is then configured, and finally a microplate reader or a handheld ultraviolet lamp is used for measurement to quickly detect Aeromonas versicolor. This method also requires the use of a PCR instrument in the laboratory, which is not immediate, limiting its application.
[0005] In recent years, recombinase polymerase amplification (RPA) technology has demonstrated significant application value in the field of immediate pathogen detection, thanks to its unique advantages of isothermal amplification (can be completed at 37-42°C) and high efficiency (nucleic acid amplification within 15-30 minutes). This technology, through recombinase-mediated primer-directed binding and strand displacement amplification, successfully overcomes the traditional PCR's reliance on thermal cycling equipment.
[0006] However, it still faces the challenge of insufficient specificity when used independently, especially when dealing with bacterial species with high genomic homology, which can easily lead to false positives due to nonspecific amplification.
[0007] In the context of innovation in molecular diagnostic technology, the gene editing properties of the CRISPR-Cas system have provided new ideas for the field of detection. Effector proteins represented by Cas12a can activate trans-cleavage activity after target sequence recognition. This dual function enables it to have single-molecule nucleic acid recognition capabilities and signal amplification characteristics. However, there is a sensitivity bottleneck when using the CRISPR-Cas12a detection system alone, and a higher concentration of initial target molecules is required to trigger an effective reaction. Therefore, there is an urgent need to develop a portable, efficient, low-cost and highly sensitive method for rapid pathogen detection. It does not rely on large and complex equipment. On-site rapid detection of pathogens can be achieved through simple operation and portable devices, and can be widely used in different breeding environments and conditions to meet diverse detection needs. Summary of the Invention
[0008] The object of the present invention is to overcome the above-mentioned deficiencies in the prior art and provide a kit, detection method and application for detecting Aeromonas versicolor based on RPA-CRISPR / Cas12a. The kit mainly includes specific primers for detecting the gyrB gene of Aeromonas versicolor based on RPA-CRISPR / Cas12a, Cas12a protein, crRNA and fluorescent reporter probe ssDNA Reporter.
[0009] The present invention establishes a new rapid detection method based on the combination of recombinase polymerase amplification (RPA) and CRISPR / Cas12a technology and applies it to the detection of important pathogens in sea bass farming. The detection scheme is implemented in a two-step method: first, a large number of target DNA fragments are efficiently prepared by RPA amplification, and then the amplified products are transferred to the CRISPR / Cas12a detection system for specific recognition, and the results are detected by fluorescence visualization. After crRNA guides the Cas12a protein to specifically recognize the target sequence, the Cas12a protein is activated and exhibits non-specific trans-cutting activity; due to the addition of a double-labeled fluorescent reporter probe (5' end modified with a fluorescent group, 3' end connected to a quenching group), the activated Cas12a protein will directionally cut the single-stranded DNA region in the free fluorescent reporter probe, so that the fluorescent group is spatially separated from the quenching group, and then the fluorescent signal is released, and accurate diagnosis of the pathogen can be achieved by real-time monitoring of fluorescence changes.
[0010] One of the technical solutions of the present invention provides a composition for identifying Aeromonas vernix, the composition comprising: specific primers for detecting the gyrB gene of Aeromonas vernix based on RPA-CRISPR / Cas12a, Cas12a protein, crRNA, and a fluorescent reporter probe ssDNA Reporter;
[0011] The specific primers include:
[0012] An upstream primer gyrB-F of the Aeromonas veseri gyrB gene having a nucleotide sequence as shown in any one of SEQ ID No. 1, SEQ ID NO. 5 or SEQ ID NO. 7:
[0013] SEQ ID NO.1: 5'-TGTTCCATTACGAGATCTTGGCCAAGCGCCT-3';
[0014] SEQ ID NO.5: 5'-TCCATTACGAGATCTTGGCCAAGCGCCTGC-3';
[0015] SEQ ID NO.7: 5'-CCTGTTCCATTACGAGATCTTGGCCAAGCG-3';
[0016] Downstream primer gyrB-R of the Aeromonas veseri gyrB gene having a nucleotide sequence as shown in any one of SEQ ID No. 2, SEQ ID NO. 6 or SEQ ID NO. 8:
[0017] SEQ ID NO.2: 5'-CATCGCCACTTCCACGCCGATACCATCCTGC-3';
[0018] SEQ ID NO.6: 5'-CACTTCCACGCCGATACCATCCTGCTCGGTG-3';
[0019] SEQ ID NO.8: 5'-GATAGGCGTCGTTCCACTGCATCGCCACTTC-3'; wherein the upstream primer represented by SEQ ID No.1 corresponds to the downstream primer represented by SEQ ID No.2, the upstream primer represented by SEQ ID No.5 corresponds to the downstream primer represented by SEQ ID No.6, and the upstream primer represented by SEQ ID No.7 corresponds to the downstream primer represented by SEQ ID No.8;
[0020] The upstream primer is preferably a sequence as shown in SEQ ID No. 1, and the downstream primer is preferably a sequence as shown in SEQ ID No. 2;
[0021] The crRNA targets the Aeromonas veseri gyrB gene and has a nucleotide sequence as shown in SEQ ID No. 3:
[0022] SEQ ID No.3:
[0023] 5'-UAAUUUCUACUAAGUGUAGAUUGCUACGAGGGUGGCAUCAAGGC-3';
[0024] The fluorescent reporter probe ssDNA Reporter has a nucleotide sequence as shown in SEQ ID No. 4:
[0025] SEQ ID No. 4: 5'-FAM-TTTTTATTTTT-BHQ1-3'.
[0026] The second technical solution of the present invention provides a kit for identifying Aeromonas veroni based on RPA-CRISPR / Cas12a, comprising the above-mentioned composition for identifying Aeromonas veroni.
[0027] Furthermore, the kit also includes lyophilized enzyme, RPA reaction buffer, magnesium acetate, CRISPR reaction buffer, nuclease-free water, healthy sea bass tissue genomic DNA and Aeromonas vernix genomic DNA.
[0028] The concentration of magnesium acetate is 150-400 mM, preferably 280 mM;
[0029] The CRISPR reaction buffer is preferably 10×CRISPR reaction buffer;
[0030] The positive control and negative control will vary depending on the pathogen and host being detected; preferably, nuclease-free water is used as a blank control; genomic DNA from healthy sea bass tissue is used as a negative control, and genomic DNA from Aeromonas vernix is used as a positive control.
[0031] The third technical solution of the present invention provides a detection method for identifying Aeromonas viridis based on RPA-CRISPR / Cas12a, the method comprising:
[0032] S1. Extraction of genomic DNA from samples: Take the sample to be tested and extract the genomic DNA from the sample;
[0033] S2. RPA amplification: Using the upstream primer gyrB-F for Aeromonas vernix and the downstream primer gyrB-R for Aeromonas vernix, amplify the genomic DNA of the sample to be tested, extracted in step S1, by RPA to obtain an RPA amplification product. Simultaneously, nuclease-free water was used as a blank control, genomic DNA from healthy sea bass tissue was used as a negative control, and genomic DNA from Aeromonas vernix was used as a positive control, all treated in the same manner as the sample genomic DNA.
[0034] Furthermore, the RPA amplification reaction system in step S2 was composed as follows: a total volume of 50 μL, including 1 tube of lyophilized enzyme, 2 μL each of Aeromonas vernix upstream primer gyrB-F and Aeromonas vernix downstream primer gyrB-R, 29.4 μL of RPA reaction buffer, 2.5 μL of 280 mM magnesium acetate, and 2.0 μL of genomic DNA, with the remaining volume being made up by nuclease-free water;
[0035] Furthermore, the concentration of the primer is 5-20 μM, preferably 10 μM; the concentration of the genomic DNA of Aeromonas wilkenbergii is preferably 10-100 ng / μL, preferably 20 ng / μL; the RPA amplification procedure is a constant temperature reaction at 30-41°C for 10-30 minutes, preferably a constant temperature reaction at 37°C for 20 minutes.
[0036] S3. CRISPR / Cas12a detection: After the reaction in step S2 is completed, take 2 μL of the RPA amplification product in step S2 and add it to a 20 μL CRISPR / Cas12a reaction system for subsequent detection; the CRISPR / Cas12a reaction system includes: CRISPR reaction buffer, fluorescent reporter probe ssDNA Reporter, Cas12a protein, crRNA, and nuclease-free water;
[0037] Furthermore, in step S3, the final concentration ratio of the Cas12a protein to the crRNA in the system is 1: (0.5-2), preferably 1: 1; the final concentration ratio of the Cas12a protein to the fluorescent reporter molecule ssDNA Reporter in the system is 1: (0.5-2), preferably 1: 0.8.
[0038] Furthermore, the CRISPR / Cas12a reaction and detection procedure in step S3 is as follows: the reaction system is subjected to a constant temperature reaction at 35-39°C for 30-50 minutes, preferably at 37°C for 40 minutes, and then the amplified product is subjected to fluorescence detection using a handheld blue light flashlight; preferably, the blue light irradiation wavelength range is 465-485 nm, preferably 475 nm, the absorption wavelength is 525 nm, and the flashlight output power is preferably 10 W.
[0039] Furthermore, 20 μL of the CRISPR / Cas12a reaction system includes 2 μL of 10×CRISPR reaction buffer, 0.5 μL of 10 μM Cas12a protein, 0.5 μL of 10 μM crRNA, 0.4 μL of 10 μM fluorescent reporter probe ssDNA Reporter, 2.0 μL of RPA amplification product, and 14.6 μL of nuclease-free water.
[0040] S4. Interpretation of test results: The color of the reaction solution after irradiation is used as the standard. If the color is similar to that of the blank control and negative control and both are colorless, it is negative; if the color is green, it is positive.
[0041] Further, in some specific embodiments, the standard test results after the RPA-CRISPR / Cas12a reaction in step S4 according to the above detection process are as follows: Figure 1 shown.
[0042] The above detection steps are all completed under constant temperature conditions, without the need for complex temperature settings, thus getting rid of the dependence on precision instruments such as qPCR instruments, and have a broader application prospect.
[0043] A fourth technical solution of the present invention provides the application of the above-mentioned kit and detection method for identifying Aeromonas vermiformis based on RPA-CRISPR / Cas12a, wherein the kit and detection method are used for the detection of fish pathogens in marine aquaculture.
[0044] Compared with the prior art, the present invention has the following beneficial effects:
[0045] The present invention provides a kit and detection method for identifying Aeromonas victoriae. After the target sequence of the gyrB gene of Aeromonas victoriae is amplified by RPA, the trans-cleavage activity of Cas12a protein is used for fluorescence detection under the guidance of crRNA for on-site rapid detection of Aeromonas victoriae. In the CRISPR / Cas12a system, Cas12a protein recognizes the target sequence and activates its trans-cleavage (trans activity) activity under the action of crRNA (CRISPRRNA). By introducing a fluorescent reporter probe into the system, the information of the sequence to be detected is converted into a fluorescent signal by means of the trans-cleavage activity of Cas12a protein. The synergistic effect of RPA and Cas12a protein realizes the dual amplification of "sequence amplification" and "enzymatic cascade", significantly improving the detection sensitivity and surpassing the effect of traditional qPCR single-stage amplification. Because RPA and CRISPR / Cas12a technologies do not require complicated temperature changes or PCR thermal cycling reactions, they are free from the dependence on precision instruments such as real-time fluorescence PCR instruments, greatly simplifying the detection process. The detection method of the present invention can be completed within 60 minutes, which greatly shortens the detection time and significantly improves the detection efficiency compared with traditional culture, immunology or molecular biology methods.
[0046] 1) High sensitivity: The detection method of the present invention can detect 1 fg / μL of Aeromonas vermiformis, which is more sensitive than PCR and qPCR, and can achieve accurate detection even for low bacterial concentrations.
[0047] 2) Good specificity: The detection method of the present invention has good specificity for Aeromonas vernix and has no cross-reaction with other common aquatic bacterial pathogens such as Edwardsiella piscicida, Aeromonas salmonicida, Vibrio alginolyticus, etc., thus avoiding false positives.
[0048] 3) Easy operation and low cost: The RPA / Cas12a technology eliminates the reliance on specialized instruments and equipment in traditional testing. The constant-temperature reaction process does not require complex instruments, and there is no need to monitor the fluorescence signal in the instrument throughout the process. This greatly simplifies the detection process, significantly reduces the detection cost, and makes on-site testing more convenient and efficient. With these advantages, RPA / Cas12a technology has shown great application potential in the field of rapid on-site detection of pathogens, and is expected to provide strong support for rapid diagnosis and prevention and control.
[0049] In summary, the present invention successfully established an RPA-CRISPR / Cas12a method for detecting Aeromonas vernix by selecting specific target sequences for Aeromonas vernix, designing RPA amplification primers, crRNA, and fluorescent reporter probes. The method has the characteristics of simple operation, rapid detection, significant specificity, and high sensitivity. At the same time, it is not easy to cause cross-contamination during the detection process. It provides reliable technical support for the on-site rapid diagnosis of important bacterial diseases in the field of aquaculture, and is particularly suitable for the real-time detection needs of grassroots laboratories and aquaculture sites. BRIEF DESCRIPTION OF THE DRAWINGS
[0050] Figure 1 Schematic diagram of the standard results of the RPA-CRISPR / Cas12a method for detecting Aeromonas vernix, where P represents a positive test result, N represents a negative test result, and CK represents a blank control test result;
[0051] Figure 2 Schematic diagram of RPA primer screening of the present invention; labels M, 1, 2, 3, 4, 5, and 6 correspond to DNA Marker I, the first group of primers, the negative control of the first group of primers, the second group of primers, the negative control of the second group of primers, the third group of primers, and the negative control of the third group of primers, respectively;
[0052] Figure 3 Schematic diagram of the RPA reaction time optimization results of the present invention, the reaction times are 5min, 10min, 15min, 20min, 25min, and 30min respectively;
[0053] Figure 4 Schematic diagram of the RPA reaction temperature optimization results of the present invention, the reaction temperatures are 30°C, 35°C, 37°C, 39°C, and 41°C respectively;
[0054] Figure 5Schematic diagram of the fluorescence results of the optimization of the concentration ratio of LbCas12a protein and crRNA provided in an embodiment of the present invention; the concentration ratios corresponding to labels 1, 2, 3, 4, and 5 are 1:2, 1:1.5, 1:1, 1:0.8, and 1:0.5, respectively, label 6 is a negative control, and label 7 is a blank control;
[0055] Figure 6 Schematic diagram of the fluorescence results of the optimized concentration ratio of LbCas12a protein and fluorescent reporter probe ssDNA Reporter provided in an embodiment of the present invention; the concentration ratios corresponding to labels 1, 2, 3, 4, and 5 are 1:2, 1:1.5, 1:1, 1:0.8, and 1:0.5, respectively, label 6 is a negative control, label 7 is a blank control, and label P is a positive control;
[0056] Figure 7 Schematic diagram of the sensitivity experimental results of the RPA-CRISPR / Cas12a method of the present invention, wherein A is the detection limit of the Aeromonas vickers PCR method (agarose gel electrophoresis result); CK is the detection limit of the Aeromonas vickers RPA method (agarose gel electrophoresis result); C is the detection limit of the Aeromonas vickers RPA-CRISPR / Cas12a method (fluorescence result); 1-11 are 100 ng / μL, 50 ng / μL, 25 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL genomic templates, respectively, N represents a negative test result, and CK represents a blank control test result;
[0057] Figure 8 Schematic diagram of the specific experimental results detected by the RPA-CRISPR / Cas12a method of the present invention. DETAILED DESCRIPTION
[0058] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention is described in detail below with reference to specific embodiments. It should be noted that the following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.
[0059] Unless otherwise specified, the technical solutions described in the present invention are conventional solutions well known to those skilled in the art; the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.
[0060] The Cas12a protein described in the example is a common commercial product, LbCas12a (Cpf1) nuclease, which and 10× CRISPR reaction buffer were purchased from Shanghai Tolo Port Biotechnology Co., Ltd.; the lyophilized enzyme (taken from a kit with model number WLB8201KIT) and buffer (same model as above) in the RPA amplification reaction were purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd.
[0061] Example 1: Selection of Aeromonas welchii-specific target genes and design of RPA primers and crRNA for CRISPR / Cas12a.
[0062] 1.1 Target selection
[0063] GenBank and Blast analysis identified the Aeromonas veronii gyrB gene as the target gene for identification. This gene sequence exhibits high homology within the species and high specificity between species. To maximize detection accuracy and avoid missed detections, the Aeromonas veronii gyrB gene (shown in SEQ ID NO. 9) was selected as the target gene for RPA amplification primer design and CRISPR-Cas12a detection of Aeromonas veronii.
[0064] 1.2RPA primer design
[0065] Primers were designed using Primer Premier 5.0, referring to the RPA primer design rules in the Twist Amp assay design manual. Three sets of RPA primers were designed and synthesized for Aeromonas vermiformis (see Table 1). RPA amplification was performed according to the reaction system and parameters described in Example 2, and then agarose gel electrophoresis was performed to screen for the most suitable primers. RPA primers must be designed based on the crRNA position to amplify DNA fragments containing the crRNA binding site.
[0066] Table 1 Three groups of RPA primers designed for Aeromonas vernix
[0067]
[0068]
[0069] 1.3 Design of CRISPR / Cas12a crRNA
[0070] The crRNA of Aeromonas victoriae was designed and scored using CRISPOR software, and the crRNA with the highest score was selected based on factors such as off-target risk and amplification efficiency. RPA isothermal amplification primers were designed based on the position of crRNA, and a fragment containing the crRNA binding site was amplified inside the product. The specific sequence information of the crRNA (gyrB-crRNA) designed for Aeromonas victoriae by the present invention is shown in Table 2.
[0071] Table 2 crRNA designed for Aeromonas viridis by the present invention
[0072]
[0073] In the present invention, the Aeromonas veseri gyrB gene has a sequence as shown in SEQ ID No. 9, respectively; wherein the underlined portion in the sequence is the PAM site required for the LbCas12a protein to bind to the crRNA.
[0074] The fluorescent reporter probe ssDNA Reporter has a nucleotide sequence as shown in SEQ ID No. 4:
[0075] 5'-FAM-TTTTTATTTTT-BHQ1-3'
[0076] Example 2: RPA primer screening and RPA reaction system optimization and establishment
[0077] This example screened the optimal primers for RPA amplification of the Aeromonas gyrB gene designed in Example 1 and optimized the RPA reaction temperature and reaction time. RPA amplification reaction conditions are one of the important factors affecting the detection efficiency of the subsequent CRISPR / Cas12a system. The present invention designed three pairs of RPA primers for this pathogen, each pair of primers covering the crRNA binding site.
[0078] 2.1RPA Primer Screening
[0079] The three groups of RPA primers designed for Aeromonas vernix in Example 1 were screened.
[0080] In this embodiment, the RPA amplification reaction uses a 50 μL system, including the following components: lyophilized enzyme (1 tube), buffer 29.4 μL, forward primer (gyrB-F1, gyrB-F2, gyrB-F3 in Table 1, added separately, 10 μM) 2 μL, reverse primer (gyrB-R1, gyrB-R2, gyrB-R3, and gyrB-F in Table 1, added correspondingly, 10 μM) 2 μL, template 2.0 μL, ddH2O 13.1 μL, 2.5 μL magnesium acetate (280 mM). Among them, the template is extracted Aeromonas vernix genomic DNA (the target gene fragment is shown in SEQ ID No. 9, and the theoretical fragment after amplification is shown in SEQ ID NO. 12), and the concentration is preferably 20 ng / μL.
[0081] RPA amplification reaction parameters: incubate at 37°C for 20 min.
[0082] After amplification, the RPA amplification product is mixed with DNA loading buffer (6X) at a volume ratio of 5:1 and then subjected to agarose gel electrophoresis. The concentration of the agarose gel used for electrophoresis is preferably 2% (W / V), the electrophoresis voltage is preferably 150V, and the electrophoresis time is preferably 30min. The optimal primers are selected based on the electrophoresis results. Figure 2 As shown, the three groups of negative controls (labeled 2, 4, and 6 in the figure) all had very dark bands or no bands. The electrophoresis bands of the products amplified by the RPA primers in group 1 (labeled 1) were the clearest and brightest, with less tailing, compared with those in groups 2 and 3 (labeled 3 and 5). Therefore, group 1 RPA primers were selected for subsequent experiments.
[0083] 2.2RPA amplification time optimization
[0084] The aforementioned reaction system and detection method were used, with a reaction temperature of 37°C and reaction times set to 5, 10, 15, 20, 25, and 30 minutes. The target bands of the amplified products at different reaction times were compared by agarose gel electrophoresis to identify the most suitable reaction time.
[0085] The results are as follows Figure 3 As shown in the figure, the band brightness is optimal when the RPA reaction is carried out for 20 minutes, so the optimal reaction time for RPA amplification is determined to be 20 minutes.
[0086] 2.3 RPA amplification temperature optimization
[0087] The aforementioned reaction system and detection method were selected, with a reaction time of 20 min and reaction temperatures set at 30°C, 35°C, 37°C, 39°C, and 41°C. The target bands of the amplified products at different reaction times were compared by agarose gel electrophoresis to screen for the most suitable reaction time.
[0088] The results are as follows Figure 4 As shown in the figure, the band brightness of RPA reaction is the best at the amplification temperature of 37°C, so the optimal reaction temperature for RPA amplification is determined to be 37°C.
[0089] Example 3: Optimization and establishment of CRISPR / Cas12a reaction system
[0090] The CRISPR / Cas12a detection system includes three important components: Cas12a protein, crRNA, and fluorescent reporter molecule ssDNA Reporter. This embodiment optimizes each component to maximize detection efficiency and reduce detection costs. The crRNA and ssDNA Reporter designed in Example 1 were used to optimize the CRISPR / Cas12a reaction system. The optimized groups are shown in Tables 3 and 4.
[0091] Test results such as Figure 5 、 6 As shown, Figure 5 It is the result of optimizing the concentration ratio of Cas12a to crRNA. Figure 6 It is the optimization result of the concentration ratio of Cas12a to ssDNA Reporter. The optimization results show that in the present invention, when the final concentration ratio of Cas12a protein to crRNA is 1: 1, the final concentration ratio of Cas12a protein to fluorescent reporter molecule ssDNA Reporter is 1: 0.8, and the fluorescence is significant, and there is almost no difference with the higher concentration group. Therefore, after comprehensively considering the detection efficiency and cost, the above concentration ratio is determined to be the optimal reaction condition.
[0092] Table 3 Optimization of Cas12a protein and crRNA concentration ratio
[0093]
[0094] Table 4 Optimization of the concentration ratio of Cas12a protein and fluorescent reporter molecule ssDNA Reporter
[0095]
[0096]
[0097] In summary, the RPA-CRISPR / Cas12a detection method of the present invention combines RPA amplification and Cas12a detection. After optimization of RPA primers for Aeromonas vermiformis, subsequent experiments were carried out using the first group of RPA primers (gyrB-F1 / R1) designed in Example 1. The total volume of the RPA reaction system was 50 μL, including lyophilized enzyme (1 tube), 2 μL each of upstream and downstream primers (10 μM), 29.4 μL of RPA reaction buffer, 2.5 μL of magnesium acetate (280 mM), 2.0 μL of genomic DNA, and the remaining volume was supplemented by nuclease-free water.
[0098] The RPA amplification reaction procedure was to incubate at a constant temperature of 37°C for 20 min. After the RPA reaction was completed, 2 μL of RPA amplification product was taken and added to 20 μL of CRISPR / Cas12a reaction system for further detection.
[0099] After optimization in this example, it was finally determined that the 20 μL CRISPR / Cas12a reaction system included the following components: 2 μL of 10×CRISPR reaction buffer, 0.5 μL of LbCas12a protein (10 μM), 0.5 μL of crRNA (10 μM), 0.4 μL of fluorescent reporter probe ssDNA Reporter (10 μM), 2.0 μL of RPA amplification product, and 14.6 μL of nuclease-free water.
[0100] The CRISPR / Cas12a reaction and detection procedures were as follows: constant temperature reaction at 37°C for 40 min, followed by fluorescence detection of the amplified product using a handheld blue light flashlight (475 nm, 10 W).
[0101] Example 4: Sensitivity analysis of Aeromonas veseri detection based on RPA-CRISPR / Cas12a method
[0102] The extracted Aeromonas wilkenbergii genomic DNA was diluted to obtain genomic templates with concentrations of 100 ng / μL, 50 ng / μL, 25 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, 10 fg / μL, and 1 fg / μL, respectively. A sensitivity experiment was performed using the RPA-CRISPR / Cas12a optimal reaction system obtained in Example 3. At the same time, this example also used PCR and RPA methods for comparison to further evaluate the sensitivity of detection by this method.
[0103] Table 5 PCR primers for Aeromonas victoriae of the present invention
[0104]
[0105] The preferred PCR primer information in this embodiment is shown in Table 5. The reaction system for PCR detection is 20 μL, including the following components: 10 μL of 2×Taq PCR Mix (GenStar), 1 μL of upstream and downstream primers, 1.0 μL of the above-extracted DNA genome, and 7.0 μL of ddH2O; the concentrations of the upstream and downstream primers are preferably 10 μM, respectively. The reaction procedure is denaturation at 95°C for 5 minutes, followed by 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 35 seconds, and finally extension at 72°C for 5 minutes, and storage at 4°C for later use. The PCR amplification product is detected and verified by 2% (W / V) agarose gel electrophoresis. The electrophoresis voltage is preferably 150 V, and the electrophoresis time is preferably 30 minutes.
[0106] In this embodiment, the RPA-CRISPR / Cas12a reaction adopts the optimal system and conditions obtained by screening in Example 2. After amplification, the product is mixed with DNA loading buffer (6X) in a volume ratio of 5:1 and then subjected to agarose gel electrophoresis. The concentration of agarose gel used for electrophoresis is preferably 2% (W / V), the electrophoresis voltage is preferably 150 V, and the electrophoresis time is preferably 30 min.
[0107] Test results such as Figure 7 As shown, based on the fluorescence difference between the experimental group and the negative control, it was determined that the detection limit of the RPA-CRISPR / Cas12a method for detecting Aeromonas victoria could reach 1 fg / μL; while the detection limits of the PCR method and the RPA method were 100 pg / μL and 10 fg / μL, respectively, which were higher than the detection limit of this method, indicating that the RPA-CRISPR / Cas12a method provided by the present invention has excellent detection sensitivity.
[0108] Example 5: Specificity analysis of Aeromonas veseri detected based on RPA-CRISPR / Cas12a method
[0109] According to the optimal RPA-CRISPR / Cas12a reaction system and conditions in Example 3, Aeromonas vernix and several other common aquatic pathogens were simultaneously detected by RPA-CRISPR / Cas12a to evaluate the specificity of the RPA-CRISPR / Cas12a method provided by the present invention for detecting Aeromonas vernix.
[0110] In this embodiment, other aquatic pathogens selected include: Edwardsiella piscicida (CCTCC M208068), infectious spleen and kidney necrosis virus (ISKNV), Photobacterium damselae (ST1), Nocardia seriolae (N.99001), Vibrio anguillarum (MVM425), and Vibrio alginolyticus (CCTCC 209169).
[0111] Test results such as Figure 8 As shown, in the specific detection of Aeromonas wilkenbergii, only the corresponding target pathogen group produced strong fluorescence, while other pathogen groups did not show obvious fluorescence, which shows that the RPA-CRISPR / Cas12a detection method of the present invention has reliable specificity and has no cross-reaction with pathogens other than the target pathogen.
[0112] In summary, the RPA-CRISPR / Cas12a detection method provided by the present invention shows excellent detection efficiency in the detection of Aeromonas vermiformis, with a detection limit as low as 1 fg / μL, strong reaction specificity, simple operation without the need for complex instruments, and visualized result interpretation, so that personnel without any professional knowledge or technical background can easily complete the detection, meeting the needs of first-line aquaculture enterprises, farmers and grassroots laboratories for real-time diagnosis and early warning of aquaculture diseases.
[0113] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.
[0114] The sequences involved in the embodiments of the present invention are as follows:
[0115] SEQ ID NO.9 (Aeromonas wilkenbergii gyrB gene sequence, 1141 bp)
[0116] GGTATCCGGCGGCCTGCACGGCGTGGGTGTCTCGGTAGTTAACGCCCTCT
[0117] CTGACAAGCTGTTGCTGACCATTCGTCGTAACGGTCACGTCTACGAGCAGACC
[0118] TATCATCTGGGTGAGCCACAGGCGCCGCTCAAGCAGATTGGCGACAGCACCG
[0119] GTACCGGTACCGAAGTTCGCTTCTGGCCGAGCCCGGCCATTTTCAGCGATACC
[0120] CTGTTCCATTACGAGATCTTGGCCAAGCGCCTGCGCGAGCTCTCCTTCCTCAA
[0121] CTCCGGTGTCTCCATCCGTCTGCAAGACGAGCGTGATGGCCGCGAGGCGCA TT
[0122] TC TGCTACGAGGGTGGCATCAAGGCATTCGTTGAATACCTGAACCAGAACAA
[0123] GACCCCGATCCACCCGAAGGTGTTCCATTTCACCACCGAGCAGGATGGTATCG
[0124] GCGTGGAAGTGGCGATGCAGTGGAACGACGCCTATCAGGAAGGGGTCTACTG
[0125] CTTCACCAACAACATCCCGCAGCGGGATGGTGGTACTCACCTCGTTGGTTTCC
[0126] GTACCGCGCTGACCCGTACTCTGAACTCCTATATGGACAAAGAGGACTACAG
[0127] CAAGAAGGCCAAGTCTGCCGCCAGTGGCGACGACGTGCGTGAAGGTCTGATT
[0128] GCCGTTATCTCCGTGAAGGTGCCGGATCCCAAGTTCTCATCCCAGACCAAAGA
[0129] CAAGCTGGTCTCTTCCGAAGTGAAGACCGCCGTTGAACAGGCGATGGGTGAG
[0130] AAGCTGGCTGACTTCCTGCTGGAAAACCCGGGCGATGCCAAGATCGTGGTCA
[0131] ACAAGATCATCGATGCGGCCCGTGCCCGCGAAGCGGCCCGCAAGGCTCGCGA
[0132] ACTGACCCGCCGCAAAGGCGCGCTGGATATCGCCGGTCTGCCCGGCAAGCTG
[0133] GCTGACTGTCAGGAAAAAGACCCAGCTCTCTCCGAACTCTACATAGTGGAAG
[0134] GGGACTCTGCTGGCGGTTCTGCCAAGCAGGGCCGCAACCGGAAGAACCAGGC
[0135] CATCCTGCCGCTCAAGGGTAAAATCCTGAACGTGGAGAAGGCCCGTTTCGAC
[0136] AAGATGATCTCCTCGCAAGAGGTGGGCACCCTGATCACCGCACTGGGTTGCG
[0137] GTATCGGTCGCGACGAGTACAACCCGGACAAGCTGCGCTATCAC
[0138] SEQ ID NO.12 (RPA amplification sequence of Aeromonas veronii gyrB gene, 227bp):
[0139] TGTTCCATTACGAGATCTTGGCCAAGCGCCTGCGCGAGCTCTCCTTCCTCAACTCCGGTGTCTCCATCCGTCTGCAAGACGAGCGTGATGGCCGCGAGGCGCATTTCTGCTACGAGGGTGGCATCAAGGCATTCGTTGAATACCTGAACCAGAACAAGACCCCGATCCACCCGAAGGTGTTCCATTTCACCACCGAGCAGGATGGTATCGGCGTGGAAGTGGCGATG。
Claims
1. A composition for identifying Aeromonas vermiformis, characterized in that: The composition includes: specific primers for detecting the gyrB gene of Aeromonas veseri based on RPA-CRISPR / Cas12a, Cas12a protein, crRNA, and a fluorescent reporter probe ssDNAReporter; The specific primers include: an upstream primer gyrB-F of the gyrB gene of Aeromonas virginiana and a downstream primer gyrB-R of the gyrB gene of Aeromonas virginiana: The nucleotide sequence of the upstream primer gyrB-F of the Aeromonas visneri gyrB gene is shown in SEQ ID No. 1, and the nucleotide sequence of the downstream primer gyrB-R of the Aeromonas visneri gyrB gene is shown in SEQ ID No. 2, or, The nucleotide sequence of the upstream primer gyrB-F of the Aeromonas victoriae gyrB gene is shown in SEQ ID No. 5, and the nucleotide sequence of the downstream primer gyrB-R of the Aeromonas victoriae gyrB gene is shown in SEQ ID No. 6, or, The nucleotide sequence of the upstream primer gyrB-F of the Aeromonas virginiana gyrB gene is shown in SEQ ID No. 7, and the nucleotide sequence of the downstream primer gyrB-R of the Aeromonas virginiana gyrB gene is shown in SEQ ID No. 8; The crRNA targets the gyrB gene of Aeromonas veseri, and the nucleotide sequence is shown in SEQ ID No. 3; The nucleotide sequence of the fluorescent reporter probe ssDNA Reporter is shown in SEQ ID No.
4.
2. A kit for identifying Aeromonas vermiformis, characterized in that: The invention comprises the composition for identifying Aeromonas veroni as claimed in claim 1.
3. A kit for identifying Aeromonas vernix according to claim 2, characterized in that: The kit also includes lyophilized enzyme, RPA reaction buffer, magnesium acetate, CRISPR reaction buffer, nuclease-free water, healthy sea bass tissue genomic DNA, and Aeromonas vernix genomic DNA.
4. A kit for identifying Aeromonas vernix according to claim 3, characterized in that: The concentration of the magnesium acetate is 150-400 mM; the CRISPR reaction buffer is 10×CRISPR reaction buffer; the nuclease-free water is used as a solvent or a blank control; the healthy sea bass tissue genomic DNA is used as a negative control; and the Aeromonas vernix genomic DNA is used as a positive control.
5. A detection method for identifying Aeromonas vernix, based on the kit according to claim 2, characterized in that: The method comprises: S1. Extraction of genomic DNA from samples: Take the sample to be tested and extract the genomic DNA from the sample; S2. RPA amplification: Using the upstream primer gyrB-F for Aeromonas vernix and the downstream primer gyrB-R for Aeromonas vernix, amplify the genomic DNA of the sample to be tested, extracted in step S1, by RPA to obtain an RPA amplification product. Simultaneously, nuclease-free water was used as a blank control, genomic DNA from healthy sea bass tissue was used as a negative control, and genomic DNA from Aeromonas vernix was used as a positive control, all treated in the same manner as the sample genomic DNA. S3. CRISPR / Cas12a detection: After the reaction in step S2 is completed, take 2 μL of the RPA amplification product in step S2 and add it to a 20 μL CRISPR / Cas12a reaction system for subsequent detection. The CRISPR / Cas12a reaction system includes: CRISPR reaction buffer, fluorescent reporter probe ssDNA Reporter, Cas12a protein, crRNA, and nuclease-free water; S4. Interpretation of test results: The color of the reaction solution after irradiation is used as the standard. If the color is similar to that of the blank control and negative control and both are colorless, it is negative; if the color is green, it is positive.
6. A detection method for identifying Aeromonas vernix according to claim 5, characterized in that: The RPA amplification reaction system described in step S2 is composed of the following: a total volume of 50 μL, including 1 tube of lyophilized enzyme, 2 μL each of the Aeromonas victoriae upstream primer gyrB-F and the Aeromonas victoriae downstream primer gyrB-R, 29.4 μL of RPA reaction buffer, 2.5 μL of magnesium acetate, 2.0 μL of genomic DNA, and the remaining volume is made up by nuclease-free water.
7. A detection method for identifying Aeromonas vernix according to claim 6, characterized in that: The concentration of the primers is 5-20 μM; the concentration of the Aeromonas wilkenbergii genomic DNA is 10-100 ng / μL; and the RPA amplification procedure is a constant temperature reaction at 30-41° C. for 10-30 minutes.
8. A detection method for identifying Aeromonas vernix according to claim 5, characterized in that: The final concentration ratio of the Cas12a protein and crRNA in the system in step S3 is 1: (0.5-2); the final concentration ratio of the Cas12a protein and the fluorescent reporter molecule ssDNA Reporter in the system is 1: (0.5-2).
9. A detection method for identifying Aeromonas vernix according to claim 5, characterized in that: The CRISPR / Cas12a reaction and detection procedures described in step S3 are as follows: the reaction system is kept at a constant temperature of 35-39°C for 30-50 minutes, and then the amplified product is fluorescently detected using blue light.
10. Use of the kit according to any one of claims 2 to 4 or the detection method according to any one of claims 5 to 9, characterized in that: Used for the detection of fish pathogens in marine aquaculture.
Citation Information
Patent Citations
A kind of test kit and method for detecting Aeromonas viridis
CN105506153B
Detection method of aeromonas veronii
CN116875715A