Thrombus diagnosis and treatment method for detecting thrombus drug resistance and performing accurate medication
By using the nano-diagnosis and treatment system to target and identify thrombus components, detect changes in the structure of nucleic acid aptamers, and establish a correspondence between signal intensity and drug resistance, the problems of low thrombolytic efficiency and high bleeding risk in existing technologies are solved, and precise medication and safe and effective thrombolytic therapy are achieved.
Patent Information
- Application Number
- CN202510923992.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-04
- Publication Date
- 2025-09-26
AI Technical Summary
Existing technologies are unable to effectively diagnose resistance to thrombotic drugs, resulting in low efficiency of thrombolytic therapy and high risk of bleeding, making it impossible to use medication accurately.
By using a nano-diagnostic and therapeutic system, we can target and identify thrombus components and detect changes in the structure of nucleic acid aptamers to establish a correspondence between thrombus drug resistance and signal intensity, and adjust the dosage and release rate of thrombolytic drugs to achieve precise medication.
It improves the thrombolytic efficiency, reduces the risk of bleeding, and achieves precise treatment of thrombotic diseases.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of thrombosis drug resistance detection, and in particular to a thrombosis diagnosis and treatment method for detecting thrombosis drug resistance and performing precise medication. Background Art
[0002] Thrombotic diseases pose a serious threat to human health and life. The morbidity and mortality rates of heart attacks and cerebral infarctions caused by them are not only high, but also extremely short treatment windows, which greatly limits the effectiveness of clinical treatment. Currently, intravenous thrombolysis is the first-line clinical treatment for thrombotic diseases such as stroke. Although thrombolytic drugs have undergone numerous upgrades and have made some progress in improving efficacy and controlling side effects, clinical research data show that the proportion of patients who actually benefit from intravenous thrombolysis is still less than 5%, and more effective diagnostic and treatment methods are urgently needed. Thrombolytic efficiency and drug side effects are key factors that restrict the effectiveness of intravenous thrombolytic therapy. On the one hand, existing clinical thrombolytic drugs have problems such as poor targeting, short half-life, and single target. In particular, there is a lack of effective targets for refractory thrombi, making it difficult to achieve timely, accurate, and efficient dissolution of refractory thrombi within a limited time. On the other hand, the current dosage of intravenous thrombolytic drugs is mainly calculated based on the patient's weight. However, thrombi have significant heterogeneity, and their composition is the core factor that determines the degree of thrombus solubility. At the same time, thrombolytic drugs have a high risk of post-thrombolytic bleeding, and this risk is directly related to the dosage. This means that patients with similar weight but different degrees of thrombus solubility face a higher risk of bleeding. The main reason for this dilemma is the lack of effective diagnostic methods for thrombotic drug resistance, which makes it impossible to accurately use drugs according to the actual state of the thrombus. In the diagnosis of thrombotic diseases, currently commonly used imaging methods such as CT and DSA can only roughly determine the presence and size of thrombi, but it is difficult to provide a detailed description of the biochemical markers of thrombi. Although blood diagnosis, as a widely used and highly accessible diagnostic technology, has the potential to detect thrombotic status, sufficiently specific blood markers for thrombosis diagnosis have not yet been developed. Therefore, developing a method that can accurately diagnose thrombotic drug resistance, thereby enabling precise medication and safer and more effective thrombolytic therapy, is of great significance and value for clinical application. Summary of the Invention
[0003] The present invention aims to provide a method for diagnosing and treating thrombosis by detecting thrombotic drug resistance and performing precise medication, so as to solve the technical problem that the existing technology cannot diagnose thrombotic drug resistance, resulting in low thrombolytic treatment efficiency and high bleeding risk.
[0004] To achieve the above objectives, the present invention adopts the following technical solution: a method for diagnosing and treating thrombosis for detecting thrombotic drug resistance and performing precise medication, comprising the following steps: Step (1), design and construction of a nano-diagnosis and treatment system: synthesize drug-loaded nanomaterials, load thrombolytic drugs through mixed incubation, and modify the surface of the nanomaterials with functional nucleic acid structures that can interact with markers in thrombi and release free DNA to obtain a nano-diagnosis and treatment system; Step (2), thrombotic drug resistance detection: a capture nucleic acid chain modified with an optical signal reporter molecule is bound to the surface of a sensing nanomaterial to obtain a detection nanostructure, and then the nanodiagnosis and treatment system is injected into the body to identify the thrombus and interact with it, and then blood is drawn to mix with the detection nanostructure and react, and the optical signal is measured to obtain the detection result; Step (3), precise thrombolytic drug treatment: compare the optical detection results obtained in step (2) with the standard curve, calculate and obtain the thrombotic drug resistance, and adjust the treatment intensity according to the thrombotic drug resistance to perform precise thrombolysis.
[0005] Preferably, as an improvement, in step (1), the drug-loaded nanomaterial refers to a nanomaterial that can load or adsorb thrombolytic drugs, including any one of polymer nanomaterials and inorganic nanomaterials.
[0006] Preferably, as an improvement, in step (1), the marker in the thrombus refers to a marker that is specifically and highly expressed in the thrombus, including thrombin or p-selectin; the functional nucleic acid structure refers to a base sequence that can undergo structural changes and release free nucleic acid chains after specifically reacting with the marker in the thrombus, including any one of AGTCCGTGGTAGGGCAGGTTGGGGTGACT, GGTTGGTGTGGTTGG, GGCTCCTGCAGGTCGGCTGGGGGGGGGGGGCATGGGTAGTTAGGTGGTGATGGTGG.
[0007] Preferably, as an improvement, in step (2), the optical signal reporter molecule refers to a molecular structure that can generate a characteristic optical signal after excitation, including any one of 5,5'-dithiobis(2-nitrobenzoic acid), rhodamine 6G, and methylene blue; the capture nucleic acid chain is a base sequence modified with a specific optical reporter molecule and capable of specifically hybridizing and binding to a free nucleic acid chain, including any one of AGTCAGGGGGTTGGACGGGATGGTGGCTGA, CCAACCACACCAACC, CCACCATAGTCCACCTACTGGGCCCCCCCCCCGAGCCGACCTGCAGGAGCC.
[0008] Preferably, as an improvement, in step (2), the sensing nanomaterial refers to a nanomaterial that can enhance or weaken the optical signal of an optical reporter molecule adsorbed on its surface, including any one of gold nanomaterials and silver nanomaterials.
[0009] Preferably, as an improvement, in step (2), the blood drawn is a blood sample obtained from the body more than 5 minutes after intravenous injection of the nano-diagnosis and treatment system, and the detection result refers to the measured characteristic optical signal intensity.
[0010] Preferably, as an improvement, in step (3), the standard curve refers to a corresponding relationship curve between thrombus drug resistance and signal intensity established by treating thrombi with known different drug resistances using a nano-diagnosis and treatment system and detecting signal intensity.
[0011] Preferably, as an improvement, in step (3), regulating the treatment intensity refers to regulating the drug dosage or regulating the drug release rate or taking other methods that affect the thrombolytic efficacy.
[0012] Preferably, as an improvement, in step (2) and step (3), the thrombotic drug resistance refers to the sensitivity of thrombus in patients with thrombotic diseases to drug thrombolysis.
[0013] The principles and advantages of this solution are: 1. Compared with the existing technology that cannot adapt to thrombotic drug resistance, this solution uses nanomaterials as carriers and constructs a nano-diagnosis and treatment system through functional modifications such as targeted recognition, response changes and thrombolytic drugs. The interaction between the nano-diagnosis and treatment system and the thrombus components can cause changes in the structure of the nucleic acid aptamer therein. The interaction strength and efficiency of the nano-diagnosis and treatment system vary depending on the thrombus with different drug resistance under the action of thrombolytic drugs. Therefore, the thrombotic drug resistance is detected by the change of the nucleic acid aptamer structure, and the treatment intensity is adjusted according to the difference in drug resistance to match the thrombolysis needs for precise thrombolysis.
[0014] 2. This program can solve practical clinical problems in existing thrombolytic therapy, such as low thrombolytic recanalization efficiency and high risk of post-thrombolytic bleeding, caused by poor compatibility between drug dosage and thrombus characteristics, by diagnosing differences in thrombotic drug resistance and providing precise medication. It is of great significance for improving clinical thrombolytic efficiency, reducing bleeding side effects after thrombolytic therapy, and improving the accuracy of clinical medication. It has important application value and prospects in clinical application.
[0015] 3. There is no detection technology for diagnosing thrombotic drug resistance in the existing technology. The nano-diagnostic and therapeutic system proposed in this scheme can obtain thrombotic drug resistance based on blood diagnosis by interacting with thrombus. It can solve the clinical problem that the inability to obtain thrombotic drug resistance leads to the fact that drug dosage and treatment intensity can only be evaluated based on body weight.
[0016] 4. Clinical drug thrombolysis in existing technologies has the limitations of low efficiency and high bleeding risk. The nano-diagnosis and treatment system proposed in this scheme can be based on targeted identification and thrombosis drug resistance diagnosis, and accurately adjust the drug dosage and treatment intensity according to the characteristics of the thrombus, which can improve the thrombolysis efficiency and reduce the risk of bleeding caused by drugs.
[0017] 5. Compared with the imaging methods currently used in clinical practice, the thrombus drug resistance diagnostic method proposed in the present invention has the advantages of being fast, efficient, and highly accessible. It can not only directly achieve precise thrombolysis through the nano-diagnosis and treatment system, but can also be used in combination with clinical drug treatment, and has high universality. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the process of the thrombosis diagnosis and treatment method for detecting thrombotic drug resistance and performing precise medication in an embodiment of the present invention (including the construction of nano-diagnostic and therapeutic reagents, the construction of blood sensor diagnostic structure and the application path).
[0019] Figure 2 This is a scanning electron microscope image of the polydopamine nanodiagnostic and therapeutic system constructed in Example 1 of the present invention.
[0020] Figure 3 This is a representative Raman spectrum obtained by detecting thrombotic drug resistance using surface-enhanced Raman spectroscopy in Example 1 of the present invention.
[0021] Figure 4 This is the corresponding relationship between drug resistance and signal intensity detected in Example 1 of the present invention (i.e., standard curve).
[0022] Figure 5 This is a diagram showing the thrombolytic effect after precise treatment in Example 1 of the present invention.
[0023] Figure 6 This is a diagram showing the thrombolytic effect after precise treatment in Example 2 of the present invention.
[0024] Figure 7 Comparison of bleeding conditions between the precision treatment of Example 3 of the present invention (left) and the conventional weight-based drug administration in clinical practice (right) (HE staining results of sections after cerebral thrombosis treatment). DETAILED DESCRIPTION
[0025] The present invention will be further described in detail below with reference to the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used are all commercially available.
[0026] Program Overview This protocol provides a method for diagnosing and treating thrombosis by detecting drug resistance and accurately administering drugs. The flowchart is basically as follows: Figure 1 As shown: The following steps are included: Step (1), design and construction of a nano-diagnosis and treatment system: synthesize drug-loaded nanomaterials, load thrombolytic drugs through mixed incubation, and modify the surface of the nanomaterials with functional nucleic acid structures that can interact with markers in thrombi and release free DNA to obtain a nano-diagnosis and treatment system; Among them, drug-loaded nanomaterials refer to nanomaterials that can load or adsorb thrombolytic drugs, including any one of polymer nanomaterials and inorganic nanomaterials.
[0027] Thrombus markers refer to markers that are specifically and highly expressed in thrombus, including thrombin or p-selectin.
[0028] The functional nucleic acid structure refers to a base sequence that can specifically react with markers in the thrombus to undergo structural changes and release free nucleic acid chains, including any one of AGTCCGTGGTAGGGCAGGTTGGGGTGACT, GGTTGGTGTGGTTGG, GGCTCCTGCAGGTCGGCTGGGGGGGGGGGGCA TGGGTAGTTAGGTGGTGATGGTGG.
[0029] This solution also provides a nano-diagnosis and treatment system, which is prepared using the above steps.
[0030] Step (2), thrombotic drug resistance detection: a capture nucleic acid chain modified with an optical signal reporter molecule is bound to the surface of a sensing nanomaterial to obtain a detection nanostructure, and then the nanodiagnosis and treatment system is injected into the body to identify the thrombus and interact with it, and then blood is drawn to mix with the detection nanostructure and react, and the optical signal is measured to obtain the detection result; Among them, the optical signal reporter molecule refers to a molecular structure that can generate a characteristic optical signal after excitation, including any one of the Raman scattering signal molecules 5,5'-dithiobis(2-nitrobenzoic acid), rhodamine 6G, and methylene blue; the capture nucleic acid chain is a base sequence modified with a specific optical reporter molecule and capable of specifically hybridizing and binding to a free nucleic acid chain, including any one of AGTCAGGGGGTTGGACGGGATGGTGGCTGA, CCAACCACACCAACC, CCACCATAGTCCACCTACTGGGCCCCCCCCCCGA GCCGACCTGCAGGAGCC.
[0031] Sensing nanomaterials refer to nanomaterials that can enhance or weaken the optical signals of optical reporter molecules adsorbed on their surfaces, including any one of gold nanomaterials and silver nanomaterials.
[0032] The blood draw refers to a blood sample obtained from the body at an interval of more than 5 minutes after intravenous injection of the nano-diagnostic and therapeutic system, and the test result refers to the measured characteristic optical signal intensity.
[0033] Step (3), precise thrombolytic drug treatment: compare the optical detection results obtained in step (2) with the standard curve, calculate and obtain the thrombotic drug resistance, and adjust the treatment intensity according to the thrombotic drug resistance to perform precise thrombolysis.
[0034] Among them, the standard curve refers to the correspondence curve between thrombus drug resistance and signal intensity established by using the nano-diagnosis and treatment system to treat thrombi with different known drug resistance and detect the signal intensity.
[0035] Adjusting the intensity of treatment refers to adjusting the drug dosage or drug release rate or taking other methods to affect the efficacy of thrombolysis.
[0036] Thrombotic drug resistance refers to the sensitivity of thrombus to thrombolytic drugs in patients with thrombotic diseases.
[0037] This solution also provides a thrombosis diagnosis and treatment method for detecting thrombotic drug resistance and performing precise medication, which is used to improve the accuracy of thrombosis treatment.
[0038] Example 1 This example uses nanomaterials loaded with clinical drugs, combining nanophotothermal therapy with drug therapy. Specifically, it includes the following: 1. Synthesis of polydopamine nanomaterials 0.3 g of dopamine hydrochloride and 0.2 g of polyoxyethylene-polyoxypropylene-polyoxyethylene (PEO-PPO-PEO) copolymer (F127) were dissolved in a mixture of deionized water (10 ml) and ethanol (10 ml). 320 μL of trimethylolpropane was added and sonicated for 5 minutes. 750 μL of ammonia solution was slowly added dropwise while stirring. After reacting for 1 hour, the resulting solution was centrifuged at 10,000 rpm for 30 minutes and washed three times with deionized water and three times with ethanol.
[0039] 2. Preparation of gold and silver core-shell nanoparticles 4.7 mL of 100 mM CTAB solution was mixed with 5 μL of 10% chloroauric acid and stirred for 2 minutes. Then, 300 μL of 30 mM sodium borohydride solution was quickly added at 32°C. After vigorous stirring for 2 minutes, the mixture was allowed to stand for 30 minutes to form gold seeds. Subsequently, 4 mL of 200 mM CTAC solution, 3 mL of 100 mM ascorbic acid (AA), and 100 μL of the aforementioned gold seed solution were mixed at 25°C. 4 mL of 0.5 mM chloroauric acid solution was added. After stirring for 30 minutes, the mixture was centrifuged and resuspended in 1 mL of 10 mM CTAC solution to obtain secondary gold nanoparticles.
[0040] Next, 24 mL of 200 mM CTAC solution, 260 μL of 1 M AA solution, and 56 mL of deionized water were mixed with 1 mL of the aforementioned gold nanoparticle solution at 45°C. A 1 mM chloroauric acid solution (dissolved in 10 mM CTAC solution) was added dropwise over 60 minutes, and the color change was observed. The resulting solution was centrifuged twice and resuspended in 10 mL of 10 mM CTAC solution to serve as a template for silver shell growth.
[0041] Subsequently, equal volumes of 5 mM silver nitrate solution and 20 mM CTAC solution were mixed, and the previously obtained gold nanoparticle solution was added, and 100 mM AA solution was added dropwise. After heating and stirring at 60°C for 1 h, the mixture was centrifuged twice to purify the gold-silver core-shell nanostructure.
[0042] 3. Construction of polydopamine nanodiagnostic and therapeutic system The thiol-modified thrombin-targeting aptamer sequence Apt (GGTTGGTGTGGTTGG in this example) was first activated with TCEP hydrochloride at a molar ratio of 1:400. Polydopamine (PDA) nanoparticles were then added and shaken for 6 hours. After centrifugation (10,000 rpm for 10 minutes) and resuspending in PBS, the Apt-modified PDA nanoparticles were mixed with urokinase for 12 hours to complete drug loading. The thiol-complementary sequence Com (CCAACCACACCAACC in this example) of Apt was then incubated with gold and silver core-shell nanoparticles in a pH 3 citric acid-hydrochloric acid buffer for 20 minutes for labeling. The nanoparticles were then incubated with the drug-loaded nanocarrier for 12 hours to block drug leakage.
[0043] The scanning electron microscope image of the polydopamine nanodiagnostic system constructed in this embodiment is as follows: Figure 2 As shown in the figure, the nanostructured particles are spherical in shape, with relatively uniform size and an average particle size of about 200 nm.
[0044] 4. Preparation of sensing structure A glass slide modified with polydiallyldimethylammonium chloride (PDDA) was immersed in a solution of gold and silver core-shell nanoparticles for 2 hours. The solution was then removed and the slide was rinsed with ultrapure water. The slide was then immersed in a solution of thiol-modified single-chain apt for 1 hour. The solution was removed and the slide was rinsed with PBS. Finally, the slide was immersed in a solution of 5,5'-dithiobis(2-nitrobenzoic acid) and rinsed with PBS to obtain the sensing structure.
[0045] 5. Detection of thrombus resistance The polydopamine nanodiagnostic system was injected into the body through the vein (carotid artery thrombosis model). After the nanodiagnostic system targeted and interacted with the thrombus for 10 minutes, a blood sample was drawn and dripped onto the glass slide with the sensing nanostructure and reacted for 15 minutes. The Raman signal was detected by Raman spectrometer. The results are as follows Figure 3 As shown in the figure, 1333cm -1 The typical characteristic spectral peak of DTNB substance can be seen at the bottom. The detection intensity of this peak corresponds to the resistance of thrombotic drugs and can be used for diagnostic evaluation.
[0046] The corresponding thrombus is removed and treated with thrombolytic drugs. The actual drug resistance of the thrombus is determined by the thrombolytic efficiency. A standard curve is established between signal intensity and thrombus drug resistance. Based on this standard curve, the actual signal intensity obtained during the test is used to determine the drug resistance of the thrombus.
[0047] Specifically, the corresponding relationship and linear fitting curve are established between the signal intensity of the characteristic peak of the surface enhanced Raman spectrum measured for different thrombi and the thrombotic drug Kangxin obtained by evaluation, such as Figure 4 As shown, this curve can be used to detect and evaluate thrombi with unknown drug resistance.
[0048] 6. Precision medication and evaluation Based on the results of drug resistance detection, the dosage of the nano-diagnostic and therapeutic system is adjusted or different intensities of photothermal therapy are applied to the thrombus site to adjust the drug release rate, thereby adjusting the intensity of thrombolytic therapy. The results of precise treatment based on drug resistance adjustment are evaluated through blood vessel slices and compared with the treatment effect based on conventional drug delivery strategy. The thrombolytic effect after precise treatment of this scheme is shown in the figure below. Figure 5 As shown, the technology in this protocol was used to detect the drug resistance of thrombosis in animal models, and based on this, the treatment intensity of the nano-diagnostic and therapeutic system was adjusted through photothermal and dose. After treatment, the blood vessels at the thrombus site were sectioned and stained with HE, and the blood vessels were completely unobstructed.
[0049] Example 2 Compared with Example 1, this embodiment adjusts the detection structure and changes the medication method—only clinical drugs are used, specifically including the following contents: 1. Preparation of gold nanomaterials 4.7 mL of 100 mM CTAB solution was mixed with 5 μL of 10% chloroauric acid and stirred for 2 minutes. Then, 300 μL of 30 mM sodium borohydride solution was quickly added at 32°C. After vigorous stirring for 2 minutes, the mixture was allowed to stand for 30 minutes to form gold seeds. Subsequently, 4 mL of 200 mM CTAC solution, 3 mL of 100 mM ascorbic acid (AA), and 100 μL of the aforementioned gold seed solution were mixed at 25°C. 4 mL of 0.5 mM chloroauric acid solution was added. After stirring for 30 minutes, the mixture was centrifuged and resuspended in 1 mL of 10 mM CTAC solution to obtain secondary gold nanoparticles.
[0050] 2. Construction of Nanodiagnostic and Therapeutic Mixed Reagent System The thrombin-targeting nucleic acid aptamer sequence Apt (specifically, AGTCCGTGGTAGGGCAGGTTGGGGTGACT in this example) and its thiol-modified complementary sequence Com (specifically, AGTCAGGGGGTTGGACGGGATGGTGGCTGA in this example) were mixed and incubated for 12 hours. The mixture was then activated with TCEP hydrochloride at a molar ratio of 1:400. Gold and silver core-shell nanoparticles were added and reacted for 2 hours. After centrifugation and washing, a rhodamine 6G solution was added and reacted for 20 minutes. The mixture was then centrifuged and redispersed with ultrapure water to obtain a nanodiagnostic reagent. The nanodiagnostic reagent was then mixed with the thrombolytic drug alteplase to create a nanodiagnostic and therapeutic hybrid reagent system.
[0051] 3. Preparation of sensing structure A glass slide modified with PDDA was immersed in a solution of gold and silver core-shell nanoparticles for 2 hours, after which the solution was removed and the slide was rinsed with ultrapure water. The slide was then immersed in a solution of thiol-modified single-chain apt for 1 hour, after which the solution was removed and the slide was rinsed with PBS to obtain the sensing structure.
[0052] 4. Detection of thrombus resistance The nanodiagnostic and therapeutic mixed reagent system was injected intravenously into a carotid artery thrombosis model. After alteplase partially dissolved the thrombus and the nanodiagnostic reagent targeted and interacted with the thrombus for 10 minutes, a blood sample was drawn and dripped onto a glass slide with the sensing nanostructures. The reaction was then allowed to proceed for 15 minutes. The Raman signal was detected using a Raman spectrometer. The corresponding thrombus was removed and treated with a thrombolytic drug. The actual drug resistance of the thrombus was determined by the thrombolytic efficiency, and a standard curve was established between signal intensity and drug resistance. Based on this standard curve, the actual signal intensity obtained during testing was used to determine drug resistance.
[0053] 5. Precision medication and evaluation Based on the results of drug resistance testing, the dose of alteplase is adjusted to precisely match the dose required for thrombotic drug resistance. The results of precise treatment based on drug resistance adjustment are evaluated through vascular sections and compared with the treatment effect based on conventional drug delivery strategies. The thrombolytic effect after precise treatment of this regimen is shown in the figure below. Figure 6 As shown, the technology in this protocol was used to detect the drug resistance of thrombosis in animal models, and the clinical drug dosage was adjusted based on this. After treatment, HE staining of the blood vessels at the thrombosis site showed good patency of the blood vessels.
[0054] Example 3 Compared with Example 1, this embodiment changes the thrombus location and the detection nanomaterial. Specifically, it includes the following contents: 1. Synthesis of polydopamine nanomaterials Dissolve 0.3 g of dopamine hydrochloride and 0.2 g of F127 in a mixture of deionized water (10 ml) and ethanol (10 ml). Add 320 μL of trimethylolpropane and sonicate for 5 minutes. Slowly add 750 μL of ammonia solution dropwise while stirring. After reacting for 1 hour, centrifuge the resulting solution at 10,000 rpm for 30 minutes and wash three times with deionized water and three times with ethanol.
[0055] 2. Preparation of silver nanospheres Dissolve 44 mg of silver nitrate in 245 mL of deionized water and heat to boiling with stirring. Dissolve 50 mg of sodium citrate in 5 mL of deionized water and add to the boiling silver nitrate solution. Continue heating for 45 minutes, then remove from heat and allow to cool naturally. Before use, centrifuge the solution containing silver nanoparticles (7000 rpm, 15 minutes) and resuspend in deionized water.
[0056] 3. Construction of polydopamine nanodiagnostic and therapeutic system The thiol-modified P-selectin-targeting aptamer sequence, Apt (GGCTCCTGCAGGTCGGCTGGGGGGGGGGGGGCATGGGTAGTTAGGTGGTGATGGTGG), was first activated with TCEP hydrochloride at a molar ratio of 1:400. Mesoporous silica nanoparticles (McLean's reagent, 200-300 nm), an inorganic nanomaterial, were then added and shaken for 6 hours. After centrifugation (10,000 rpm for 10 minutes) and resuspending in PBS, the Apt-modified mesoporous silica nanoparticles were mixed with urokinase for 12 hours to complete drug loading. The thiol-complementary sequence, Com (CCACCATAGTCCACCTACTGGGCCCCCCCCCCGAGCCGACCTGCA GGAGCC), of Apt, was labeled with gold-silver core-shell nanoparticles by incubation in a pH 3 citric acid-hydrochloric acid buffer for 20 minutes. The nanoparticles were then incubated with the drug-loaded nanocarriers for 12 hours to block drug leakage.
[0057] 4. Preparation of sensing structure A glass slide modified with PDDA was immersed in a solution of silver nanospheres for 2 hours, after which the solution was removed and the slide was rinsed with ultrapure water. The slide was then immersed in a solution of thiol-modified single-chain apt for 1 hour, after which the solution was removed and the slide was rinsed with PBS. Finally, the slide was immersed in a methylene blue solution and rinsed with PBS to obtain the sensing structure.
[0058] 5. Detection of thrombus resistance The polydopamine nanodiagnostic and therapeutic system was injected intravenously into the body (a cerebral thrombosis model). After the nanodiagnostic and therapeutic system targeted and interacted with the thrombus for 10 minutes, a blood sample was drawn and dripped onto a glass slide with the sensing nanostructures, where it reacted for 15 minutes. The Raman signal was detected using a Raman spectrometer. The corresponding thrombus was removed and treated with a thrombolytic drug. The actual drug resistance of the thrombus was determined by the thrombolytic efficiency, and a standard curve was established between signal intensity and thrombus drug resistance. Based on this standard curve, the signal intensity obtained during actual testing was used to determine the drug resistance of the thrombus.
[0059] 6. Precision medication and evaluation Based on the results of drug resistance detection, the dosage of the nano-diagnostic and therapeutic system is adjusted or different intensities of light and heat are applied to the thrombus site to adjust the drug release rate, thereby adjusting the intensity of thrombolytic therapy. The results of precise treatment based on drug resistance adjustment are evaluated by blood vessel slices and compared with the treatment effect based on conventional drug delivery strategy. The bleeding situation of the precise treatment in this example is compared with the clinical conventional weight-based drug delivery treatment. Figure 7As shown (i.e., HE staining results of slices after cerebral thrombosis treatment, the left picture is the result of precision drug treatment, and the right picture is the result of existing clinical weight-based drug treatment), there is no obvious sign of bleeding in the thrombosis drug resistance treatment based on this regimen, which can effectively reduce the risk of drug dose-dependent bleeding, while weight-based drug administration can observe obvious red blood cells (red part) from the staining results, and there is obvious cerebral hemorrhage on the surface.
[0060] In summary, the present invention proposes for the first time a diagnostic method for thrombotic drug resistance, and based on thrombotic drug resistance, realizes precise medication and treatment of thrombosis, improves the thrombolytic efficiency of thrombotic diseases and reduces the risk of bleeding, providing a new and effective technical method for the clinical diagnosis and treatment of thrombotic diseases.
[0061] The above is only an embodiment of the present invention, and the common knowledge such as the specific technical solutions and / or characteristics in the solution are not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several variations and improvements can be made, which should also be regarded as the scope of protection of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the description can be used to interpret the content of the claims.
Claims
1. A method for diagnosing and treating thrombosis for detecting drug resistance and providing precise medication, characterized by: The following steps are involved: Step (1), design and construction of a nano-diagnosis and treatment system: synthesize drug-loaded nanomaterials, load thrombolytic drugs through mixed incubation, and modify the surface of the nanomaterials with functional nucleic acid structures that can interact with markers in thrombi and release free DNA to obtain a nano-diagnosis and treatment system; Step (2), thrombotic drug resistance detection: a capture nucleic acid chain modified with an optical signal reporter molecule is bound to the surface of a sensing nanomaterial to obtain a detection nanostructure, and then the nanodiagnosis and treatment system is injected into the body to identify the thrombus and interact with it, and then blood is drawn to mix with the detection nanostructure and react, and the optical signal is measured to obtain the detection result; Step (3), precise thrombolytic drug treatment: compare the optical detection results obtained in step (2) with the standard curve, calculate and obtain the thrombotic drug resistance, and adjust the treatment intensity according to the thrombotic drug resistance to perform precise thrombolysis.
2. A thrombosis diagnosis and treatment method for detecting thrombotic drug resistance and performing precise medication according to claim 1, characterized in that: In step (1), the drug-loaded nanomaterial refers to a nanomaterial that can load or adsorb thrombolytic drugs, including any one of polymer nanomaterials and inorganic nanomaterials.
3. The method for diagnosing and treating thrombosis for detecting drug resistance in thrombosis and performing precise medication according to claim 2, characterized in that: In step (1), the marker in the thrombus refers to a marker that is specifically and highly expressed in the thrombus, including thrombin or p-selectin; the functional nucleic acid structure refers to a base sequence that can undergo structural changes and release free nucleic acid chains after specifically reacting with the marker in the thrombus, including any one of AGTCCGTGGTAGGGCAGGTTGGGGTGACT, GGTTGGTGTGGTTGG, GGCTCCTGCAGGTCGGCTGGGGGGGGGGGGCATGGGTAGTTAGGTGGTGATGGTGG.
4. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 3, characterized in that: In step (2), the optical signal reporter molecule refers to a molecular structure that can generate a characteristic optical signal after excitation, including any one of 5,5'-dithiobis(2-nitrobenzoic acid), rhodamine 6G, and methylene blue; the capture nucleic acid chain is a base sequence modified with a specific optical reporter molecule and capable of specifically hybridizing and binding to a free nucleic acid chain, including any one of AGTCAGGGGGTTGGACGGGATGGTGGCTGA, CCAACCACACCAACC, CCACCATAGTCCACCTACTGGGCCCCCCCCCCGAGCCGACCTGCAGGAGCC.
5. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 4, characterized in that: In step (2), the sensing nanomaterial refers to a nanomaterial that can enhance or weaken the optical signal of an optical reporter molecule adsorbed on its surface, including a gold nanomaterial or a silver nanomaterial.
6. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 5, characterized in that: In step (2), the blood drawn is a blood sample obtained from the body at an interval of more than 5 minutes after intravenous injection of the nano-diagnosis and treatment system, and the detection result refers to the measured characteristic optical signal intensity.
7. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 6, characterized in that: In step (3), the standard curve refers to a curve of correspondence between thrombus drug resistance and signal intensity established by treating thrombi with different known drug resistances using a nano-diagnosis and treatment system and detecting signal intensity.
8. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 7, characterized in that: In step (3), regulating the treatment intensity refers to adjusting the drug dosage or adjusting the drug release rate or taking other methods that affect the thrombolytic efficacy.
9. The method for diagnosing and treating thrombosis for detecting drug resistance of thrombosis and performing precise medication according to claim 8, characterized in that: In step (2) and step (3), the thrombotic drug resistance refers to the sensitivity of thrombus in patients with thrombotic diseases to drug thrombolysis.