A kind of ophiopogon japonicus callus induction medium and the construction method of its genetic transformation system
By optimizing the formula of the Ophiopogon japonicus callus induction culture medium and constructing a genetic transformation system, the problem of Ophiopogon japonicus germplasm scarcity and breeding difficulties has been solved, achieving efficient genetic transformation and regeneration effects, and providing a large amount of materials for Ophiopogon japonicus breeding and research.
Patent Information
- Application Number
- CN202511220440.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2026-01-06
- Estimated Expiration
- 2045-08-29
AI Technical Summary
Ophiopogon japonicus germplasm resources are scarce, its growth cycle is long, its planting area is decreasing, traditional breeding methods are difficult to improve, and monocotyledonous plants cannot directly regenerate new shoots from explants, making it difficult to establish existing genetic transformation systems.
The formulation of the Ophiopogon japonicus callus induction medium was optimized, containing specific concentrations of naphthaleneacetic acid, 2,4-D, 6-benzylaminopurine, sucrose, and agar. The medium for inducing, regenerating, and screening Ophiopogon japonicus callus was constructed, and the genetic transformation method mediated by Agrobacterium tumefaciens was adopted.
It significantly improved the callus induction rate and regeneration efficiency of Ophiopogon japonicus, provided a large amount of genetic transformation materials, laid the foundation for the genetic breeding and functional research of Ophiopogon japonicus, and realized the construction of an efficient genetic transformation system.
Smart Images

Figure CN120699886B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic transformation system construction technology, specifically relating to a method for constructing a callus induction culture medium for Ophiopogon japonicus and its genetic transformation system. Background Technology
[0002] Ophiopogon japonicus ( Ophiopogon japonicus Ophiopogon japonicus, belonging to the genus Ophiopogon japonicus in the family Liliaceae, is a common medicinal plant with the effects of nourishing yin and promoting body fluid production, moistening the lungs and clearing the heart. Modern research shows that Ophiopogon japonicus extract has anti-inflammatory, antioxidant, and immune-enhancing effects, and is also a major component of traditional Chinese medicine prescriptions for treating cardiovascular diseases. According to its place of origin, Ophiopogon japonicus is divided into "Zhejiang Ophiopogon japonicus" and "Sichuan Ophiopogon japonicus". Due to the rapid pace of modern urbanization and the increase in local economic activities, Ophiopogon japonicus faces problems such as scarce germplasm resources, long growth cycle, and decreasing planting area year by year. Traditional breeding methods also make it very difficult to improve the variety of Ophiopogon japonicus.
[0003] With the increasing maturity of molecular breeding and gene editing technologies, and the rapid development of high-quality sequencing technologies, transgenic breeding and in vivo verification of natural product synthesis genes are being considered in various plants. Agrobacterium-mediated plant genetic transformation systems are widely used transgenic methods due to their high efficiency, convenience, and broad adaptability. However, due to the characteristics of monocotyledonous plants, it is difficult for *Ophiopogon japonicus* to directly regenerate new shoots from explants. The key to establishing a genetic transformation system lies in inducing callus tissue and using it as an explant to construct a regeneration system. Currently, there are only a few reports on tissue culture for both *Ophiopogon japonicus* from Zhejiang and Sichuan, and no reports on the establishment of genetic systems based on callus tissue culture. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide a callus induction culture medium for Ophiopogon japonicus, which greatly improves the callus induction ability of Ophiopogon japonicus by optimizing the ratio of growth hormones.
[0005] This invention provides a callus induction culture medium for Ophiopogon japonicus, which is based on MS medium and further contains the following components: 0.4~0.6 mg / L naphthaleneacetic acid, 0.4~0.6 mg / L or 0.8~1.2 mg / L 2,4-D, 0.08~0.12 mg / L or 0.15~0.25 mg / L 6-benzylaminopurine, 28~32 g / L sucrose, and 7~9 g / L agar; the pH value of the Ophiopogon japonicus callus induction culture medium is 5.8~6.0.
[0006] Preferably, it also contains the following components: 0.5 mg / L naphthaleneacetic acid, 0.5 mg / L or 1 mg / L 2,4-D, 0.1 or 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose, and 8 g / L agar; the pH of the Ophiopogon japonicus callus induction medium is 5.8.
[0007] This invention provides a culture medium for Ophiopogon japonicus tissue culture, comprising the Ophiopogon japonicus callus induction medium and the Ophiopogon japonicus regeneration medium;
[0008] The Ophiopogon japonicus regeneration medium is based on MS medium and also contains the following components: 0.18~0.22 mg / L NAA, 1~4 mg / L BAP, 28~32 g / L sucrose and 7~9 g / L agar;
[0009] The pH value of the Ophiopogon japonicus regeneration medium is 5.8~6.0.
[0010] Preferably, the Ophiopogon japonicus regeneration medium further comprises the following components: 0.2 mg / L NAA, 2 mg / L BAP, 30 g / L sucrose and 8 g / L agar; the pH value of the Ophiopogon japonicus regeneration medium is 5.8.
[0011] This invention provides a culture medium for constructing a genetic transformation system of Ophiopogon japonicus, comprising a first screening medium and a second screening medium;
[0012] The first screening medium is the Ophiopogon japonicus callus induction medium containing 48-52 mg / L kanamycin;
[0013] The second screening medium is MS medium containing 48-52 mg / L kanamycin, 280-320 mg / L cephalosporin, 0.15-0.25 mg / L NAA, 1.8-2.2 mg / L BAP, 28-32 g / L sucrose and 7-9 g / L agar; the pH of the first or second screening medium is 5.8-6.0.
[0014] Preferably, the first screening culture medium is the Ophiopogon japonicus callus induction culture medium containing 50 mg / L kanamycin as described in the above technical solution;
[0015] The second screening medium is MS medium containing 50 mg / L kanamycin, 300 mg / L cephalosporin, 0.2 mg / L NAA, 2 mg / L BAP, 30 g / L sucrose and 8 g / L agar; the pH of the first or second screening medium is 5.8.
[0016] The present invention provides the Ophiopogon japonicus callus induction medium, the Ophiopogon japonicus tissue culture medium, or the application of the medium in Ophiopogon japonicus tissue culture and / or the construction of Ophiopogon japonicus genetic transformation system, wherein the explants of Ophiopogon japonicus include Ophiopogon japonicus roots.
[0017] Preferably, the Ophiopogon japonicus includes Zhejiang Ophiopogon japonicus and / or Sichuan Ophiopogon japonicus.
[0018] This invention provides a method for constructing a genetic transformation system for Ophiopogon japonicus, comprising the following steps:
[0019] The roots of aseptic Ophiopogon japonicus seedlings were used as explants and inoculated into the Ophiopogon japonicus callus induction medium to culture callus tissue, thereby obtaining Ophiopogon japonicus callus tissue.
[0020] Recombinant Agrobacterium strains containing recombinant vectors of the target exogenous gene were transformed into the callus tissue and co-cultured. After initial screening, re-screening, and culture of resistant callus tissue, the resulting resistant seedlings were Ophiopogon japonicus genetic transformants.
[0021] Preferably, after obtaining the Ophiopogon japonicus callus, the method further includes inoculating the Ophiopogon japonicus callus into the Ophiopogon japonicus regeneration culture medium described in the above technical solution for regeneration culture, and using the obtained regenerated callus for transformation.
[0022] This invention provides a callus induction medium for *Ophiopogon japonicus*, which is based on MS medium and further contains the following components: 0.4–0.6 mg / L NAA, 0.4–0.6 mg / L 2,4-D, 0.15–0.25 mg / L BAP, 28–32 g / L sucrose, and 7–9 g / L agar; the pH of the *Ophiopogon japonicus* callus induction medium is 5.8–6.0. This invention optimizes the combination of NAA, 2,4-D, and BAP concentrations to obtain a medium that can efficiently induce callus in *Ophiopogon japonicus* roots. In the embodiments of this invention, the *Ophiopogon japonicus* callus induction medium provided by this invention was used to culture callus from explant *Ophiopogon japonicus* roots. The results show that the *Ophiopogon japonicus* callus induction medium provided by this invention achieves a callus induction rate of 100%, while media with other hormone ratios result in a callus induction rate of less than 63%. Since it is difficult for Ophiopogon japonicus to directly regenerate new shoots from explants, the callus induction medium provided by this invention can obtain a large amount of callus tissue, providing a large amount of material for the large-scale tissue culture and genetic transformation system construction of Ophiopogon japonicus, and laying the foundation for the genetic breeding and functional research of Ophiopogon japonicus. Attached Figure Description
[0023] Figure 1 The results of aseptic seedling culture of Zhemaidong No. 1;
[0024] Figure 2Figure 1 shows the induction results of *Ophiopogon japonicus* explants (leaves and roots) under different culture media. Figure 2 shows the partial results of callus induction of leaves on CI11 induction medium, Figure 3 shows the partial results of callus induction of leaves on CI12 induction medium, Figure 4 shows the partial results of callus induction of leaves on CI8 induction medium, Figure 5 shows the partial results of callus induction of roots on CI5 induction medium, Figure 6 shows the partial results of callus induction of roots on CI3 induction medium, and Figure 7 shows the partial results of callus induction of roots on CI1 induction medium.
[0025] Figure 3 This represents the regeneration and differentiation results of Ophiopogon japonicus callus tissue;
[0026] Figure 4 Figure A shows the regeneration and differentiation results of Ophiopogon japonicus callus under different antibiotic concentrations; Figure B shows the regeneration and differentiation results with a kanamycin concentration of 0; Figure B shows the regeneration and differentiation results with a kanamycin concentration of 50 mg / L.
[0027] Figure 5 The results of the detection of Ophiopogon japonicus callus tissue are shown in Figure A; Figure B shows the genetic transformation results and the PCR verification results. Detailed Implementation
[0028] This invention provides a callus induction culture medium for Ophiopogon japonicus, which is based on MS medium and further contains the following components: 0.4~0.6 mg / L naphthaleneacetic acid, 0.4~0.6 mg / L or 0.8~1.2 mg / L 2,4-D, 0.08~0.12 mg / L or 0.15~0.25 mg / L 6-benzylaminopurine, 28~32 g / L sucrose, and 7~9 g / L agar; the pH of the Ophiopogon japonicus callus induction culture medium is 5.8~6.0.
[0029] In this invention, the Ophiopogon japonicus callus induction medium further comprises the following components: 0.5 mg / L naphthaleneacetic acid, 0.5 mg / L or 1 mg / L 2,4-D, 0.1 or 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose, and 8 g / L agar; the pH value of the Ophiopogon japonicus callus induction medium is 5.8.
[0030] In this invention, different concentrations of NAA (0.5~2 mg / L), 2,4-D (0.5~2 mg / L), and BAP (0.1~0.2 mg / L) are combined to screen callus tissue. The results showed that, using Ophiopogon japonicus roots as explants, combinations of 1–2 mg / L NAA with any concentration of 2,4-D and BAP did not induce callus formation well, with induction rates ranging from 0% to 48.12%. However, combinations of 0.5 mg / L NAA and 0.1 mg / L BAP with different concentrations of 2,4-D improved callus induction rates, ranging from 62.96% to 81.48%. The callus induction rates of combinations of 0.5 mg / L NAA and 0.2 mg / L BAP with different concentrations of 2,4-D varied considerably. Combinations with 1 mg / L or 2 mg / L 2,4-D resulted in callus induction rates of 44.44%–55.56%, while combinations with 0.5 mg / L 2,4-D achieved a 100% callus induction rate. Using Ophiopogon japonicus leaves as explants, the callus induction rate of all the above combinations was not high, ranging from 0% to 34.29%. This suggests that the combination of NAA, 2,4-D and BAP may not be suitable for callus induction using Ophiopogon japonicus leaves as explants.
[0031] This invention provides a culture medium for Ophiopogon japonicus tissue culture, comprising the Ophiopogon japonicus callus induction medium and the Ophiopogon japonicus regeneration medium; the Ophiopogon japonicus regeneration medium is based on MS medium and further contains the following components: 0.18~0.22 mg / L NAA, 1~4 mg / L BAP, 28~32 g / L sucrose and 7~9 g / L agar; the pH value of the Ophiopogon japonicus regeneration medium is 5.8~6.0.
[0032] In this invention, the *Ophiopogon japonicus* regeneration medium preferably further comprises the following components: 0.2 mg / L NAA, 2 mg / L BAP, 30 g / L sucrose, and 8 g / L agar; the pH value of the *Ophiopogon japonicus* regeneration medium is 5.8. The *Ophiopogon japonicus* regeneration medium is used for the large-scale propagation of callus tissue from *Ophiopogon japonicus* roots, providing abundant materials for the construction of *Ophiopogon japonicus* tissue culture and genetic transformation systems.
[0033] In another embodiment of the present invention, the regeneration effect of callus tissue from Ophiopogon japonicus roots was evaluated using combinations of different concentrations of NAA (0.1 mg / L and 0.2 mg / L) and BAP (1 mg / L, 2 mg / L and 4 mg / L). The results showed that the combination of 0.2 mg / L NAA and 1 mg / L to 4 mg / L BAP had a high regeneration efficiency, specifically 80% to 92%, which was significantly higher than the regeneration efficiency (47% to 62%) obtained by the combination of 0.1 mg / L NAA and 1 mg / L to 4 mg / L BAP.
[0034] This invention provides a culture medium for constructing a genetic transformation system of Ophiopogon japonicus, comprising a first screening medium and a second screening medium; the first screening medium is the Ophiopogon japonicus callus induction medium containing 48-52 mg / L kanamycin; the second screening medium is MS medium containing 48-52 mg / L kanamycin, 280-320 mg / L cephalosporin, 0.15-0.25 mg / L NAA, 1.8-2.2 mg / L BAP, 28-32 g / L sucrose and 7-9 g / L agar; the pH of the first screening medium or the second screening medium is 5.8-6.0.
[0035] In this invention, the first screening medium is preferably the *Ophiopogon japonicus* callus induction medium containing 50 mg / L kanamycin. The second screening medium is MS medium containing 50 mg / L kanamycin, 300 mg / L cephalosporin, 0.2 mg / L NAA, 2 mg / L BAP, 30 g / L sucrose, and 8 g / L agar; the pH of the first or second screening medium is 5.8.
[0036] In this invention, the first screening medium is based on the Ophiopogon japonicus callus induction medium with optimized antibiotic concentration. Different concentrations (0, 10 mg / L, 25 mg / L, 50 mg / L, 75 mg / L and 100 mg / L) of kanamycin were used as the first screening medium to preliminarily screen the transformed callus. The results showed that 50 mg / L kanamycin had a significant inhibitory effect on the regeneration and differentiation ability of the callus. Therefore, this concentration was used for subsequent screening of transgenic shoots.
[0037] In this invention, the second screening medium is used for shoot induction culture of the initially screened surviving callus tissue. The second screening medium is obtained by adding kanamycin to the callus regeneration medium.
[0038] This invention provides the Ophiopogon japonicus callus induction medium, the Ophiopogon japonicus tissue culture medium, or the application of the medium in Ophiopogon japonicus tissue culture and / or the construction of Ophiopogon japonicus genetic transformation system. In the Ophiopogon japonicus tissue culture and / or the construction of Ophiopogon japonicus genetic transformation system, the explants of Ophiopogon japonicus preferably include Ophiopogon japonicus roots.
[0039] In this invention, the Ophiopogon japonicus preferably includes Zhejiang Ophiopogon japonicus and / or Sichuan Ophiopogon japonicus. In an embodiment of this invention, taking Zhejiang Ophiopogon japonicus No. 1 as an example, the method for inducing callus tissue and constructing a genetic transformation system is described.
[0040] This invention provides a method for constructing a genetic transformation system for Ophiopogon japonicus, comprising the following steps:
[0041] The roots of sterile Ophiopogon japonicus seedlings are used as explants and inoculated into the Ophiopogon japonicus tissue culture and / or Ophiopogon japonicus genetic transformation system. The explants of Ophiopogon japonicus preferably include callus culture in Ophiopogon japonicus callus induction medium to obtain Ophiopogon japonicus callus.
[0042] The recombinant vector containing the target exogenous gene was transformed into Agrobacterium strain and co-cultured with the callus tissue. After initial screening, re-screening and resistant seedling culture of resistant callus tissue, the resistant seedlings obtained were Ophiopogon japonicus genetic transformants.
[0043] In this invention, the method for obtaining the roots of the aseptic seedlings of *Ophiopogon japonicus* preferably involves separating tubers from healthy *Ophiopogon japonicus* plants, removing impurities, and then sterilizing them. The sterilized tubers are inoculated into MS medium for culture to obtain aseptic seedlings. The roots of the aseptic seedlings are then obtained through rooting culture. The sterilization reagents preferably include a 75% ethanol aqueous solution and a 1.5% sodium hypochlorite aqueous solution (v / v). The sterilization time of the 75% ethanol aqueous solution is 45-75 seconds, or 60 seconds. The sterilization time of the 1.5% sodium hypochlorite aqueous solution is preferably 15-25 minutes, or 20 minutes. After sterilization, the seedlings are rinsed 4-6 times with sterile water, or 5 times. The rooting medium is preferably 1 / 2 MS medium. The rooting culture temperature is preferably 22-24°C, or 23°C. The aseptic seedlings are preferably cultured at 22-24°C, or 23°C; the photoperiod is preferably 16 hours of light / 8 hours of darkness.
[0044] In this invention, after obtaining the Ophiopogon japonicus callus, it is preferable to further inoculate the Ophiopogon japonicus callus into the Ophiopogon japonicus regeneration culture medium described in the above technical solution for propagation culture, and the resulting regenerated callus is used for transformation. The propagation culture is beneficial to increasing the number of callus tissues.
[0045] In this invention, there are no special restrictions on the type of recombinant vector for the target exogenous gene; any recombinant vector of interest in the art can be used. The host bacterium of the recombinant strain containing the target exogenous gene includes *Agrobacterium tumefaciens*. Preferably, the *Agrobacterium tumefaciens* GV3101 strain is used. In this embodiment, the *O. malathion* OMT gene is used as the target exogenous gene, and the p9UA vector containing the *O. malathion* OMT gene is used as the recombinant vector.
[0046] This invention does not impose any particular limitation on the transformation method of the recombinant vector; any transformation method well known in the art can be used, such as freeze-thaw or electroporation. The co-culture time of the callus tissue and bacterial solution is preferably 14-16 min, and can be 15 min. During co-culture, the preferred ratio of the mass of the callus tissue to the volume of the recombinant bacterial solution is 1 g: 12-18 mL, and can be 1 g: 15 mL.
[0047] In this invention, the culture medium used for the initial screening is preferably the first screening culture medium. The initial screening is preferably performed in steps based on whether or not plaques appear. If no obvious plaques appear on the callus tissue, the co-cultured callus tissue is transferred to the screening culture medium. If plaques appear in the culture medium, the co-cultured callus tissue is washed sequentially with sterile water containing 300 mg / L cephalosporin and ordinary sterile water for 5 min, excess water is discarded, and the treated callus tissue is transferred to the screening culture medium and cultured in the dark at 23°C, with the culture medium being changed every two weeks. The screening culture medium is preferably an Ophiopogon japonicus callus induction medium containing 300 mg / L cephalosporin and 50 mg / L kanamycin. The temperature for the second screening is preferably 22-24°C, and can be 23°C. The photoperiod for the second screening is preferably 16h light / 8h dark, and the culture medium is preferably changed every 2 weeks. The culture medium used for the second culture is preferably the second screening culture medium. The second screening is preferably performed when the resistant shoots reach a length of 1-2 cm, at which point they are cut for rooting culture. The rooting culture medium is preferably MS medium or 1 / 2 medium as the base medium, preferably 300 mg / L cephalosporin and 50 mg / L kanamycin.
[0048] In this invention, the detection of the target exogenous gene is preferably included before the rooting culture of the resistant shoots. The method for detecting the target exogenous gene preferably includes PCR detection, specifically, primers designed based on the specific gene sequence of the transformed recombinant vector are used for PCR amplification. In this embodiment of the invention, the p9UA-OMT recombinant vector is used as an example to illustrate the method for detecting the target exogenous gene. The presence or absence of the 35S promoter and the OCS terminator is used to determine whether the target exogenous gene has been successfully transformed. This embodiment of the invention shows that the target exogenous gene was successfully introduced into *Ophiopogon japonicus*, with an overall transformation rate of 21.43%.
[0049] The following detailed description, in conjunction with embodiments, illustrates the construction method of the Ophiopogon japonicus callus induction culture medium and its genetic transformation system provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0050] Example 1
[0051] 1. Optimization of the callus induction culture medium for Ophiopogon japonicus
[0052] Five healthy one-year-old *Ophiopogon japonicus* var. *zhejiangense* No. 1 were selected as tissue material. Excess leaves and roots were removed to obtain naked tubers, which were then divided. Surface soil was removed, and the tubers were rinsed under running tap water with detergent for 2 hours, during which time old leaves and excess roots were further removed. Fifty tubers with a diameter of 3-5 cm were immersed in 200 mL of 75% ethanol solution for 1 minute. After discarding the ethanol solution, 200 mL of 1.5% sodium hypochlorite solution was added for sterilization for 15 minutes. The tubers were then transferred to a clean bench and rinsed five times with sterile water for 2-3 minutes each time. The tubers were then transferred to bottles containing MS medium, 2-3 tubers per bottle, and cultured at 23℃ under 16h light / 8h dark conditions until the sterile seedlings reached 3-4 cm in height. They were then transferred to 1 / 2 MS medium to promote rooting. Figure 1 Young leaves and roots were inoculated into different callus induction media (MS medium containing auxin content as shown in Table 1, and also containing 8 g / L agar and 30 g / L sucrose) and cultured in the dark continuously at 23°C. The medium was replaced with fresh medium every 3 weeks. After 2 months, the number of explants that induced callus was counted, and the callus induction efficiency was calculated according to Formula I.
[0053] Callus induction efficiency (%) = Number of explants that induce callus / Total number of explants used × 100% Formula I.
[0054] The results showed that the callus induction efficiency was significantly higher when roots of tissue-cultured seedlings were used as explants than when leaves were used. In tests with different growth hormone ratios, the callus induction medium CI10 containing 2,4-D achieved a final induction efficiency of 100% (Table 1). Figure 2 ).
[0055] Table 1 Callus induction
[0056]
[0057] 2. Optimization method for callus regeneration culture
[0058] The callus tissues induced and cultured in CI10 medium in step 1 were inoculated into culture media with different concentrations of growth hormone (Table 2). Each callus was about 0.3g, and 9 callus tissues (about 5 mm in diameter) were inoculated into each culture dish (90 mm). The callus tissues were placed in the culture conditions of 23℃, light for 16 h and dark for 8 h, and the regeneration efficiency was counted after 2 months.
[0059] Using callus tissue as explants, bud regeneration tests were conducted, and the regeneration efficiency of the RI5 culture medium combination was as high as 91.43% (Table 2). Figure 3 ).
[0060] Table 2. Callus regeneration results in different regeneration media
[0061]
[0062] 3. Antibiotic resistance testing of callus tissue
[0063] Callus tissues of different concentrations were inoculated into the optimal regeneration medium containing different concentrations of antibiotics (kanamycin, 0-50 mg / L) (Table 3). Each callus tissue weighed approximately 0.3 g, and 9 callus tissues (approximately 5 mm in diameter) were inoculated into each culture dish (90 mm). The dishes were then cultured at 23°C under conditions of 16 h of light and 8 h of darkness for resistance culture. The regeneration efficiency was calculated after 2 months.
[0064] Antibiotic tolerance tests were performed on callus tissue. The results showed that 50 mg / L kanamycin significantly inhibited the regeneration and differentiation capacity of callus tissue. Therefore, this concentration was used for subsequent screening of transgenic shoots (Table 3). Figure 4 ).
[0065] Table 3. Antibiotic tolerance test of callus tissue
[0066]
[0067] "-" indicates that the bud regeneration rate is 0, meaning no new buds are produced.
[0068] 4. Transfer of exogenous genes into Agrobacterium tumefaciens
[0069] Construction of a recombinant vector containing the O-methyltransferase gene OMT from *Campanula*: The p9UA vector (Gehl, C., Li, G. & Serek, M. An efficient protocol for Agrobacterium-mediated transformation and regeneration of Campanula medium (Canterbury bells) based on leaf disc explants. Plant Cell Tiss Organ Cult 140, 635–645 (2020).) was used as the backbone vector, containing a kanamycin resistance gene controlled by the UBQ10 promoter and a GFP gene controlled by the 35S promoter. Homologous recombination technology was used to replace the GFP gene with an O-methyltransferase gene from *Campanula*, which was named p9UA-OMT.
[0070] The recombinant vector (p9UA-OMT) containing the liriope oryzae oxygen methyltransferase gene OMT was transformed into competent cells of Agrobacterium tumefaciens GV3101 using a freeze-thaw method. Cells were then screened and cultured on LB agar plates containing the appropriate antibiotics at 28°C. After 48 hours of culture, single colonies were picked and transferred to LB liquid medium containing the appropriate antibiotics, and cultured at 200 rpm and 28°C for another 48 hours. The cultured bacterial suspension was then diluted 20-fold and reactivated by culturing until OD200 was reached. 600 To achieve a concentration of 0.6, place the bacterial culture in a 50 mL centrifuge tube, centrifuge at 4000 g for 25 min at room temperature, discard the supernatant, resuspend the precipitate in MS liquid medium (containing 30 g / L sucrose), add acetylsuccinone to a final concentration of 100 μM, and store at room temperature for later use.
[0071] 5. Co-cultivation
[0072] The well-grown callus from step 1 was mixed with the resuspended bacterial solution from step 4 at a ratio of 1g of callus to 15mL of resuspended bacterial solution, and co-cultured at room temperature for 15min. Subsequently, the bacterial solution was drained, and the callus was placed on sterile filter paper to absorb as much excess bacterial solution as possible. After drying in a laminar flow hood for 15min, the callus was transferred to CI10 medium and incubated in the dark at 23℃ for 3 days.
[0073] 6. Initial screening of resistant callus tissue
[0074] Three days later, if no obvious plaques appear, the callus tissue is directly transferred to the selection medium (CI10 medium containing 300 mg / L cephalosporin and 50 mg / L kanamycin). If obvious plaques appear in the medium, the callus tissue is washed sequentially with sterile water containing 300 mg / L cephalosporin and ordinary sterile water for 5 minutes. After discarding the excess water, the callus tissue is placed on sterile filter paper to absorb excess water before being transferred to the selection medium. The tissue is then incubated in the dark at 23°C, with the medium changed every two weeks.
[0075] 7. Secondary screening of resistant callus and regeneration of resistant buds
[0076] Callus tissue that survived the initial resistance selection was transferred to RI5 bud induction medium containing 50 mg / L kanamycin and 300 mg / L cephalosporin. Selection culture was conducted at 23°C under 16 h light / 8 h dark conditions, with the medium changed every two weeks. Once the resistant shoots reached 1-2 cm in length, they were cut from the parent plant and transferred to MS medium containing 50 mg / L kanamycin and 300 mg / L cephalosporin for rooting culture, thus obtaining the *Ophiopogon japonicus* genetic transformation system.
[0077] 8. PCR verification of resistant buds
[0078] Approximately 100 mg of resistant seedling leaves were collected, and genomic DNA was extracted using the CTAB method. After extraction, DNA quality was assessed by agarose gel electrophoresis and NanoDrop. Using the extracted resistant seedling DNA, wild-type seedling DNA, and plasmid DNA as templates, and primers designed based on plasmid-specific sequences (35S promoter region and OCS terminator region, 35S-For: acgcacaatcccactatcct, OCS-Rev: ggcggtaaggatctgagcta), PCR amplification was performed. The reaction mixture consisted of 10 µl Taq mix (P222, Vazyme), 100 ng gDNA, 1 µl primer mix (10 µM), and ddH2O to a final volume of 20 µl. The reaction program was: 95 ℃ for 3 min; 35 cycles: 95 ℃ for 15 s, 60 ℃ for 15 s, 72 ℃ for 15 s, and 72 ℃ for 5 min. After PCR, agarose gel electrophoresis was used for detection.
[0079] Genetic transformation experiments were conducted using the methods described above, and transgenic shoots were successfully obtained. PCR amplification confirmed the introduction of the exogenous gene. Figure 5 The overall conversion rate was 21.43% (6 / 28).
[0080] Example 2
[0081] A method for inducing callus from Ophiopogon japonicus roots
[0082] The roots of sterile Ophiopogon japonicus seedlings were inoculated into callus induction medium (auxin is shown in Table 4, and also includes 8 g / L agar and 30 g / L MS medium), and continuously cultured in the dark at 23°C. Fresh medium was replaced every 3 weeks. After 2 months, the number of explants that induced callus was counted, and the callus induction efficiency was calculated according to Formula I in step 1 of Example 1.
[0083] The results showed that the callus induction efficiency was significantly higher when the roots of tissue culture seedlings were used as explants than when the leaves were used. In tests with different growth hormone ratios, the callus induction medium provided by this invention achieved a final induction efficiency of over 75% (Table 4).
[0084] Table 4 Callus Induction
[0085]
[0086] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. Application of Ophiopogon japonicus callus induction medium in Ophiopogon japonicus tissue culture and / or Ophiopogon japonicus genetic transformation system construction, wherein the explant of Ophiopogon japonicus is Ophiopogon japonicus root; the Ophiopogon japonicus callus induction medium is MS medium composed of 0.5 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.5 mg / L naphthalene acetic acid, 1 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.4 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.6 mg / L naphthalene acetic acid, 1.0 mg / L 2,4-D, 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.5 mg / L naphthalene acetic acid, 0.6 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.5 mg / L naphthalene acetic acid, 1.0 mg / L 2,4-D, 0.08 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.6 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.12 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.4 mg / L naphthalene acetic acid, 1.2 mg / L 2,4-D, 0.15 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium composed of 0.6 mg / L naphthalene acetic acid, 0.8 mg / L 2,4-D, 0.25 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; the pH value of the Ophiopogon japonicus callus induction medium is 5.
8.
2. Application of Ophiopogon japonicus tissue culture medium in Ophiopogon japonicus tissue culture and / or Ophiopogon japonicus genetic transformation system construction, wherein the explant of Ophiopogon japonicus is Ophiopogon japonicus root; the Ophiopogon japonicus tissue culture medium comprises the Ophiopogon japonicus callus induction medium and the Ophiopogon japonicus regeneration medium in the application of claim 1; the Ophiopogon japonicus regeneration medium comprises MS medium composed of 0.2 mg / L naphthalene acetic acid, 2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; the pH value of the Ophiopogon japonicus regeneration medium is 5.
8. 3. The use of the Ophiopogon japonicus genetic transformation system medium in Ophiopogon japonicus tissue culture and / or Ophiopogon japonicus genetic transformation system construction, wherein the explants of Ophiopogon japonicus are roots of Ophiopogon japonicus; The Ophiopogon japonicus genetic transformation system medium comprises a first screening medium and a second screening medium; the first screening medium is the Ophiopogon japonicus callus induction medium in the use of claim 1 and contains 50 mg / L kanamycin; the second screening medium is an MS medium containing 50 mg / L kanamycin, 300 mg / L cephalosporin, 0.2 mg / L naphthalene acetic acid, 2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; The pH value of the first screening medium or the second screening medium is 5.
8.
4. Use according to any one of claims 1 to 3, characterized in that, The Ophiopogon japonicus comprises Zhejiang Ophiopogon japonicus and / or Sichuan Ophiopogon japonicus.
5. A method for constructing a genetic transformation system of Ophiopogon japonicus, characterized in that, The method comprises the following steps: roots of the Ophiopogon japonicus aseptic seedlings are used as explants, inoculated into the Ophiopogon japonicus callus induction medium for callus culture, and Ophiopogon japonicus callus is obtained; The Ophiopogon japonicus callus induction medium is an MS medium comprising the following components: 0.5 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.5 mg / L naphthalene acetic acid, 1 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.4 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.6 mg / L naphthalene acetic acid, 1.0 mg / L 2,4-D, 0.2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.5 mg / L naphthalene acetic acid, 0.6 mg / L 2,4-D, 0.1 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.5 mg / L naphthalene acetic acid, 1.0 mg / L 2,4-D, 0.08 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.6 mg / L naphthalene acetic acid, 0.5 mg / L 2,4-D, 0.12 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or an MS medium comprising the following components: 0.4 mg / L naphthalene acetic acid, 1.2 mg / L 2,4-D, 0.15 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; or MS medium consisting of the following components in the amounts: 0.6 mg / L naphthalene acetic acid, 0.8 mg / L 2,4-D, 0.25 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; the pH value of the Ophiopogon japonicus callus induction medium is 5.8; The recombinant Agrobacterium strain containing the recombinant vector of the target foreign gene is transformed into the callus for co-culture, and after primary screening of the resistant callus, secondary screening and culture, the obtained resistant seedlings are Ophiopogon japonicus genetic transformants.
6. The method of construction according to claim 5, wherein, After obtaining the Ophiopogon japonicus callus, the Ophiopogon japonicus callus is inoculated into the Ophiopogon japonicus regeneration medium for regeneration culture, and the obtained regenerated callus is used for transformation; The Ophiopogon japonicus regeneration medium consists of the following components in the amounts: 0.2 mg / L naphthalene acetic acid, 2 mg / L 6-benzylaminopurine, 30 g / L sucrose and 8 g / L agar; the pH value of the Ophiopogon japonicus regeneration medium is 5.8.
Citation Information
Patent Citations
Rapid propagation method of in vitro culture of liriope spicata
CN110432144A
Acer truncatum culture medium and application thereof
CN116671437A