Pollution monitoring kit suitable for multiple targeted sequencing, monitoring method and application of pollution monitoring kit
By designing a contamination monitoring kit with uniquely identifiable molecular tags and universal amplification primers, the problem of sample contamination monitoring in multiple targeted sequencing was solved, accurate contamination identification was achieved, and the false positive rate was reduced.
Patent Information
- Application Number
- CN202510618432.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-09-26
AI Technical Summary
During multiple targeted sequencing, contamination between samples is difficult to monitor effectively, leading to false positives, and existing technologies lack effective means.
A pollution monitoring kit is designed that contains several different molecular tags. The molecular tags are uniquely identifiable, with a length of 100 to 400 bp, the same terminal base sequence, and a difference of more than 90% in the middle base sequence. A pair of universal amplification primers are used for sample amplification and sequencing, and pollution is identified by comparing with the molecular tag database.
Effectively distinguish human genomes from pathogenic genomes, reduce amplification complexity, improve amplification efficiency, accurately judge sample contamination, and avoid false positive misjudgments.
Smart Images
Figure BDA0005401798990000041 
Figure BDA0005401798990000051 
Figure BDA0005401798990000061
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of in vitro diagnosis, and in particular relates to a contamination monitoring kit suitable for multiple targeted sequencing, a monitoring method and applications thereof. Background Art
[0002] Infectious diseases are common and frequently occurring clinical illnesses, among the highest in morbidity and mortality worldwide. The ability of pathogen detection technologies to rapidly and accurately detect and identify pathogens is a key concern for those working in infectious disease prevention and control. Targeted high-throughput sequencing (tNGS), developed based on next-generation sequencing (NGS) technology, utilizes ultra-multiplexed PCR to selectively enrich specific genomic regions of interest prior to large-scale sequencing library preparation. This technology can detect dozens or even hundreds of known pathogens and their virulence and / or drug resistance genes in a sample. Compared to traditional gene sequencing, targeted sequencing significantly improves the detection of RNA viruses, fungi, and intracellular bacteria through the design of specific primers, minimizes interference from human genes, and offers lower testing costs. Consequently, it has gained popularity in clinical testing and is widely used in areas such as respiratory tract infections, bloodstream infections, and central nervous system infections.
[0003] In the actual application of high-throughput sequencing pathogen detection for a large number of samples in parallel, there is a possibility of cross-contamination between different samples at all stages of the detection process, which may lead to false positives in the sample test results. Moreover, under targeted sequencing technology, the detection frequency of tNGS strong positive samples is higher, and contamination identification and prevention are particularly important. The existing technology lacks effective technical means for monitoring sample contamination, and targeted development and design are needed. In view of this, this patent application is filed. Summary of the Invention
[0004] The purpose of the present invention is to provide a contamination monitoring kit suitable for multiplex targeted sequencing, which is used to monitor sample contamination in multiplex targeted sequencing and improve the effectiveness of the results of multiplex targeted sequencing by monitoring contamination.
[0005] The technical solution adopted by the present invention is: a contamination monitoring kit suitable for multiple targeted sequencing, comprising several different molecular tags and each molecular tag has unique identification. The several different molecular tags are all artificially synthesized base sequences, which have more than 90% difference with the human genome and the pathogen genome. Different molecular tags have the same 5' terminal base sequence and 3' terminal base sequence, and the intermediate base sequences of different molecular tags have more than 90% difference.
[0006] Preferably, the 5' end sequence of each molecular tag is GTACAACCTTCGCTCTCGTC, and the 3' end sequence of each molecular tag is GTGGAGAGGTCATTGATGCG.
[0007] Preferably, the nucleic acid sequence length of each molecular tag is 100 to 400 bp.
[0008] The advantages and positive effects of the present invention are:
[0009] 1) Through optimized design, the present invention has obtained a kit suitable for multiplex targeted sequencing contamination monitoring. The kit contains several molecular tags ranging in length from 100 to 400 bp, wherein the molecular tags have the same 5' and 3' terminal base sequences, and the molecular tag sequences differ from the human genome and the pathogen genome by more than 90%, thus effectively distinguishing the molecular tags from the human genome and the pathogen genome;
[0010] 2) The present invention designs the same base sequence at the end of the molecular tag. Therefore, by introducing only one pair of molecular tag universal amplification primers into the multiple targeted amplification primer pool, the molecular tags in different samples can be uniformly amplified, reducing the risks of complexity, increased amplification difficulty, and decreased amplification efficiency that may be caused by introducing too many molecular tag primers into the multiple targeted amplification primer pool.
[0011] Another object of the present invention is to provide a method for pollution monitoring using a pollution monitoring kit, comprising the following steps:
[0012] Step S1, introducing a molecular tag into each sample to be detected, and different molecular tags are introduced into different samples to be detected;
[0013] Step S2, using a commercially available pathogenic microorganism nucleic acid extraction kit to obtain nucleic acid from the sample to be tested mixed with molecular tags;
[0014] Step S3, using the nucleic acid mixed with the molecular tag as a template, multiple targeted amplification is performed using a pool of targeted amplification primers to enrich the target sequence;
[0015] Step S4, constructing a library for the enriched target sequences and sequencing them;
[0016] Step S5: perform quality control on the molecular tags in the offline data to determine whether there is contamination in the sample to be tested.
[0017] Preferably, in step S1, the amount of molecular tags introduced is 10 4～5 copies / mL.
[0018] Preferably, the multiple targeted amplification primer pool used in step S3 contains a pair of molecular tag universal amplification primers, and the sequence of the molecular tag universal amplification primer is:
[0019] Forward primer sequence: GTACAACCTTCGCTCTCGTC;
[0020] Reverse primer sequence: CGCATCAATGACCTCTCCAC.
[0021] Preferably, the quality control method of the molecular tags in step S5 is to compare with a molecular tag database established in advance. If non-pre-introduced molecular tags are identified in the sample, it is determined that the test sample is contaminated; if only pre-introduced molecular tags are identified in the sample, it is determined that the test sample is not contaminated.
[0022] The contamination monitoring kit suitable for multiplex targeted sequencing is used to monitor sample contamination in multiplex targeted sequencing.
[0023] The advantages and positive effects of the present invention are:
[0024] The present invention provides a method suitable for multiple targeted sequencing contamination monitoring. The aforementioned monitoring kit is applied, a molecular tag with a unique identifier is introduced into each sample to be tested, and nucleic acid extraction, library construction and sequencing are performed together with the sample to be tested. By comparing with a pre-established molecular tag database, the molecular tags in the off-machine data can be effectively identified, thereby effectively determining whether contamination exists. DETAILED DESCRIPTION
[0025] The embodiments of the present application will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present application and should not be construed as limiting the scope of the present application. In the examples, if no specific conditions are specified, the conditions are carried out according to conventional conditions or manufacturer recommendations. The reagents or instruments used are not specified by the manufacturer and are conventional products that can be purchased on the market.
[0026] Unless otherwise defined below, the meanings of all technical and scientific terms used in the specific embodiments of the present application are intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain this application.
[0027] The term "about" in this application indicates an accuracy range that can be understood by those skilled in the art and still ensures the technical effect of the characteristics discussed. This term usually indicates a deviation from the indicated value by ±10%, preferably ±5%.
[0028] As used in this application, the terms "comprising," "including," "having," "containing," or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising." If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of these embodiments.
[0029] Furthermore, the terms first, second, third, (a), (b), (c), and the like, in the specification and claims, are used to distinguish between similar elements and are not necessarily intended to describe a sequential or chronological order. It is understood that the terms so used are interchangeable under appropriate circumstances, and that the embodiments described herein can be practiced in other sequences than described or illustrated herein.
[0030] The contamination monitoring kit suitable for multiple targeted sequencing of the present invention contains several different molecular tags, and each molecular tag has unique identification. The several different molecular tags are all artificially synthesized base sequences, which have more than 90% difference with the human genome and the pathogen genome. Different molecular tags have the same 5' terminal base sequence and 3' terminal base sequence, and the intermediate base sequences of different molecular tags have more than 90% difference.
[0031] In this embodiment, the 5' end sequence of each molecular tag is GTACAACCTTCGCTCTCGTC, and the 3' end sequence of each molecular tag is GTGGAGAGGTCATTGATGCG.
[0032] In this embodiment, the nucleic acid sequence length of each molecular tag is 100 to 400 bp.
[0033] Sample contamination monitoring is performed using the aforementioned contamination monitoring kit suitable for multiplex targeted sequencing. The monitoring method includes the following steps:
[0034] Step S1, introducing molecular tags into each sample to be tested, and different samples to be tested have different molecular tags introduced; in this step, the amount of molecular tags introduced is 10 4～5 copies / mL;
[0035] Step S2, using a commercially available pathogenic microorganism nucleic acid extraction kit to obtain nucleic acid from the sample to be tested mixed with molecular tags;
[0036] Step S3, using the nucleic acid mixed with the molecular tag as a template, multiple targeted amplification is performed using a targeted amplification primer pool to enrich the target sequence; the multiple targeted amplification primer pool used in this step contains a pair of molecular tag universal amplification primers, and the sequence of the molecular tag universal amplification primer is,
[0037] Forward primer sequence: GTACAACCTTCGCTCTCGTC;
[0038] Reverse primer sequence: CGCATCAATGACCTCTCCAC;
[0039] In the first round of amplification, the reverse primer sequence is used to complement the 3' end sequence of the molecular tag, and the forward primer sequence is not used. After the first amplification, another chain complementary to the molecular tag is formed. In the second and subsequent rounds of amplification procedures, both the forward and reverse primer sequences play the role of primers.
[0040] Step S4, constructing a library for the enriched target sequences and sequencing them;
[0041] Step S5: Perform quality control on the molecular tags in the offline data to determine whether there is contamination in the sample to be tested;
[0042] The quality control method for the molecular tags in this step is to compare them with the molecular tag database established in advance. If non-pre-introduced molecular tags are identified in the sample, the test sample is judged to be contaminated; if only pre-introduced molecular tags are identified in the sample, the test sample is judged to be uncontaminated.
[0043] The present invention is further illustrated by the following specific examples.
[0044] 1. Molecular tag design
[0045] In order to accurately identify cross-contamination between samples of the same batch during targeted sequencing and avoid false positive misjudgments, the present invention designs a set of molecular tags for monitoring contamination in multiple targeted sequencing using existing bioinformatics algorithms.
[0046] Specifically, the rules of the bioinformatics algorithm are: the length of the molecular tag is between 100 and 400 bp, the GC content in the base sequence is 45-65%, there is no polymer sequence of more than 5 consecutive bases in the base sequence, and there is a difference of more than 90% when compared with the human genome and the pathogen genome; different molecular tags have the same 5' terminal base sequence and 3' terminal base sequence, and the intermediate base sequences of different molecular tags have a difference of more than 90%.
[0047] The present invention designs the same base sequence at the 5' end and 3' end of different molecular tags, wherein the 5' end sequence is GTACAACCTTCGCTCTCGTC, and the 3' end sequence is GTGGAGAGGTCATTGATGCG.
[0048] At the same time, a pair of universal molecular tag amplification primers were designed based on the molecular tag sequence, which can realize the synchronous amplification of molecular tags in different samples; the forward primer sequence is GTACAACCTTCGCTCTCGTC, and the reverse primer sequence is CGCATCAATGACCTCTCCAC.
[0049] Table 1 shows a set of designed molecular tag base sequences that constitute the monitoring kit. The table only lists the base sequences of 12 molecular tags, and in actual applications, more than 12 molecular tags may be used.
[0050] Table 1. Molecular tag sequences
[0051]
[0052]
[0053]
[0054] 2. Molecular tag introduction experiment
[0055] Molecular tags are required to achieve effective detection in samples while not affecting the detection performance of pathogens in the sample being tested. Based on the sequence of the above molecular tags, different input gradients are designed to explore the optimal input amount of the molecular tags.
[0056] 2.1 Experimental methods
[0057] 2.1.1 Add a medium concentration of 10 2 copies / mL, 10 3 copies / mL, 10 4 copies / mL and 10 5 copies / mL molecular labeling.
[0058] 2.1.2 Use commercially available pathogenic microorganism extraction kits to extract nucleic acid from the samples to be tested.
[0059] 2.1.3 Using the extracted nucleic acid as a template, amplify using a multiplex targeted amplification primer pool containing molecular tag universal amplification primers.
[0060] Add each component to eight tubes for PCR amplification according to the following system:
[0061] Components Volume (μL) Enzyme premix (Novizan) 5 Multiplex targeted amplification primer pool F 2.5 Multiplex targeted amplification primer pool R 2.5 Nucleic acid template X(≤1ug) Nuclease-FreeWater 14-X Total 25.0
[0062] 2.1.4 Set up the following program on the PCR instrument for PCR amplification:
[0063]
[0064] 2.1.5 The above PCR products were purified using magnetic beads (Agencout AMPure XP, Beckman) with a final elution volume of 30 μL.
[0065] 2.1.6 Using the product obtained in step 2.1.5 as a template, add sequencing adapter sequences to the multiplex PCR amplification products to obtain a sequencing library.
[0066] Add each component to eight tubes for PCR amplification according to the following system
[0067] Components Volume (μL) Enzyme premix (Novizan) 12.5 Adapter Universal Primer Index (MGI) 5.0 Step 2.1.4 Product 20.0 Total 50.0
[0068] 2.1.7 Set up the following program on the PCR instrument for PCR amplification:
[0069]
[0070] 2.1.8 The above PCR product was purified using magnetic beads (Agencout AMPure XP, Beckman) with a final elution volume of 30 μL.
[0071] 2.1.9 Perform high-throughput sequencing on the sequencing library obtained in step 2.1.7 to obtain the sequencing sequence.
[0072] 2.1.10 Compare the sequencing sequence with the molecular tag database and count the number of reads that accurately match the specific molecular tag.
[0073] 2.2 Experimental Results,The experimental statistical results are shown in Table 2 below.
[0074] Table 2. Molecular tag detection statistics
[0075]
[0076]
[0077] It can be seen that there are significant differences in the detection of uniqIC at different input levels in the test samples. With the increase of uniqIC input, the number of detected reads showed an upward trend. 4 copies / mL and 10 5 At the input of 10 copies / mL, uniqIC can stably detect more than 1000 reads in different sample types, and the highest proportion of clean reads is within 10%. 4～5 copies / mL is used as the input amount of molecular tags.
[0078] 3. Preparation of monitoring kits and establishment of monitoring system
[0079] 1. Based on the design of the above molecular tags and the exploration and optimization of the input amount, the monitoring kit of the present invention is established, and the monitoring kit of the present invention contains several different molecular tags;
[0080] 2. A method for contamination monitoring in multiple targeted sequencing was established using the aforementioned monitoring kit. The specific steps are as follows:
[0081] 2.1 Add a final concentration of 10 4～5 copies / mL of molecular tags, mix thoroughly;
[0082] 2.2 Use commercially available pathogen extraction kits to extract nucleic acids from the samples to be tested, including molecular tags;
[0083] 2.3 Using the extracted nucleic acid as a template, amplification is performed using a multiplex targeted amplification primer pool containing molecular tag universal amplification primers.
[0084] Add each component to eight tubes for PCR amplification according to the following system:
[0085] Components Volume (μL) Enzyme premix (Novizan) 5 Multiplex targeted amplification primer pool F 2.5 Multiplex targeted amplification primer pool R 2.5 Nucleic acid template X(≤1ug) Nuclease-Free Water 14-X Total 25.0
[0086] 2.4 Set the following program on the PCR instrument for PCR amplification:
[0087]
[0088] 2.5 The above PCR product was purified using magnetic beads (Agencout AMPure XP, Beckman) with a final elution volume of 30 μL.
[0089] 2.6 Using the product obtained in step 2.5 as a template, add sequencing adapter sequences to the multiplex PCR amplification products to obtain a sequencing library.
[0090] Add each component to eight tubes for PCR amplification according to the following system
[0091] Components Volume (μL) Enzyme premix (Novizan) 12.5 Adapter Universal Primer Index (MGI) 5.0 Step 2.1.4 Product 20.0 Total 50.0
[0092] 2.7 Set the following program on the PCR instrument for PCR amplification:
[0093]
[0094] 2.8 The above PCR product was purified using magnetic beads (Agencout AMPure XP, Beckman) with a final elution volume of 30 μL.
[0095] 2.9 Perform high-throughput sequencing on the sequencing library obtained in step 2.7 to obtain a sequencing sequence.
[0096] 2.10 Compare the sequencing sequence with the molecular tag database and count the number of reads that accurately match the specific molecular tag.
[0097] IV. Clinical Sample Verification
[0098] In this example, 10 clinical samples with known pathogen infection were collected and cross contamination was verified and judged using the method of this application. The results are shown in Table 3 below.
[0099] Table 3. Clinical sample validation results
[0100]
[0101] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than to limit them. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the scope of the technical solutions of the embodiments of the present application.
Claims
1. A contamination monitoring kit suitable for multiple targeted sequencing, characterized by: It contains several different molecular tags and each molecular tag has unique identification. The several different molecular tags are all artificially synthesized base sequences, which have more than 90% difference from the human genome and the pathogen genome. Different molecular tags have the same 5' terminal base sequence and 3' terminal base sequence, and the intermediate base sequences of different molecular tags have more than 90% difference.
2. The contamination monitoring kit for multiple targeted sequencing according to claim 1, wherein: The 5' end sequence of each molecular tag is GTACAACCTTCGCTCTCGTC, and the 3' end sequence of each molecular tag is GTGGAGAGGTCATTGATGCG.
3. The contamination monitoring kit for multiple targeted sequencing according to claim 2, wherein: The nucleic acid sequence length of each molecular tag is 100 to 400 bp.
4. A method for monitoring sample contamination using the contamination monitoring kit according to any one of claims 1 to 3, characterized in that: Including the following step, Step S1, introducing a molecular tag into each sample to be detected, and different molecular tags are introduced into different samples to be detected; Step S2, using a commercially available pathogenic microorganism nucleic acid extraction kit to obtain nucleic acid from the sample to be tested mixed with molecular tags; Step S3, using the nucleic acid mixed with the molecular tag as a template, multiple targeted amplification is performed using a pool of targeted amplification primers to enrich the target sequence; Step S4, constructing a library for the enriched target sequences and sequencing them; Step S5: perform quality control on the molecular tags in the offline data to determine whether there is contamination in the sample to be tested.
5. The monitoring method according to claim 4, wherein the steps In S1, the amount of molecular tags introduced is 10 4～ 5 copies / mL.
6. The monitoring method according to claim 5, wherein: The multiple targeted amplification primer pool used in step S3 includes a pair of molecular tag universal amplification primers, and the sequence of the molecular tag universal amplification primer is: Forward primer sequence: GTACAACCTTCGCTCTCGTC; Reverse primer sequence: CGCATCAATGACCTCTCCAC.
7. The monitoring method according to claim 6, wherein: The quality control method of the molecular tags in step S5 is to compare with a previously established molecular tag database. If non-pre-introduced molecular tags are identified in the sample, it is determined that the test sample is contaminated; if only pre-introduced molecular tags are identified in the sample, it is determined that the test sample is not contaminated.
8. Use of the contamination monitoring kit suitable for multiplex targeted sequencing according to any one of claims 1 to 3 for monitoring sample contamination in multiplex targeted sequencing.