Polynucleotide for silent spindle microtubule assembly factor transcriptional variant 1 and application thereof

Abstract

The present invention relates to polynucleotides and methods for the treatment of primary or secondary solid tumors by inhibiting the activity of development-related pathways including Wnt, Hedgehog, and Notch pathways and the invasion ability of malignant cells.

Description

Cross-reference to related applications

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 414,461, filed October 8, 2022, the disclosure of which is hereby incorporated by reference in its entirety for all purposes. Technical Field

[0002] The present invention relates to the field of cancer treatment. Specifically, the present invention provides polynucleotides that silence spindle microtubule assembly factor (ASPM) and their use in treating cancer. Background Art

[0003] Developmental signaling pathways, including Wnt, Notch, and Hedgehog, regulate stem cell homeostasis in adult tissues and are often dysregulated during malignant transformation, leading to the stemness of tumors. Canonical Wnt signaling pathways, such as β-catenin, participate in epithelial tissue homeostasis by maintaining stem cell proliferation and migration, particularly in the intestine, mammary gland, and skin. Accumulating evidence suggests that Wnt-regulated autorenewal processes in tissue progenitor cells and stem cells are co-opted by cancer cells, promoting malignant progression. Consistently, compelling data now support a role for the Wnt / β-catenin signaling pathway in maintaining the cancer stem cell (CSC) phenotype in solid tumors. Increasing evidence indicates that Wnt signaling plays an important role in the metastatic colonization of cancer cells, and these experimental studies emphasize the interplay between microenvironmental factors and CSCs. For example, the stromal cell-derived extracellular matrix (ECM) protein periostin recruits Wnt ligands, thereby activating Wnt signaling in CSCs during breast cancer metastasis.

[0004] Cancer invasiveness and remote metastasis are the main causes of patient death, and understanding it is crucial for improving the prognosis of patients with solid tumors. Invadopodia (Invadopodia) or podosome (podosome) is a transient protrusion based on actin present in immune cells and some cancer cells, which mediates the focal degradation of extracellular matrix (ECM) by the local proteolytic activity of protease. In addition to directly degrading ECM, invadopodia also promotes cancer cell invasion (Iizuka, S., Leon, RP, Gribbin, KP, Zhang, Y., Navarro, J., Smith, R., Devlin, K., Wang, LG, Gibbs, SL, Korkola, J. et al., (2020). Crosstalk between invadopodia and the extracellular matrix. Eur J Cell Biol 99, 151122). Invadopodia have been shown to exist in vivo and are therefore hypothesized to play a key role in the establishment of distant metastases by promoting intravasation and extravasation. Based on these observations, a series of functional studies have shown that inhibition of invadopodia regulators, including SRC, PDGFR-α, TKS-5, or specific variants of MENA (MENA INV ), which can inhibit metastasis in various cancer models (Eckert, MA, Lwin, TM, Chang, AT, Kim, J., Danis, E., Ohno-Machado, L., and Yang, J. (2011). Twist1-induced invadopodia formation promotes tumor metastasis. Cancer Cell 19, 372-386; Weidmann, MD, Surve, CR, Eddy, RJ, Chen, X., Gertler, FB, Sharma, VP, and Condeelis, JS (2016). Mena (INV) dysregulates cortactin phosphorylation to promote invadopodium maturation. Sci Rep 6, 36142).

[0005] Therefore, there is a need for drugs and methods for treating and preventing cancer and its metastasis. Summary of the Invention

[0006] The present invention relates to polynucleotides and methods for treating primary or secondary solid tumors by inhibiting the activity of development-related pathways including Wnt, Hedgehog and Notch pathways and the invasive ability of malignant cells.

[0007] The present invention provides a polynucleotide comprising a nucleotide sequence complementary to the mRNA of the ASPM gene having the nucleotide sequence shown in SEQ ID NO: 1; or b) comprising a nucleotide sequence having a continuous segment having at least 70%, at least 80% or at least 90% sequence identity with the nucleotide sequence complementary to SEQ ID NO: 1.

[0008] In one embodiment, the polynucleotide comprises a nucleotide sequence complementary to an mRNA encoded by exon 18 of a transcript variant 1 of the human ASPM gene having the nucleotide sequence shown in SEQ ID NO: 3, or comprises a nucleotide sequence comprising a contiguous segment having at least 70%, at least 80%, or at least 90% sequence identity to a nucleotide sequence complementary to SEQ ID NO: 3.

[0009] In some embodiments, the polynucleotides described herein are RNAi. Examples of RNAi include, but are not limited to, shRNA, siRNA, or dsRNA.

[0010] Certain embodiments of the polynucleotides of the present invention are siRNA molecules, wherein the siRNA molecule comprises: (a) a duplex region; and (b) no overhang region or at least one overhang region, wherein each overhang region contains six or fewer nucleotides, wherein the duplex region consists of a sense region and an antisense region, wherein the sense region and the antisense region together form the duplex region and the antisense region and the sense region are each 15-30 nucleotides in length, and the antisense region comprises a sequence complementary to a sequence selected from SEQ ID NO: 3, 5, 7 or 9.

[0011] In some embodiments, siRNA molecules as described herein have antisense and sense regions that are each 15-25, 15-20, or 15-18 bases in length.

[0012] In some embodiments, the siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 3, 5, 7, or 9.

[0013] In some embodiments, the siRNA molecules described herein comprise a sense strand and an antisense strand, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 4 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 5 by no more than 3 nucleotides.

[0014] In a certain embodiment, the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:4 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:5.

[0015] In some embodiments, the siRNA molecules described herein comprise a sense strand and an antisense strand that form another double-stranded RNA dimer, wherein the sense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from SEQ ID NO: 6, and the antisense strand comprises at least 15 contiguous nucleotides that differ by no more than 3 nucleotides from SEQ ID NO: 7.

[0016] In a certain embodiment, the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:6 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:7.

[0017] In some embodiments, the siRNA molecules described herein comprise a sense strand and an antisense strand that form another double-stranded RNA dimer, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 8 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 9 by no more than 3 nucleotides.

[0018] In a certain embodiment, the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:8 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:9.

[0019] In some embodiments, the siRNA molecule has at least one overhang region or no overhang region.

[0020] In some embodiments, one or both of the sense and antisense strands can be further modified to form modified siRNAs. Examples of modified nucleotides include, but are not limited to, 2'-O-methyl modified nucleotides, 2'-fluorophosphoramidates, 3'-terminal deoxythymidine nucleotides, nucleotides containing unnatural bases, nucleotides containing 5' phosphorothioate groups, and terminal nucleotides linked to cholesterol derivatives and dodecanoic acid bisdecanoyl groups.

[0021] In some other embodiments, about 10% to about 30% of the nucleotides in the double-stranded region of the modified siRNA are 2'-O-methyl (2'OMe) nucleotides, or about 10% to about 30% of the nucleotides in both strands of the modified siRNA are 2'-O-methyl (2'OMe) nucleotides.

[0022] The present invention provides a pool of siRNA molecules, wherein the pool comprises one or more first siRNA molecules or modified siRNA molecules thereof, second siRNA molecules or modified siRNA molecules thereof, third siRNA molecules or modified siRNA molecules thereof, and fourth siRNA molecules or modified siRNA molecules thereof, in The first siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 3; The second siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 5; The third siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 7; and The fourth siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO:9.

[0023] In some embodiments, the siRNA molecules in the pool comprise one or more second siRNA molecules or modified siRNA molecules thereof, third siRNA molecules or modified siRNA molecules thereof, and fourth siRNA molecules or modified siRNA molecules thereof.

[0024] In some embodiments, the siRNA molecules in the pool comprise a sense strand and an antisense strand that form another double-stranded RNA dimer, wherein the sense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 4, 6, or 8 by no more than 3 nucleotides, and the antisense strand comprises at least 15 contiguous nucleotides that differ from SEQ ID NO: 3, 5, or 9 by no more than 3 nucleotides.

[0025] In another embodiment, the siRNA molecules in the pool comprise a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:4 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:5.

[0026] In another embodiment, the siRNA molecules in the pool comprise a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:6 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:7.

[0027] In another embodiment, the siRNA molecules in the pool comprise a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:8 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:9.

[0028] The present invention provides a pharmaceutical composition comprising at least one polynucleotide described herein and a pharmaceutical carrier, diluent and / or adjuvant.

[0029] The present invention provides a nanoparticle comprising a polynucleotide as described herein or any mixture thereof and a lipid nanoparticle (LNP), a liposome, a micelle, a virosome or a nucleic acid complex.

[0030] The present invention also provides a method for inhibiting the growth, local regional spread and distant metastasis of a malignant tumor in a subject and / or treating a solid tumor and / or tumor metastasis in a subject, comprising administering to the subject a polynucleotide described herein or any mixture thereof, a siRNA molecule pool described herein, a pharmaceutical composition described herein or a nanoparticle described herein.

[0031] In some embodiments, the human solid cancer is breast cancer, non-small cell lung cancer (NSCLC), PDAC, the sclerosing subtype of gastric adenocarcinoma, and the "stem / serrated / mesenchymal (SSM)" molecular subtype of colorectal cancer (CRC). BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figures 1 (A) and (B) show that ASPM expression is associated with breast cancer metastasis. (A) shows that ASPM is the top-ranked Wnt-related factor associated with breast cancer metastasis in the Pawitan et al. dataset. (B) shows Kaplan-Meier survival curves comparing distant metastasis-free survival in breast cancer patients stratified by ASPM expression using KM Plotter (http: / / kmplot.com / analysis / index.php?p=service) and SurvExpress (http: / / bioinformatica.mty.itesm.mx:8080 / Biomatec / SurvivaX.jsp). P values ​​were calculated using the log-rank test.

[0033] Figures 2(A) and (B) show that genetic knockdown (knockdown) of ASPM expression reduces the invasive ability of breast cancer cells. Lentivirus-mediated knockdown was used to stably downregulate ASPM-v1 expression in HCC-1954 and MDA-MB-436 breast cancer cells. The ability of control or ASPM-knocked cancer cells to invade across reconstituted basement membranes was examined using a modified Boyden chamber invasion assay. (A) shows representative immunofluorescence images of invasive cells, with nuclei stained with CYTOX-green. Scale bar = 100 μm. (B) shows the number of invasive cells in (A). Data are mean ± SEM. ***P < 0.001.

[0034] FIG3 (A) and (B) include several graphs related to the effects of genetic knockdown (knockdown) of ASPM expression on distant metastasis of breast and pancreatic cancer. (A) Shows representative bioluminescence (BLI) of metastatic lung tumors at the indicated times (weeks; wk) after cell inoculation. (B) Shows the BLI signal in (A) as normalized photon counts over time. Data are shown as mean ± SEM (n = 5 mice / group). **P ≤ 0.01 compared to control IgG.

[0035] Figures 4(A) and (B) include several graphs related to elevated ASPM expression in micrometastatic cancers in patient-derived xenograft (PDX) models of breast cancer progression. (A) shows representative flow cytometry images demonstrating the ASPM staining pattern of CD298-positive cancer cells in primary tumors and lung micrometastases. (B) shows elevated ASPM expression in CD298-positive cancer cells in micrometastatic lesions of two PDX models (BR1282 and BR1474). Data are mean ± SEM. **P < 0.01.

[0036] Figure 5The predicted domain architecture of human ASPM isoform 1 and isoform 2 proteins is shown. CH, calmodulin homology; ARM, armadillo; IQ, isoleucine and glutamine. The region encoded by exon 18, which carries the 67 IQ domains, is highlighted.

[0037] Figures 6(A) to (F) include several graphs related to the expression patterns of ASPM isoforms in normal and cancer tissues. (A) Shows the immunohistochemical (IHC) staining patterns of ASPM isoform 1 (ASPM-i1) and ASPM isoform 2 (ASPM-i2) in representative human breast cancer tissues and normal breast tissues. Scale bar, 50 μm. (B) Bar graph showing the distribution of single-cell staining intensity (1+ to 3+) for ASPM-i1 and ASPM-i2. Data are mean ± SEM (n = 40). ***P < 0.001. (C) Shows the IHC staining pattern of ASPM-i1 at the invasion front of representative human breast cancer tissues. Scale bar, 100 μm. (D) Bar graph showing the percentage of cancer cells with moderate (2+) to high (3+) ASPM-i1 staining intensity. Data are mean ± SEM (n = 46). ***P < 0.001. (E) IHC staining patterns of ASPM-i1 and ASPM-i2 in representative normal, hepatitis, and cirrhosis liver tissues, as well as HCC tissues. Scale bar, 50 μm. (F) Bar graph showing the distribution of single-cell staining intensity (1+ to 3+) of ASPM-i1 and ASPM-i2 in normal liver tissue (n = 24), hepatitis liver tissue (n = 10), cirrhosis liver tissue (n = 50), and HCC tissue (n = 111). Data are mean ± SEM. **P < 0.01; ***P < 0.001 compared with normal liver.

[0038] Figure 7 Figure 3. Immunoprecipitation of ASPM isoform 1 (ASPM-i1) with PAR planar cell polarity proteins, including PAR-6α, PAR-6β, Dishevelled-2 (DVL2), CDC42, and SMURF1, in invasive breast cancer MDA-MB-436 cells. Non-invasive cancer cells were included as controls.

[0039] Figures 8(A) and (B) include several images related to the specific interaction of ASPM isoform 1 (ASPM-i1) with the PAR / PCP proteins DVL2, PAR6β, and CDC42 in cancer cell invadopodia. (A) Confocal imaging shows colocalization of ASPM-i1 (red), DVL2, PAR6β, CDC42, or N-WASP (blue) and the invadopodia marker cortical actin (green) in invadopodia of breast cancer MDA-MB-436 cells. Scale bar, 10 μm. (B) Specific immunoprecipitation of ASPM-i1 with DVL2, PAR6β, CDC42, and N-WASP in invadopodia of invasive MDA-MB-436 cells is shown. Cortical actin and TKS5 are included as invadopodia markers.

[0040] Figures 9(A) to (C) show the effects of genetic knockdown (knockdown) of ASPM variant 1 (ASPM-v1; encoding "ASPM isoform 1" or "ASPM-i1") expression on invadopodia formation and invasive ability in breast cancer cells. MDA-MB-436 breast cancer cells were lentivirally transduced with a small hairpin RNA (shRNA) specifically targeting ASPM gene transcript variant 1 (ASPM-v1 shRNA), thereby knocking down ASPM-v1 expression. (A) shows the effects of specific ASPM-v1 shRNA isoforms (including ASPM.e18 shRNA#1 and ASPM.e18 shRNA#4) on ASPM-i1 protein abundance in MDA-MB-436 cells. (B) Shows that knockdown of ASPM-v1 expression reduces the recruitment of DVL2, PAR6β, CDC42, and membrane-type matrix metalloproteinase (MT1-MMP) to invadopodia of MDA-MB-436 cells. Shown are immunoblots of the indicated proteins in invadopodia lysates of MDA-MB-436 cells lentivirally transduced with control shRNA or ASPM.e18 shRNA#4. (C) Shows that knockdown of ASPM-v1 expression reduces the invasive ability of MDA-MB-436 cells, as assessed using a modified Boyden chamber invasion assay. Left, representative immunofluorescence images of invasive cells, with nuclei stained with CYTOX-green. Scale bar, 50 μm. Right, quantification of invasive cells. Data are mean ± SEM. ***P < 0.001.

[0041] Figure 10Genetic knockdown (knockdown) of ASPM variant 1 (ASPM-v1) expression (knockdown) impacts multiple developmental and stemness-related pathways. Relative luciferase reporter activity of designated developmental and stemness-related signaling pathways in 293T cells attenuated with ASPM-v1 using lentiviral-mediated transduction with ASPM.18 shRNA #4 or in these cells infected with a control shRNA lentivirus and transduced with reporter constructs from the Cignal Finder Stem Cell and Differentiation 10 Pathway Reporter Array (n=3 per group). *P<0.05; **P<0.01; ***P<0.001 compared to control shRNA.

[0042] Figure 11 Included are two figures related to the selection of optimized siRNAs targeting ASPM variant 1 (ASPM-v1). Shown are the transcript levels of ASPM-v1 in MDA-MB-436 cells transduced with equal amounts (all siRNAs at 50 nM) of the three top-ranked siRNAs described in step 4 or different combinations thereof, analyzed using qRT-PCR (mean ± SEM; n = 3). *P < 0.5; **P < 0.01; ***P < 0.001 compared to NT siRNA.

[0043] Figures 12 (A) and (B) show the effects of a lipid nanoparticle (LNP)-formulated small interfering RNA (siRNA) cocktail (LNP-siASPM-v1) specifically targeting the mRNA region of exon 18 of ASPM variant 1. (A) shows that treatment of breast cancer MDA-MB-436 cells with increasing concentrations (0-50 nM) of LNP-ASPM-v1 siRNA dose-dependently reduced ASPM-v1 transcript levels. (B) shows that treatment of MDA-MB-436 cells with LNP-siASPM-v1 dose-dependently reduced ASPM isoform 1 (ASPM-i1) protein abundance, but did not reduce ASPM isoform 2 (ASPM-i2) protein abundance. NT siRNA, non-target siRNA.

[0044] Figure 13 (A) and (B) show the effects of LNP-siASPM-v1 on invadopodia formation and invasive ability of cancer cells. (A) shows the inhibitory effect of LNP-delivered ASPM-v1-specific siRNA (LNP-siASPM-v1) on invadopodia formation in cancer cells. The left panel shows confocal images of cortical actin + F-actin + puncta (yellow), representing cross-sections of downward-protruding invadopodia, in MDA-MB-436 cells treated with LNP-siASPM-v1 or LNP-nontarget control siRNA (NT siRNA) (both at 100 nM for 72 hours). The right panel shows the number of cortical actin + F-actin + invadopodia per cell. Scale bar, 10 μm. Data are mean ± SEM. ***P < 0.001 (B) shows that treatment of MDA-MB-436 cells substantially inhibited their invasive ability, as assessed using a two-chamber invasion assay. The left panel shows representative immunofluorescence images of invasive cells, with nuclei stained with CYTOX-green (green). Scale bar = 500 μm. The right panel shows the number of invasive cells. Data are mean ± SEM. **P < 0.01.

[0045] Figures 14(A) to (C) include several graphs related to the effects of LNP-formulated ASPM variant 1-specific siRNA (LNP-siASPM-v1) on Wnt activity, stemness, and tumorigenicity of hepatocellular carcinoma (HCC) cells. (A) Shows the fold increase in Wnt-specific luciferase expression in HuH-1 cells treated with LNP-siASPM-v1 or LNP-non-target control siRNA (NT siRNA) (both at 100 nM for 72 hours) and subsequently treated with WNT3A (250 ng / ml for 16 hours). (B) Shows the percentage of aldehyde dehydrogenase (ALDH)-positive cells (representing cancer stemness in HCC) in HuH-1 cells treated with LNP-siASPM-v1 or LNP-non-target control siRNA as in (A). Data are shown as mean ± SEM (n = 3). ***P ≤ 0.001 compared to LNP-NT siRNA in (A) and (B). (C) shows the inhibitory effect of LNP-siASPM-v1 on the tumor sphere formation ability of HCC cells. HuH-1 cells were treated with LNP-siASPM-v1 or LNP NT siRNA as in (A). The cells were then cultured for ten days in serum-free, non-adherent culture plates. Representative phase-contrast images of the resulting tumor spheres are shown. Scale bar, 50 μm. Right panel: Limiting dilution analysis demonstrating the cells' tumor sphere formation ability. Data are mean ± SEM (n = 4 in each group).

[0046] Figures 15(A) to (D) include several figures related to the pharmacodynamics study of the systemic LNP-formulated siRNA therapy targeting ASPM variant 1, LNP-siASPM-v1, in an orthotopic mouse model of triple-negative breast cancer (TNBC). (A) shows orthotopic injection of MDA-MB-436 breast cancer cells expressing GFP and firefly luciferase (FF-Luc) into the mammary fat pad of immunodeficient NOD / SCID mice. Ten days after cell inoculation, when tumors were detectable by bioluminescence (BLI), tumor-bearing mice received two intravenous injections of Cy5-labeled LNP-siASPM-v1 (100 μg [approximately 4 mg / kg] per mouse) every three days. Tumors were removed at the designated times after the second injection for cell dissociation, and GFP+ cancer cells were sorted for subsequent analysis. (B) shows representative FACS plots showing the GFP and Cy5 staining patterns of the cancer cells described in (A) and the frequency of the Cy5+GFP+ cell population. Right panel: Percentage of Cy5+ cancer cells at different times after treatment. T1 / 2: half-life. (C) Representative confocal images showing accumulation of Cy5-labeled siRNA (red) in the cytoplasm of breast tumor cells following intravenous LNP-ASPM-v1 siRNA treatment. The cytoplasm was labeled by staining F-actin with muscimol (green). Cell nuclei were counterstained with DAPI (blue). Scale bar, 5 μm. (D) Representative immunoblots showing the specific attenuation effect of systemic LNP-siASPM-v1 therapy on the protein abundance of ASPM-isoform 1 (ASPM-i1) in treated tumors. Right panel: Relative protein abundance of ASPM-i1 in tumor-bearing mice treated with LNP-nontarget control siRNA (NT siRNA) or LNP-siASPM-v1. Data are mean ± SEM (n = 3 in each group). *P < 0.05.

[0047] Figures 16(A) to (C) include several figures related to the anti-metastatic efficacy of ASPM variant 1 (ASPM-v1) targeted siRNA therapy in an orthotopic mouse model of triple-negative breast cancer (TNBC). (A) shows orthotopic injection of TNBC MDA-MB-436 cells stably expressing firefly luciferase (FF-Luc) into the mammary fat pad of immunodeficient NOD / SCID mice. Two weeks after cell inoculation, when tumors were detectable by BLI, tumor-bearing mice received intravenous (IV; 2 mg / kg or 4 mg / kg every three days; 6 doses total) injections of LNP-siASPM-v1 or LNP-non-target control siRNA (NTsiRNA). (B) Shows representative BLI of primary or metastatic tumors (lung windows) at the indicated times after the start of treatment in (A). (C) Shows tumor volume in (B), quantified as BLI-normalized photon counts over time. Data are shown as mean ± SEM (n = 5 mice / group). Compared with LNP-NT siRNA, **P≤0.01; ***P≤0.001.

[0048] Figures 17(A) to (C) include several figures related to the anti-metastatic effect of systemic ASPM variant 1 (ASPM-v1)-targeted siRNA therapy in distant metastases of triple-negative breast cancer (TNBC). (A) shows the tail vein injection of NOD / SCID mice with MDA-MB-436 cells expressing firefly luciferase (FF-Luc). Twenty-four hours after cell inoculation, mice received intravenous injections of LNP-siASPM-v1 (100 μg [approximately 4 mg / kg] per mouse every three days; a total of 6 doses) or LNP-nontarget control siRNA (NTsiRNA), and the distribution of metastatic tumors was monitored by BLI. (B) Shows representative BLI of metastatic tumors at the indicated times after cell inoculation. (C) Shows the BLI signal in (B), displayed as normalized photon counts over time. Data are shown as mean ± SEM (n = 5 mice / group). **P ≤ 0.01 compared to LNP-NT siRNA.

[0049] Figures 18(A) and (B) include several figures related to the antitumor efficacy of intratumoral ASPM variant 1 (ASPM-v1)-targeted siRNA therapy in a mouse xenograft model of hepatocellular carcinoma (HCC). (A) shows HuH-1 cells stably expressing GFP and firefly luciferase (FF-Luc) were subcutaneously injected into the flank of immunodeficient NOD / SCID mice. Tumor-bearing mice were administered LNP-siASPM-v1 or LNP-nontarget control siRNA (NT siRNA; 0.8 mg / kg or 2 mg / kg oligonucleotide per intratumoral injection every three days for a total of three doses), with or without concurrent intraperitoneal (IP) injection of sorafenib (15 mg / kg / day for ten consecutive days) or vehicle. Representative bioluminescence (BLI) of tumors at the indicated times after cell inoculation is shown. (B) shows tumor volume of the tumor-bearing mice described in (A), quantified as BLI-normalized photon counts over time. Data are shown as mean ± SEM (n = 8 mice / group). *P ≤ 0.05 compared with LNP-NT siRNA. Data are shown as mean ± SEM (n = 3 mice / group).

[0050] Figures 19(A) and (B) include several figures related to the anti-tumor efficacy of ultrasound-guided intratumoral ASPM variant 1 (ASPM-v1)-targeted siRNA therapy in an orthotopic mouse xenograft model of hepatocellular carcinoma (HCC). (A) shows HuH-1 cells injected into the left lobe of the liver of NOD / SCID mice. Two weeks after cell inoculation, tumor-bearing mice received ultrasound-guided intratumoral injections of LNP-siASPM-v1 or LNP-nontargeted control siRNA (NT siRNA; 0.8 mg / kg every three days for a total of three injections). (B) shows representative photographs of the tumors in (A) at study endpoint. Right panel, tumor volume plotted over time. Data are shown as mean ± SEM (n = 5 mice / group). **P ≤ 0.01 compared to LNP-NT siRNA.

[0051] Figures 20(A) to (E) include several figures related to the antitumor efficacy of systemic ASPM variant 1 (ASPM-v1)-targeted siRNA in an orthotopic mouse model of hepatocellular carcinoma (HCC). (A) shows HuH-1 cells expressing GFP and FF-Luc were injected into the left lobe of the liver of immunodeficient NOD / SCID mice. Two weeks after cell inoculation, tumor-bearing mice subsequently received repeated intravenous injections of LNP-siASPM-v1 or LNP-nontarget control siRNA (NT siRNA; 4 mg / kg every three days for a total of six doses). (B) shows accumulation of siRNA in liver tumors of treated mice. Three days after two consecutive injections of LNP-siASPM-v1 (100 μg per mouse per injection), tumors established in (A) were removed for cell dissociation and FACS analysis. Representative FACS plots of Cy5 in GFP-positive tumor cells isolated from LNP-formulated and Cy5-labeled siASPM-v1 or in these tumor cells from untreated tumors are shown. (C) Shows representative BLI of tumors at the indicated times after initiation of treatment in (A). (D) Shows tumor volume in (C), quantified as BLI-normalized photon counts over time. Data are shown as mean ± SEM (n = 7 mice / group). *P ≤ 0.05 compared to LNP-NT siRNA. (E) Shows the percentage survival of mice described in (D) over time. Arrows: siRNA injection.

[0052] Figures 21(A) and (B) include several graphs related to the gene silencing efficacy of unmodified and chemically modified siASPM-v1.7636 and siASPM-v1.4822 in cancer cells. (A) shows the transcript levels of ASPM variant 1 (ASPM-v1) in breast cancer MDA-MB-436 cells transduced with siASPM-v1.7636, siASPM-v1.4822, or a 1:1 mixture thereof, as described in Table 5, analyzed using qRT-PCR analysis (mean ± SEM; n = 3). (B) shows the transcript levels of ASPM-v1 in hepatocellular carcinoma HuH-1 cells transduced with unmodified or chemically modified siASPM-v1.7636, siASPM-v1.4822, or a 1:1 mixture thereof, as described in (A) (mean ± SEM; n = 3). ***P<0.001 compared with chemically modified non-target (NT) siRNA (NT siRNA).

[0053] Figures 22(A) and (B) include several figures related to the effects of the siASPM-v1 active pharmaceutical ingredient (API) on invadopodia formation in cancer cells. (A) shows the inhibitory effect of siASPM-v1 API on invadopodia formation in HCC HuH-1 cells. The left panel shows confocal images of cortical actin + F-actin + puncta (yellow), representing cross-sections of downward-projecting invadopodia, in HuH-1 cells transduced with siASPM-v1 API or chemically modified non-target control siRNA (NT siRNA; both at 100 nM for 72 hours) using Lipofectamine LTX reagent. The right panel shows the number of cortical actin + F-actin + puncta (representing invadopodia) per cell. Scale bar, 10 μm. Data are mean ± SEM. ***P < 0.001. (B) shows the inhibitory effect of siASPM-v1 API on invadopodia formation in TNBC MDA-MB-436 cells. The left panel shows confocal images of cortical actin and F-actin puncta (yellow) in HuH-1 cells transduced with siASPM-v1 API or non-targeting control siRNA (NT siRNA; both at 100 nM for 72 hours) using Lipofectamine LTX reagent. These puncta represent cross-sections of downward-projecting invadopodia. The right panel shows the number of invadopodia per cell. Scale bar, 10 μm. Data are mean ± SEM. ***P < 0.001.

[0054] Figure 23 Transduction with the siASPM-v1 active pharmaceutical ingredient (API) inhibits the invasive ability of HuH-1 hepatocellular carcinoma or MDA-MB-436 breast cancer cells. The left panel shows representative immunofluorescence images of invasive cells, with nuclei stained with CYTOX-green (green). Scale bar = 100 μm. The right panel shows the number of invasive cells. Data are mean ± SEM. ***P < 0.001.

[0055] Figures 24 (A) and (B) include several graphs related to the effects of the siASPM-v1 active pharmaceutical ingredient (API) on Wnt, Hedgehog, and Notch pathway activity in cancer cells. HuH-1 hepatoma cells (A) or MDA-MB-436 breast cancer cells (B) carrying triple luciferase reporters for measuring Wnt, Hedgehog, and Notch pathway activity were transduced with 100 nM siASPM-v1 API or non-target control siRNA (NT siRNA) using Lipofectamine LTX reagent for 48 hours. Cells were then stimulated with SHH (3 μg / ml for 24 hours), WNT3A (250 ng / ml for 16 hours), JAG1-Fc (5 μg / ml for 24 hours), or vehicle for 24 hours, followed by measurement of the respective reporter activity. **P<0.01; ***P<0.001 compared to control.

[0056] Figures 25(A) and (B) include several graphs related to the gene silencing efficacy of unmodified and chemically modified siASPM-v1.4360 and siASPM-v1.4822 in cancer cells. (A) shows the transcript levels of ASPM-v1 in HuH-1 hepatocellular carcinoma cells transduced (48 hours) with 100 nM siASPM-v1.4360 and siASPM-v1.4822, or a 1:1 mixture thereof (designated "siASPM-v1 active pharmaceutical ingredient version 2" or "siASPM-v1 API_V2"), or their chemically modified versions (mean ± SEM; n = 3), analyzed using qRT-PCR analysis. siNT, non-target siRNA. (B) shows the transcript levels of ASPM-v1 in HCT-116 colorectal cancer cells transduced with unmodified or chemically modified siRNA as in (A) (mean ± SEM; n = 3). ***P<0.001 compared with siNT.

[0057] Figures 26 (A) and (B) include several graphs related to the inhibitory effect of siASPM-v1 active pharmaceutical ingredient version 2 (API_V2) on the formation of invadopodia in cancer cells. (A) shows the inhibitory effect of siASPMv1 API_V2 on the formation of invadopodia in HuH-1 liver cancer cells. The left graph shows the expression of TKS5 in HuH-1 cells transduced with siASPM-v1 API_V2 or chemically modified non-target control siRNA (m-siNT; both at 100 nM for 72 hours). + Col1-3 / 4C +Confocal view of a spot (yellow), which represents a cross-section of an invadopodia protruding downward. Right panel, number of TKS5+Col1-3 / 4C+ (representing functional invadopodia) per cell. Scale bar, 10 μm. Data are mean ± SEM. ***P < 0.001. (B) shows the inhibitory effect of siASPM-v1API_V2 on invadopodia formation in HCT-116 colorectal cancer cells. Left panel shows TKS5 in HCT-116 cells transduced with siASPM-v1API_V2 or m-siNT (both 100 nM × 72 hours). + Col1-3 / 4C + Confocal image of a spot (yellow) representing a cross-section of a downward-projecting invadopodia. Right panel, number of invadopodia per cell. Scale bar, 10 μm. Data are mean ± SEM. ***P < 0.001.

[0058] Figures 27 (A) and (B) show several figures related to the inhibitory effect of siASPM-v1 active pharmaceutical ingredient version 2 (API_V2) on cancer cell invasion. (A) shows representative immunofluorescence images of invasive HhH-1 hepatocellular carcinoma cells or HCT-116 colorectal cancer cells treated with chemically modified non-target siRNA (m-siNT) or siASPM-v1 API_V2, with cell nuclei stained with CYTOX-green. Scale bar = 100 μm. (B) shows the number of invasive cells. Data are mean ± SEM. ***P < 0.001.

[0059] Figure 28 Demonstrating the inhibitory effects of siASPM-v1 active pharmaceutical ingredient version 2 (API_V2) on Wnt, Hedgehog (Hh), and Notch signaling pathways, as well as TEAD activity, in cancer cells. HuH-1 hepatocellular carcinoma cells (left) or HCT-116 colorectal cells (right) were lentivirally infected with reporter constructs for Wnt, Hh, Notch signaling pathways, or TEAD transcriptional activity. Cells were then transduced with 100 nM chemically modified non-target siRNA (m-siNT) or siASPM-v1 API_V2 using Lipofectamine LTX reagent for 48 hours. Cells were then stimulated for 24 hours with SHH (3 μg / ml for 24 hours), WNT3A (250 ng / ml for 16 hours), and JAG-Fc (5 μg / ml for 24 hours), respectively. **P<0.01; ***P<0.001 compared to m-siNT.

[0060] Figures 29 (A) and (B) include several graphs related to the inhibitory effect of siASPM-v1 active pharmaceutical ingredient version 2 (API_V2) on the tumor sphere-forming ability of cancer cells. (A) Shows representative phase-contrast images of tumor spheres formed from HuH-1 hepatocellular carcinoma or HCT-116 colorectal cancer cells transduced with chemically modified non-target siRNA (m-siNT) or siASPM-v1 API_V2. Scale bar, 100 mm. (B) Shows limiting dilution analysis demonstrating the tumor sphere-forming efficacy (1 / n) of HuH-1 or HCT-116 cells transduced with m-siNT or siASPM-v1 API_V2. n = 8 independent experiments. Maximum likelihood estimate with 95% confidence interval. ***P < 0.001; likelihood ratio test and chi-square test. DETAILED DESCRIPTION

[0061] Unless otherwise stated, the following terms and phrases have the meanings provided below.

[0062] The term "ribonucleotide" and the phrase "ribonucleic acid" (RNA) refer to a modified or unmodified nucleotide or polynucleotide comprising at least one ribonucleotide unit. The ribonucleotide unit comprises a hydroxyl group linked to the 2' position of a ribosyl moiety, a nitrogenous base linked to the 1' position of the ribosyl moiety by an N-glycosidic bond, and a moiety that allows or precludes linkage to another nucleotide.

[0063] As used herein, the term "interfering RNA" or "RNAi" or "interfering RNA sequence" refers to a double-stranded RNA (i.e., duplex RNA) that targets (i.e., silences, reduces, or inhibits) the expression of a target gene (i.e., by mediating the degradation of an mRNA complementary to the interfering RNA sequence) when the interfering RNA and the target gene are in the same cell. Thus, interfering RNA refers to a double-stranded RNA formed by two complementary strands or by a single self-complementary strand. Specifically, an RNAi molecule refers to an shRNA, siRNA, or dsRNA as disclosed herein. Small hairpin RNA (shRNA) is an RNA sequence that forms a rigid hairpin turn and can be used to silence gene expression through RNA interference. shRNA can be delivered to target cells using DNA plasmids, viral vectors, or bacterial vectors. Double-stranded RNA (dsRNA) comprises a large class of viruses. Small interfering RNA (siRNA) is a class of double-stranded RNA molecules that include two independent strands of a duplex, as well as a single strand that can form a hairpin structure containing a duplex region. siRNAs are relatively short (generally about 18-30 base pairs in length). siRNA can be used to silence gene expression through RNA interference. In addition, siRNAs can vary in length and contain varying degrees of complementarity to the target mRNA in their antisense strands. Some, but not all, siRNAs have unpaired overhanging bases at the 5' or 3' end of the sense and / or antisense strands.

[0064] As used herein, the term "complementary nucleotide sequence" refers to a complementary RNA that is complementary to the mRNA transcript region of the target mutant gene (ie, the "corresponding nucleotide sequence" of the target gene).

[0065] As used herein, an excipient is an inactive ingredient in a pharmaceutical composition. Examples of excipients include fillers or diluents, surfactants, binders, glidants, lubricants, disintegrants, and the like.

[0066] As used herein, the term "substantial identity" refers to sequences that hybridize to a reference sequence under stringent conditions, or sequences that have a specified percent identity over a specified region of a reference sequence.

[0067] As used herein, the phrase "stringent hybridization conditions" refers to conditions under which a probe typically hybridizes to its target subsequence in a complex mixture of nucleic acids, but not to other sequences. Stringent conditions are sequence-dependent and will vary from situation to situation. Longer sequences hybridize specifically at higher temperatures. A comprehensive guide to nucleic acid hybridization is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assay" (1993). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) of the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (since the target sequence is present in excess, at the Tm, 50% of the probes are occupied at equilibrium). Stringent conditions can also be achieved by adding destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization.

[0068] As used herein, the term "substantially identical" or "substantial identity" in the context of two or more nucleic acids refers to two or more sequences or subsequences that are identical or have a specified percentage of nucleotide identity (i.e., at least about 60%, preferably 65%, 70%, 75%, preferably 80%, 85%, 90%, or 95% identity over a specified region) when compared and aligned over a comparison window or designated region for maximum correspondence using one of the following sequence comparison algorithms or by manual alignment and visual inspection. When the context indicates, this definition also refers to the complement of a sequence. Preferably, substantial identity exists over a region of at least about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, or 100 nucleotides in length.

[0069] The term "transfection" refers to the process of introducing an agent into a cell.

[0070] The phrase "inhibit the expression of a target gene" refers to the ability of the siRNA molecules of the present invention to silence, reduce, or inhibit the expression of a target gene. To examine the extent of gene silencing, a test sample (e.g., a biological sample from an organism of interest expressing the target gene or a cell sample in culture expressing the target gene) is contacted with an siRNA that silences, reduces, or inhibits the expression of the target gene. The expression of the target gene in the test sample is compared to the expression of the target gene in a control sample that has not been contacted with the siRNA. The control sample is assigned a value of 100%. Silencing, inhibition, or reduction of target gene expression is achieved when the test sample has a test value relative to the control sample of about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 10%. Suitable assays include, for example, examining protein or mRNA levels using techniques known to those skilled in the art, such as dot blotting, Northern blotting, in situ hybridization, ELISA, immunoprecipitation, enzyme function, and phenotypic assays known to those skilled in the art.

[0071] The terms "treatment" and "treating" encompass therapeutic treatment of a patient who has developed the condition, particularly in an overt form. Therapeutic treatment can be symptomatic, thereby alleviating the symptoms of a particular indication, or causal, thereby reversing or partially reversing the condition of the indication or halting or slowing the progression of the disease. Thus, the compositions and methods of the present invention can be used, for example, as therapeutic treatments for a period of time as well as for long-term treatment.

[0072] The terms "prophylactically treating," "preventively treating," and "prevention" are used interchangeably and encompass treating a patient at risk of developing the above-mentioned conditions, thereby reducing that risk.

[0073] ASPM has been identified as a key regulator of the Wnt signaling pathway. It was found that in pancreatic cancer cells and prostate cancer cells, ASPM expression is essential for the cell's response to canonical Wnt ligands (such as Wnt-3a). Mechanistic studies have shown that ASPM interacts with upstream activators of β-catenin, including dishevel (Dvl)-2 or Dvl-3, axin, and protease-activated receptor-1 (PAR-1), and inhibits the proteasome-dependent degradation of Dvl protein, thereby increasing the protein abundance level of β-catenin and enhancing canonical Wnt signaling, which is important for its carcinogenic effect. ASPM expresses its oncogenic and Wnt-activating effects mainly through the protein stabilization of Dvl and the role of DVL in canonical and atypical Wnt signaling, indicating that ASPM can also act as an atypical Wnt signaling activator in adenocarcinoma cells or CSCs. ASPM and its binding partner DVL were found to be greatly upregulated in CSCs of various cancer cell types, including pancreatic cancer, breast cancer, non-small cell lung cancer, prostate cancer, and hepatocellular carcinoma (HCC).

[0074] It has been predicted that several putative splice variants of the ASPM transcript may exist in normal and malignant human tissues, encoding protein isoforms consisting of 3477 amino acids (isoform 1), 1892 amino acids (isoform 2), 1389 amino acids (isoform 3), and 1062 amino acids (isoform 4), respectively (Kouprina, N., Pavlicek, A., Collins, NK, Nakano, M., Noskov, VN, Ohzeki, J., Mochida, GH, Risinger, JI, Goldsmith, P., Gunsior, M., et al., (2005). The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein. Hum Mol Genet 14, 2155-2165). The specific upregulation of ASPM isoform 1 and its prognostic significance make this isoform an ideal and potentially safe therapeutic target in cancer.

[0075] In one embodiment, the present invention provides a polynucleotide comprising a nucleotide sequence complementary to the mRNA of the ASPM gene having the nucleotide sequence shown in SEQ ID NO: 1; b) comprising a nucleotide sequence having a continuous segment having at least 70%, at least 80%, or at least 90% sequence identity with the polynucleotide shown in a).

[0076] The polynucleotide of the present invention may be an RNAi molecule, such as shRNA, siRNA, miRNA, dsRNA or antisense oligonucleotide (ASO) or any derivative thereof, which is complementary to the coding or non-coding region of the mRNA of the ASPM gene (SEQ ID NO: 1) and thereby induces its specific degradation or reduces its amount.

[0077] The polynucleotide of the present invention can also be complementary to the mRNA encoded by exon 18 of the human ASPM gene shown in SEQ ID NO: 3, such that the polynucleotide only induces the degradation or reduction of the transcript variant 1 of ASPM but does not induce the degradation or reduction of the other transcript variants.

[0078] Specifically, the polynucleotides of the present invention are siRNAs of about 15-60, 15-50, 15-50, or 15-40 (duplex) nucleotides in length, more typically about 15-30 or 15-25 (duplex) nucleotides in length, and preferably about 20-24, 21-22, or 21-23 (duplex) nucleotides in length (e.g., each complementary sequence of a double-stranded siRNA is about 15-60, 15-50, or 15-40 (duplex) nucleotides in length). The length of the double-stranded siRNA is preferably about 15-50, 15-50, 15-40, 15-30, or 15-25 nucleotides, preferably about 20-24, 21-22, or 21-23 nucleotides in length, and the length of the double-stranded siRNA is about 15-60, 15-50, 15-50, 15-40, 15-30, 15-25, or 19-25 base pairs, preferably about 20-24, 21-22, or 21-23 base pairs in length. The siRNA duplex may comprise a 3' overhang of about 1 to about 4 nucleotides, preferably about 2 to about 3 nucleotides, and a 5' phosphate terminus. Examples of siRNA include, but are not limited to, double-stranded polynucleotide molecules assembled from two separate oligonucleotides, one of which is the sense strand and the other is the complementary antisense strand; double-stranded polynucleotide molecules assembled from a single oligonucleotide, wherein the sense and antisense regions are connected by a nucleic acid-based or non-nucleic acid-based linker; double-stranded polynucleotide molecules having a hairpin secondary structure having self-complementary sense and antisense regions; and circular single-stranded polynucleotide molecules having two or more loop structures and a stem having self-complementary sense and antisense regions, wherein the circular polynucleotide can be processed in vivo or in vitro to generate an active double-stranded siRNA molecule.

[0079] In one embodiment of the present invention, the siRNA may be double-stranded and may include at least one blunt end. For example, the siRNA may be a siRNA with blunt ends at both ends; a siRNA with a blunt end at one end and a 5'2 nucleotide overhang at the other end; a siRNA with a blunt end at one end and a 3'2 nucleotide overhang at the other end; and / or combinations thereof. Alternatively, in this embodiment, the siRNA introduced into the cell may be double-stranded and include a 5'2 nucleotide overhang at each end. In a specific embodiment, the overhang may include about 1 nucleotide to about 5 nucleotides. In another embodiment, the siRNA may be double-stranded and include at least 2 overhangs. The overhang may include about 1 nucleotide to about 5 nucleotides. In a specific embodiment, each of the at least 2 overhangs includes 2 nucleotides. In this embodiment of the present invention, the siRNA may be a siRNA with both 3' ends including a 2 nucleotide overhang; a siRNA with a 3'2 nucleotide overhang at one end and a 5'2 nucleotide overhang at the other end; and / or combinations thereof.

[0080] siRNAs can be modified to contain synthetic, naturally occurring, and non-naturally occurring backbone residues or linkages to form analogs that have similar binding properties to the reference nucleic acid and are metabolized in a manner similar to the reference nucleotide. siRNAs can be modified according to methods known in the art, and modifications include substitutions or additions of one or more atoms or groups to one or more nucleotide bases. Some examples of types of modifications that can include modified nucleotides relative to the base moiety include, but are not limited to, alkylation, halogenation, thiolation, amination, amidation, or acetylation of bases, alone or in combination. Some examples include, for example, 2-propyladenine, 2-propylguanine, 2-aminoadenine, 1-methylinosine, 3-methyluridine, 5-propynyluridine, 5-propynylcytidine, 6-methyladenine, 6-methylguanine, N,N,-dimethyladenine, 5-methylcytidine, 5-methyluridine and other nucleotides with modifications at the 5 position, 1-methyladenosine, 2-methyladenosine, 3-methylcytidine, 5-(2-amino)propyluridine, 5-halocytidine, 5-halouridine, 4-acetylcytidine, 6-methyluridine, 2-methylguanosine, 7-methylguanosine, 2,2-dimethylguanosine, 5-methylaminoethyluridine, 5-methoxyuridine, deazanucleotides such as 7-deaza-adenosine, 6-azouridine, 6-azocytidine, 6-azo In some embodiments, the nucleotides of the present invention include 5-nitrothymidine, 5-methyl-2-thiouridine, other thiobases such as 2-thiouridine, 4-thiouridine and 2-thiocytidine, dihydrouridine, pseudouridine, Q nucleosides, archaeosides, naphthyl and substituted naphthyl groups, any O-alkylated purines and pyrimidines and N-alkylated purines and pyrimidines such as N6-methyladenosine, 5-methylcarbonylmethyluridine, uridine 5-oxyacetic acid, pyridin-4-one, pyridin-2-one, phenyl and modified phenyl groups such as aminophenol or 2,4,6-trimethoxybenzene, modified cytosines that act as G-clamp nucleotides, 8-substituted adenines and guanines, 5-substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylamino nucleotides and alkylcarbonylalkylated nucleotides. Other specific examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2'-O-methyl ribonucleotides, and peptide nucleic acids (PNAs). Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues.

[0081] Chemical modification of siRNA includes attaching a conjugate to the siRNA molecule. The conjugate can be attached to the 5' and / or 3' end of the sense strand and / or antisense strand of the siRNA via a covalent linker (such as a biodegradable linker). The conjugate can also be attached to the siRNA, for example, via a carbamate group or other linking group. In some cases, the conjugate is a molecule that facilitates the delivery of the siRNA into cells. Examples of conjugate molecules suitable for attachment to siRNA include, but are not limited to, steroids (such as cholesterol), glycols (such as polyethylene glycol (PEG)), human serum albumin (HSA), fatty acids, carotenoids, terpenes, bile acids, folates (such as folic acid, folic acid analogs and derivatives thereof), sugars (such as galactose, galactosamine, N-acetylgalactosamine, glucose, mannose, fructose, trehalose, etc.), phospholipids, peptides, ligands for cell receptors capable of mediating cellular uptake, and combinations thereof.

[0082] siRNA can be chemically synthesized or can be encoded by a plasmid (e.g., transcribed as a sequence that automatically folds into a duplex with a hairpin loop). siRNA can also be produced by cleaving longer dsRNA (e.g., dsRNA greater than about 25 nucleotides in length) with E. coli RNase III or Dicer. These enzymes process dsRNA into biologically active siRNA.

[0083] Substantial identity refers to sequences that hybridize to a reference sequence under stringent conditions, or sequences that have a specified percent identity over a specified region of a reference sequence.

[0084] For sequence comparison, usually a sequence serves as a reference sequence and is compared with a test sequence. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. Default program parameters can be used, or alternative parameters can be specified. The sequence comparison algorithm then calculates the sequence identity percentage of the test sequence relative to the reference sequence based on the program parameters. The sequence alignment method for comparison is well-known in the art. The optimal comparison of the sequence for comparison can be performed.

[0085] Preferred examples of algorithms suitable for determining percent sequence identity and percent sequence similarity are BLAST and BLAST 2.0 algorithms. BLAST and BLAST 2.0 are used together with the parameters described herein to determine percent sequence identity for nucleic acids and proteins of the present invention. Software for performing BLAST analysis is publicly available through the Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ).

[0086] Once a potential siRNA sequence is identified, the sequence can be analyzed using a variety of criteria known in the art. One skilled in the art will appreciate that sequences having one or more of the aforementioned characteristics can be selected as potential siRNA sequences for further analysis and testing. siRNA sequences can also be designed that are complementary to the siRNA target site.

[0087] The polynucleotides of the present invention may be operably linked to control sequences or gene promoters that direct the expression of the polynucleotides in specific tissues and / or cell types. Such control sequences are well known in the art and can be constructed in any of a variety of ways known to those skilled in the art.

[0088] Methods suitable for use in the present invention for determining the expression of ASPM mRNA include an assay selected from the group consisting of Northern blotting, reverse transcription polymerase chain reaction (PCR), RNase protection assay, cDNA or oligonucleotide microarray analysis, nucleotide sequencing, or probe-based digital mRNA profiling technology such as the NanoString nCounter Gene Expression System (Geiss, GK, Bumgarner, RE, Birditt, B., Dahl, T., Dowidar, N., Dunaway, DL, Fell, HP, Ferree, S., George, RD, Grogan, T., et al., (2008). Direct multiplexed measurement of gene expression with color-coded probe pairs. Nat Biotechnol 26, 317-325).

[0089] Methods suitable for use in the present invention for determining the expression of ASPM protein include analytical methods selected from the group consisting of Western blotting, ELISA, immunoprecipitation, glutathione-S-transferase fusion protein pull-down, fluorescence anisotropy, fluorescence polarization, fluorescence resonance energy transfer, analytical ultracentrifugation, surface plasmon resonance, and isothermal titration calorimetry.

[0090] In one embodiment, the present invention provides a pool or set of at least one siRNA, preferably in the form of a set or therapeutic agent, wherein one strand of each siRNA, the sense strand, comprises a sequence substantially similar to a sequence within the target mRNA. The opposite strand, the antisense strand, will preferably comprise a sequence substantially complementary to the sequence of the target mRNA. More preferably, one strand of each siRNA will comprise a sequence identical to a sequence contained in the target mRNA. Most preferably, each siRNA is 15-25, 15-20, or 15-18 base pairs in length, and one strand of each siRNA will be 100% complementary to a portion of the target mRNA. By increasing the number of siRNAs directed against a particular target using a pool or set, one can increase the likelihood of including at least one siRNA with satisfactory functionality and benefit from additive or synergistic effects. Furthermore, when two or more siRNAs directed against a single gene do not individually exhibit satisfactory functionality, when combined, they can satisfactorily promote degradation of the target messenger RNA and successfully inhibit translation.

[0091] The siRNA duplexes in the aforementioned siRNA pool or set can correspond to overlapping sequences in a particular mRNA or non-overlapping sequences of an mRNA. However, preferably, they correspond to non-overlapping sequences. In addition, each siRNA can be randomly selected, or one or more siRNAs can be selected according to the criteria discussed above to maximize the effectiveness of the siRNA.

[0092] In one embodiment of the present invention, the anti-tumor agent or composition can be delivered to cells, malignancies or individuals by direct transfection or transfection and expression via an expression vector. Suitable expression vectors include mammalian expression vectors and viral vectors, in which polynucleotides encoding sensitizing agents and appropriate regulatory sequences including promoters have been selected so that the sensitizing agents are expressed in cells or malignancies. Suitable promoters may be constitutive or developmentally specific promoters. Transfection delivery can be achieved by liposome transfection reagents known in the art (e.g., Xtreme transfection reagent, Roche, Alameda, CA; Lipofectamine formulations, Invitrogen, Carlsbad, CA). Cationic liposome-mediated delivery and direct delivery are highly efficient. Another possible mode of delivery is targeted delivery using antibodies to cell surface markers of target cells.

[0093] For transfection, a composition comprising one or more nucleic acid molecules (within a vector or without a vector) may comprise a delivery vehicle (including liposomes), a carrier, and a diluent, and salts thereof, for administration to a subject, and / or may be present in a pharmaceutically acceptable formulation. Delivery of siRNA molecules is also described in several U.S. patent publications, including, for example, 2006 / 0019912, 2006 / 0014289, 2005 / 0239687, 2005 / 0222064, and 2004 / 0204377, the disclosures of each of which are hereby incorporated by reference herein. Nucleic acid molecules can be administered to cells by a variety of methods known to those skilled in the art, including, but not limited to, encapsulation in liposomes, by iontophoresis, by electroporation, or by incorporation into other vehicles, including biodegradable polymers, hydrogels, cyclodextrins (see, e.g., Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074; Wang et al., International PCT Publication Nos. WO 03 / 47518 and WO 03 / 46185), poly(lactic-co-glycolic acid) (PLGA) and PLCA microspheres (see, e.g., U.S. Patent No. 6,447,796 and U.S. Patent Application Publication No. 2002 / 130430), biodegradable nanocapsules and bioadhesive microspheres, or by protein carriers (O'Hare and Normand, International PCT Publication No. WO 00 / 53722). In another embodiment, the nucleic acid molecules of the present invention can also be formulated or complexed with polyethyleneimine and its derivatives, such as polyethyleneimine-polyethylene glycol-N-acetylgalactamine (PEI-PEG-GAL) or polyethyleneimine-polyethylene glycol-tri-N-acetylgalactamine (PEI-PEG-triGAL) derivatives.

[0094] Examples of liposome transfection reagents used in the present invention include, for example: CellFectin, a 1:1.5 (M / M) liposome formulation of the cationic lipid N,NI,NII,NIII-tetramethyl-N,NI,NII,NIII-tetrapalmitoyl-spermamine and dioleoylphosphatidylethanolamine (DOPE) (GIBCOBRL); Cytofectin GSV, a 2:1 (M / M) liposome formulation of a cationic lipid and DOPE (Glen Research); DOTAP (N-[1-(2,3-dioleoyloxy)-N,N,N-trimethyl-methylammonium sulfate) (Boehringer Manheim); Lipofectamine, a 3:1 (M / M) liposome formulation of the polycationic lipid DOSPA and the neutral lipid DOPE (GIBCO BRL); and (5) siPORT (Ambion); HiPerfect (Qiagen); X-treme GENE (Roche); RNAiCarrier (Epoch Biosciences). Biolabs) and TransPass (New England Biolabs).

[0095] Many types of human solid cancers, such as breast cancer, non-small cell lung cancer (NSCLC), PDAC, sclerosing subtypes of gastric adenocarcinoma, and the "stem / serrated / stromal (SSM)" molecular subtype of colorectal cancer (CRC), are characterized by a pronounced stromal reaction called a "desmoplastic reaction" (Isella, C., Terrasi, A., Bellomo, SE, Petti, C., Galatola, G., Muratore, A., Mellano, A., Senetta, R., Cassenti, A., Sonetto, C. et al. (2015). Stromal contribution to the colorectal cancer transcriptome. Nat Genet 47, 312-319), which constitutes a major obstacle to the efficient delivery of cancer therapeutics into tumors. Recently, two nanoparticle-formulated chemotherapies, including albumin-bound paclitaxel (nab-paclitaxel) and liposome-encapsulated irinotecan, have been shown to prolong the survival of patients with advanced PDAC. Both agents significantly increased the levels of chemotherapeutic agents in treated tumors (Wang-Gillam, A., Li, CP, Bodoky, G., Dean, A., Shan, YS, Jameson, G., Macarulla, T., Lee, KH, Cunningham, D., Blanc, JF, et al. (2016). Nanoliposomal irinotecan with fluorouracil and folinic acid in metastatic pancreatic cancer after previous gemcitabine-based therapy (NAPOLI-1): a global, randomized, open-label, phase 3 trial. Lancet 387, 545-557), indicating that nanoparticle formulations are a clinically validated approach to improving therapeutic efficacy in desmoplastic cancers.In liver disease, parenteral administration of lipid nanoparticle (LNP)-formulated siRNA specific for transthyretin (Patisiran, Alnylam Pharmaceuticals, MA, USA) has been shown to reduce transthyretin production by up to 86.8% in the liver of patients with hereditary transthyretin-mediated amyloidosis and thus became the first clinically approved RNAi drug (Adams, D., Gonzalez-Duarte, A., O'Riordan, W.D., Yang, C.C., Ueda, M., Kristen, A.V., Tournev, I., Schmidt, H.H., Coelho, T., Berk, J.L., et al., (2018). Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N Engl J Med 379, 11-21). In addition, nanoparticle-delivered siRNA therapies, such as cyclodextrin polymer-based nanoparticles carrying siRNA targeting ribonucleotide reductase M2 (RRM2) and lipid nanoparticles carrying siRNA targeting VEGF-A and kinesin spindle protein (KSP), have shown promising pharmacodynamics and tolerability as well as anti-tumor efficacy in some treated patients in Phase 1 clinical trials. In addition, systemic delivery of siRNA targeting tumor driver genes such as BCR-ABL has also shown significant therapeutic efficacy in an orthotopic mouse model of hepatocellular carcinoma (HCC) (Tabernero, J., Shapiro, G.I., LoRusso, P.M., Cervantes, A., Schwartz, G.K., Weiss, G.J., Paz-Ares, L., Cho, D.C., Infante, J.R., Alsina, M., et al., (2013). First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP incancer patients with liver involvement. Cancer Discov 3, 406-417).Unlike microRNAs, siRNAs silence only one mRNA target, so their genetic and biological effects are highly specific and associated with fewer off-target effects, as exemplified by the recently approved first-of-its-kind liposomal siRNA targeting transthyretin in patients with hereditary amyloidosis (Adams, D., Gonzalez-Duarte, A., O'Riordan, WD, Yang, CC, Ueda, M., Kristen, AV, Tournev, I., Schmidt, HH, Coelho, T., Berk, JL, et al. (2018). Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. NEngl J Med 379, 11-21). In complex multigenic diseases such as human malignancies, the implementation of siRNA-based therapies requires the identification of "driver" genes that act as key regulators of disease pathology.

[0096] Therapeutic gene delivery to tumor cells or malignant tissues can be achieved by using non-viral vehicles such as lipid-based and polymeric materials. For example, a tumor-targeted immunoliposome nanocomplex called scL, in which the therapeutic molecule payload is encapsulated in a cationic liposome, whose surface is decorated with an anti-transferrin receptor (TfR) single-chain antibody fragment, is designed to target tumor cells via the TfR highly expressed on its surface. A series of studies have shown that scL nanocomplexes can specifically deliver various payloads including plasmid DNA, siRNA, and small molecules to primary and metastatic tumor cells and even cancer stem cells in vitro and in vivo. In preclinical models of various human tumors such as breast cancer, malignant glioma, head and neck cancer, and pancreatic cancer, systemic administration of p53 plasmid DNA encapsulated with scL immunoliposome nanoparticles called TfRscFv-Lip p53 or "SGT-53" has been shown to induce tumor-specific expression of exogenous p53 and thereby enhance the efficacy of chemotherapy and radiotherapy. Importantly, the clinical applicability of SGT-53 has been demonstrated in a recent Phase 1 clinical trial, which showed that the therapeutic dose tested was well tolerated by study participants. Notably, PCR analysis of tumor tissue revealed the clear presence of the exogenous p53 transgene, providing strong support for the use of scL nanoparticles as an effective systemic delivery vehicle for the efficient delivery of therapeutic genes to human tumors.

[0097] AlCana ​​Technologies (Vancouver, BC) used a rational design approach to generate a lipid nanoparticle (LNP) suitable for delivering oligonucleotides such as siRNA to liver or tumor tissue in vivo (Jayaraman, M., Ansell, SM, Mui, BL, Tam, YK, Chen, J., Du, X., Butler, D., Eltepu, L., Matsuda, S., Narayanannair, JK, et al., (2012). Maximizing the potency of siRNA lipidnanoparticles for hepatic gene silencing in vivo. Angew Chem Int Ed Engl 51, 8529-8533). The LNP formulation consists of four lipid components, including the ionizable cationic amino lipid DLin-MC3-DMA complexed with siRNA, the amphoteric phospholipid distearoyl-phosphatidylcholine (DSPC), cholesterol, and the coating lipid poly(ethylene glycol) lipid 1,2-dimyristoyl-rac-glycero-methoxy(poly(ethylene glycol)) (DMG-PEG), mixed in a molar ratio of 50:10:38.5:1.5. The particle size of DLin-MC3-DMA LNPs is in the range of 70-90 nm (Jayaraman, M., Ansell, SM, Mui, BL, Tam, YK, Chen, J., Du, X., Butler, D., Eltepu, L., Matsuda, S., Narayanannair, JK, et al., (2012). Maximizing the potency of siRNA lipidnanoparticles for hepatic gene silencing in vivo. Angew Chem Int Ed Engl 51, 8529-8533), which is associated with a prolonged circulation time and allows them to leak into tumor tissue through leaky endothelial cell fenestrations (estimated pore size of 380-780 nm), a phenomenon known as the "enhanced permeation and retention (EPR)" effect (Agarwal, R. and Roy, K. (2013). Intracellular delivery of polymeric nanocarriers: a matter of size, shape, charge, elasticity and surface composition.Ther Deliv 4,705-723).

[0098] DLin-MC3-DMA-based LNPs have been used in the development of Alnylam Pharmaceuticals' first FDA-approved siRNA drug, patisiran (Onpattro). They have also been used for systemic delivery of siRNAs targeting tumor-driving genes such as BCR-ABL, VEGF-A, and kinesin spindle protein (KSP), demonstrating significant therapeutic efficacy in a mouse model of chronic myeloid leukemia (CML) or an orthotopic murine model of hepatocellular carcinoma (HCC). Systemic delivery of siRNA using DLin-MC3-DMA-based LNP encapsulated siRNA has been shown to be safe in a phase I clinical trial and generally well tolerated, except for some infusion-related reactions and transient induction of proinflammatory cytokines (Tabernero, J., Shapiro, G.I., LoRusso, P.M., Cervantes, A., Schwartz, G.K., Weiss, G.J., Paz-Ares, L., Cho, D.C., Infante, J.R., Alsina, M., et al., (2013). First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP in cancer patients with liver involvement. Cancer Discov 3, 406-417).

[0099] Recently, a next-generation LNP-based delivery vehicle has been described that contains the highly biodegradable ionizable cationic lipid CL4H6, cholesterol, and 1,2-dimyristoyl-sn-glycerol, methoxyethylene glycol 2000 ether (PEG-DMG2000) mixed in a molar ratio of 60:40:1 (Sato, Y., Hashiba, K., Sasaki, K., Maeki, M., Tokeshi, M., and Harashima, H. (2019). Understanding structure-activity relationships of pH-sensitive cationic lipids facilitates the rational identification of promising lipid nanoparticles for delivering siRNAs in vivo. J Control Release 295, 140-152).CL4H6 was systematically derived based on the structure-activity relationship between the hydrophilic head group and hydrophobic tail of a pH-sensitive cationic lipid and exhibited higher in vivo gene silencing activity in a mouse Factor VII model than the benchmark lipid DLin-MC3-DMA (50% effective dose (ED50): 0.0025 mg / kg vs. 0.005 mg / kg) (Jayaraman, M., Ansell, SM, Mui, BL, Tam, YK, Chen, J., Du, X., Butler, D., Eltepu, L., Matsuda, S., Narayanannair, JK, et al., (2012). Maximizing the potency of siRNA lipidnanoparticles for hepatic gene silencing in vivo. Angew Chem Int Ed Engl 51, 8529-8533; Sato, Y., Hashiba, K., Sasaki, K., Maeki, M., Tokeshi, M., and Harashima, H. (2019). Understanding structure-activity relationships of pH-sensitive cationic lipids facilitates the rational identification of promising lipid nanoparticles for delivering siRNAs in vivo. J Control Release 295, 140-152). Although DLin-MC3-DMA was used in Onpattro, the first FDA-approved siRNA drug developed by Alnylam Pharmaceuticals, it can cause hepatotoxicity and significant weight loss when administered to mice at a high dose range (>3 mg / kg) (Jayaraman, M., Ansell, SM, Mui, BL, Tam, YK, Chen, J., Du, X., Butler, D., Eltepu, L., Matsuda, S., Narayanannair, JK, et al., (2012). Maximizing the potency of siRNA lipid nanoparticles for hepatic gene silencing in vivo. Angew Chem Int Ed Engl 51, 8529-8533).In contrast, CL4H6 contains a biodegradable ester bond in its hydrophobic tail, and its levels in the liver or spleen decline rapidly after 24 hours. The high biodegradability of CL4H6 substantially reduces the potential for inducing liver or tissue toxicity, especially during the repeated dosing schedules required for cancer treatment.

[0100] siRNA or oligonucleotides can be LNP-encapsulated by mixing siRNA or oligonucleotides dissolved in 10 mM citrate buffer (pH 3.0) with LNPs dissolved in ethanol using a microfluidic instrument such as the NanoAssemblr™ system (Precision Nanosystems, Vancouver, BC, Canada) at a flow rate of 0.5 ml / min and a flow rate ratio of 1:3 (lipid:siRNA=0.125 ml / min:0.375 ml / min). A syringe pump (Harvard Apparatus, MA, USA) can be used to control the flow rate. The resulting LNP / siRNA mixture solution is then dialyzed against phosphate-buffered saline using a Spectra / Por 4 dialysis membrane (Spectrum Laboratories, Rancho Dominguez, CA, USA). The LNP-encapsulated siRNA solution is then concentrated by ultrafiltration using an Amicon Ultra-15 device (MWCO 50 kDa, Merck Millipore, Burlington, MA, USA). The size (number-weighted mean diameter) and zeta potential of LNPs were measured using a Zetasizer Nano ZSZEN3600 instrument (Malvern Instruments, Worcestershire, UK). The encapsulation efficiency and total concentration of siRNA were measured using Quanti-iT™ RiboGreen RNA Reagent and Kit (Invitrogen, Waltham, MA, USA).

[0101] Tumor targeting of lipid-based nanoparticles can also be achieved by using the CXCR-4 antagonist AMD-3100 as a targeting moiety. CXCR-4 is upregulated after treatment of hepatocellular carcinoma (HCC) with the targeted agent sorafenib, and thus AMD-modified nanoparticles can efficiently deliver VEGF siRNA to HCC, synergizing with sorafenib to induce anti-angiogenic effects and inhibit tumor growth and metastasis (Liu, JY, Chiang, T., Liu, CH, Chern, GG, Lin Ts, T., Gao, DY, and Chen, Y. (2015). Delivery of siRNA Using CXCR4-targeted Nanoparticles Modulates Tumor Microenvironment and Achieves a Potent Antitumor Response in Liver Cancer. Mol Ther 23, 1772-1782). Interestingly, even without a specific tumor-targeting moiety, amphoteric liposomes or neutral lipid emulsions such as MaxSuppressor™ (BIOO Scientific, TX, USA) or SMARTICLES (Marina Biotech, WA, USA) have been found to be able to effectively deliver RNAi agents to tumors. Most lipid-based delivery systems contain cationic lipids and have many disadvantages that can be attributed to charge. In contrast, these neutral or amphoteric liposomes are neutral or anionic at neutral and higher pH, and cationic at low pH. In biological fluids with a pH of 7-7.5, nanoparticles exhibit a slightly anionic character that prevents unwanted interactions with the negative charge of cell membranes in the endothelium and other tissues. For the same reason, the toxicity of these liposomes may be lower than those containing cationic lipids. Since the pH in tumor areas is often lower, these particles may become cationic in these areas and adhere to tumor cells.SMARTICLES formulations have been used to deliver tumor suppressive miRNAs, such as miR-34a and let-7, to tumors in animal models of HCC, prostate cancer, and lung cancer, resulting in significant tumor regression and prolonged survival (Cortez, MA, Valdecanas, D., Niknam, S., Peltier, HJ, Diao, L., Giri, U., Komaki, R., Calin, GA, Gomez, DR, Chang, JY, et al. (2015). In Vivo Delivery of miR-34a Sensitizes Lung Tumors to Radiation Through RAD51 Regulation. Mol Ther Nucleic Acids 4, e270).

[0102] Alternatively, using combinatorial chemistry, a low-molecular-weight polyamine and lipid compound, termed 7C1, was identified to deliver siRNA to the lung endothelium without significantly transfecting immune cells or hepatocytes. In a KrasG12Dp53flox / flox transgenic lung adenocarcinoma model, treatment of tumor-bearing mice with a microRNA34 mimetic and siRNA targeting the oncogene Kras using 7C1 nanoparticles reduced K-Ras gene expression and MAPK signaling, inhibited tumor growth, and synergized with chemotherapy to prolong survival.

[0103] The present invention also relates to a pharmaceutical composition comprising an antitumor agent as defined herein, optionally in combination with a pharmaceutical carrier, diluent and / or adjuvant. Any suitable pharmaceutically acceptable diluent, adjuvant, carrier or excipient can be used in the composition of the present invention (see, for example, Remington: The Science and Practice of Pharmacy, Alfonso R. Gennaro (ed.) Mack Publishing Company, April 1997). Preferred pharmaceutical forms will be combined with sterile saline, dextrose solution or buffer solution or other pharmaceutically acceptable sterile fluids. Alternatively, solid carriers such as microcarrier beads can be used. Such compositions include an effective amount of the antitumor agent sufficient to provide the desired therapeutic or preventive effect, and a pharmaceutically acceptable carrier or excipient. "Effective amount" includes a therapeutically effective amount or a preventive effective amount.

[0104] For gene therapy vectors, the dose to be administered may depend largely on the condition and size of the individual being treated, as well as the therapeutic formulation, treatment frequency, and route of administration. The regimen for ongoing therapy, including dosage, formulation, and frequency, may be guided by initial response and clinical judgment. Parenteral routes of injection into blood vessels or interstitial spaces may be preferred, but other parenteral routes, such as inhalation of aerosol formulations, may be required in specific administrations. In some approaches, a formulation comprising a gene and a gene delivery system in an aqueous carrier is injected into the tissue in an appropriate amount. Sequence Listing SEQ ID NO: 1 sets forth the nucleotide sequence of human ASPM transcript transcript variant 1 (NCBI Reference Sequence: NM_018136.4). TTATGATGAACGCTGGAAGGAAAAGCAGGAACAGGGCTTCACTTGGTGGTTAAA CCTCCGTTGTGATCC AAAATCTACAGTTATCCTACAAGC SEQ ID NO: 2 sets forth the amino acid sequence of human ASPM gene isoform 1 (NCBI Reference Sequence: NP_060606.3). SEQ ID NO: 3 sets forth the nucleotide sequence of the mRNA encoded by exon 18 of the human ASPM gene, which corresponds to nucleotides 4323 to 9077 of ASPM transcript variant 1 (NCBI Reference Sequence: NM_018136.4). SEQ ID NO: 4 sets forth the nucleotide sequence of the sense strand of ASPM-v1 targeting siASPM-v1.4822, which corresponds to nucleotides 4822 to 4840 of ASPM transcript variant 1. GCGCACCAACUAUUUGCAG SEQ ID NO:5 sets forth the nucleotide sequence of the antisense strand of ASPM-v1 targeting siASPM-v1.4822, which is complementary to the sense strand shown in SEQ ID NO:4. CUGCAAAUAGUUGGUGCGC SEQ ID NO: 6 sets forth the nucleotide sequence of the sense strand of ASPM-v1 targeting siASPM-v1.7636, which corresponds to nucleotide 7636 to nucleotide 7654 of ASPM transcript variant 1. CAGAAGACUGAUGGUAAAG SEQ ID NO:7 sets forth the nucleotide sequence of the antisense strand of ASPM-v1 targeting siASPM-v1.7636, which is complementary to the sense strand shown in SEQ ID NO:6. CUUUACCAUCAGUCUUCUG SEQ ID NO: 8 sets forth the nucleotide sequence of the sense strand of ASPM-v1 targeting siASPM-v1.4360, which corresponds to nucleotides 4360 to 4378 of ASPM transcript variant 1. CCUGCAAUCUAGGAUAAGA SEQ ID NO:9 sets forth the nucleotide sequence of the antisense strand of ASPM-v1 targeting siASPM-v1.4360, which is complementary to the sense strand shown in SEQ ID NO:8. GGACGUUAGAUCCUAUUCU Examples

[0105] Unless otherwise specified, the following examples are given for illustrative purposes only and are not intended to be limiting. Those skilled in the art will appreciate that the techniques disclosed in the following examples represent techniques discovered by the inventor to function well in the practice of the invention and, thus, can be considered to constitute preferred modes for its practice. Those skilled in the art will appreciate that many changes can be made to the specific embodiments disclosed and still obtain the same or similar results without departing from the spirit and scope of the invention.

[0106] Example 1 ASPM is identified as the highest ranked Wnt-related gene associated with cancer metastasis

[0107] We focused on a list of 327 Wnt-related genes based on Gene Ontology terms. When sorted in descending order of their prognostic significance (Cox regression P value), the gene whose transcript levels were most strongly associated with shorter recurrence-free survival (i.e., the highest probability of recurrence and / or metastasis) was ASPM (P < 0.0001; Figure 1A Consistently, we found that ASPM expression was negatively correlated with distant metastasis-free survival in a large metastatic cohort analysis (total n=2422; P<0.0001; Figure 1B ).

[0108] The aforementioned clinical correlation analysis raises the possibility that ASPM may play a functional role in breast cancer invasiveness and metastasis. Indeed, small hairpin RNA (shRNA)-mediated knockdown of ASPM expression in MDA-MB-436 and HCC-1954 breast cancer cells completely abolished their ability to invade through reconstituted basement membranes (Figure 2). To verify the functional importance of ASPM expression in vivo, human breast cancer MDA-MB-436 and MDA-MB-231 cells and pancreatic cancer AsPC-1 cells were lentivirally transduced with a GFP and firefly luciferase (FF-Luc) fusion vector (UBC-EGFP-T2A-Luc; System Biosciences), and GFP-positive cells were enriched by FACS. MDA-MB-436-FF-Luc or MDA-MB-231-FF-Luc cells (106 cells) infected with a control or ASPM-specific shRNA (control attenuated or ASPM attenuated) were injected into immunodeficient NOD / SCID mice via the tail vein using a 27-gauge needle. According to the manufacturer's recommendations (IVIS Imaging System, Caliper Life Sciences), lung metastases were observed weekly by bioluminescence imaging (BLI) starting 3 weeks after cell inoculation. As shown in Figure 3, control attenuated breast cancer cells resulted in the development of metastatic lung tumors within 3 or 8 weeks after cell injection. In contrast, attenuating ASPM expression almost completely eliminated remote metastasis. We further validated the results in a pancreatic cancer remote metastasis model. Briefly, AsPC-1-FF-Luc cells were injected into the spleen medulla of NOD / SCID mice over 1 minute, followed by splenectomy and splenic vein ligation. The appearance of liver and / or metastatic peritoneal tumors was monitored by BLI. Consistent with the aforementioned results in breast cancer, control attenuated the rapid dissemination of pancreatic cancer AsPC-1 cells to the liver and peritoneum 3 weeks after cell inoculation, while attenuation of ASPM expression substantially abolished the pro-metastatic ability of cancer cells.

[0109] Consistent with the prevailing theory that metastatic colonization is seeded by rare tumor cells with unique properties (Lawson, DA, Bhakta, NR, Kessenbrock, K., Prummel, KD, Yu, Y., Takai, K., Zhou, A., Eyob, H., Balakrishnan, S., Wang, CY et al. (2015). Single-cell analysis reveals a stem-cell program in human metastatic breast cancer cells. Nature 526, 131-135), we sought to confirm this finding by establishing a breast cancer patient-derived xenograft (PDX) model and analyzing ASPM expression in micrometastatic lesions. Briefly, PDX breast tumors derived from two human TNBC tumors were implanted with NOD / Shi-scid / IL2Rγ null Tumor growth kinetics were monitored weekly by measuring the diameter of tumors in the mammary fat pad of NOG mice (BR1282 and BR1474, CrownBio). 3 When the tumor was collected from the tumor-bearing mice, the appearance of lung micrometastasis was confirmed by parallel experiments. The resected tissue was then digested and the cells were labeled with APC-anti-CD298 (Lawson et al., 2015) (BioLegend 341706), a specific surface marker for human breast cancer cells, and then fixed to perform subsequent labeling with PE-anti-ASPM (Santa Cruz, sc-48883) and analyzed by fluorescence activated cell sorting (FACS). In fact, compared with the cancer cells in the parental tumor, the cancer cells isolated from the lung micrometastasis microenvironment of mice carrying PDX expressed high levels of ASPM (Fig. 4). In short, these in vitro and in vivo research results all support ASPM as an important and indispensable factor for cancer aggressiveness and metastasis.

[0110] Example 2: Specific upregulation of ASPM protein isoform 1 in malignant tumors

[0111] Several splice variants of the ASPM transcript exist in normal and malignant human tissues, encoding protein isoforms consisting of 3477 amino acid residues (isoform 1; ASPM-i1), 1892 amino acid residues (isoform 2; ASPM-i2), 1389 amino acid residues (isoform 2I), and 1062 amino acid residues (isoform 1V), respectively (Kouprina, N., Pavlicek, A., Collins, NK, Nakano, M., Noskov, VN, Ohzeki, J., Mochida, GH, Risinger, JI, Goldsmith, P., Gunsior, M., et al., (2005). The microcephaly ASPM gene is expressed in proliferating tissues and encodes for a mitotic spindle protein. Hum Mol Genet 14, 2155-2165). Importantly, the three shorter ASPM isoforms (isoforms 2-4) lack several functional domains of the full-length isoform 1 protein, such as the IQ (isoleucine and glutamine) motif and the calmodulin homology (CH) domain, raising the possibility that these ASPM isoforms may play different roles in normal and malignant cells. Notably, transcript variant 1 (ASPM-v1; NCBI RefSeq: NM_018136.4), encoding the full-length ASPM protein (ASPM isoform 1 or ASPM-i1; NCBI RefSeq: NP_060606.3), and variant 2 (NCBI RefSeq: NM_001206846), encoding a truncated protein lacking the 67 IQ domain carried by exon 18 (ASPM-i1; NCBI RefSeq: NP_001193775.1), are the two major transcripts detected in pancreatic cancer cells (Hsu et al., 2019a).In several types of cancer, ASPM enhances canonical Wnt signaling by positively regulating key upstream Wnt mediators, including Dishevelled (DVL) protein and β-catenin (Wang, WY, Hsu, CC, Wang, TY, Li, CR, Hou, YC, Chu, JM, Lee, CT, Liu, MS, Su, JJ, Jian, KY, et al. (2013). A gene expression signature of epithelial tubulogenesis and a role for ASPM in pancreatic tumor progression. Gastroenterology 145, 1110-1120). Interestingly, in pancreatic cancer, rabbit polyclonal antibodies raised against peptide epitopes within a fragment encoded by exon 18 of the human ASPM gene (unique to ASPM-v1 and ASPM-i1) demonstrated that only ASPM-i1 associates with DVL2 and regulates its protein stability in cancer cells. In contrast, the protein isoform 2 of ASPM interacts with cyclin E and thereby regulates the cell cycle progression of cancer cells. Therefore, ASPM-i1, but not ASPM-i2, contributes to Wnt activity and tumorigenicity in cancer cells such as pancreatic cancer (Hsu, CC, Liao, WY, Chan, TS, Chen, WY, Lee, CT, Shan, YS, Huang, PJ, Hou, YC, Li, CR, and Tsai, KK (2019a). The differential distributions of ASPM isoforms and their roles in Wnt signaling, cell cycle progression, and pancreatic cancer prognosis. J Pathol 249, 498-508). These results suggest that different ASPM isoforms have different functions and pathogenic effects in cancer cells.

[0112] Previously, ASPM-i1 has been shown to be specifically expressed in the cytoplasm of pancreatic cancer cells, while ASPM-i2 is primarily expressed in the nucleus (Hsu et al., 2019a). Importantly, immunohistochemical (IHC) analysis of tissue microarrays (TMAs) of human pancreatic or gastric cancer tissues demonstrated that ASPM-i1 is upregulated in tumor cells, whereas positive staining is rare in normal pancreatic duct epithelial cells (data not shown). To extend these observations to non-gastrointestinal (GI) tract malignancies, TMA analysis was performed on human breast cancer tissue and matched adjacent normal tissue (BR084b, USBiomax, Inc., Rockville, MD, USA). Tissue sections were deparaffinized, hydrated, and immersed in citrate buffer, pH 6.0, for epitope retrieval in a microwave. Endogenous peroxidase activity was quenched with 3% catalase for 15 minutes, and slides were then incubated with 10% normal horse serum to block nonspecific immunoreactivity. We prepared rabbit polyclonal antibodies (1:1600) against ASPM-i1 or ASPM-i2 specific immunogens. Staining intensity was quantified at the single-cell level, with at least 300 tumor cells counted per tumor (3 tissue sections per tumor; at least 100 tumor cells counted per section).

[0113] like Figure 6A As shown, a small portion (about 9.3%) of epithelial cells in normal human breast tissue showed weak (1+) ASPM-i1 staining intensity in the cytoplasm, while ASPM-i2 was expressed (≥1+) in the cytoplasm (10.5%) or nucleus (9.3%) of a small portion of breast epithelial cells. Consistent with the aforementioned findings in pancreatic cancer, the expression of ASPM-i1 was significantly upregulated in the cytoplasm of malignant cells in breast cancer tissue. In contrast, the expression of ASPM-i2 was mainly retained in the nucleus of breast cancer cells. Specifically, in the same tumor, an average of approximately 21.1% of tumor cells showed weak (1+) staining of ASPM-i1, approximately 5.0% of tumor cells showed moderate (2+) staining and approximately 2.2% of tumor cells showed strong (3+) staining. In contrast, an average of 9.4%, 0.3% and 0.3% of tumor cells showed weak, moderate and strong staining of ASPM-i2 in the cytoplasm, respectively ( Figure 6B To further examine the expression pattern of ASPM-i1 in breast cancer, we repeated IHC staining in whole tumor tissue sections from three breast cancer patients. Interestingly and importantly, we noticed significant regional heterogeneity in the expression of ASPM-i1 in breast cancer tissues, with higher expression at the cancer invasion front than in other areas ( Figure 6C and Figure 6D This observation raises the possibility that ASPM-i1 may be associated with breast cancer invasiveness and / or metastasis.

[0114] Having demonstrated heterogeneity in the expression of ASPM isoforms, we next sought to determine whether the expression pattern of ASPM, particularly the specific upregulation of ASPM-i1 in the cytoplasm of cancer cells, could be generalized to other types of human cancer. Previously, ASPM transcript levels have been shown to be elevated in 66% of human HCC tissues and correlated with shorter 5-year survival and early tumor recurrence in HCC patients (Lin, SY, Pan, HW, Liu, SH, Jeng, YM, Hu, FC, Peng, SY, Lai, PL, and Hsu, HC (2008). ASPM is a novel marker for vascular invasion, early recurrence, and poor prognosis of hepatocellular carcinoma. Clin Cancer Res 14, 4814-4820). To investigate the expression pattern of ASPM-i1 in normal and malignant human liver tissues at the protein level, we performed IHC staining of ASPM-i1 on two tissue microarrays (LVN241a and LV805b, US Biomax, Inc., Rockville, MD, USA) consisting of 24 normal liver tissues, 10 hepatitis liver tissues, 50 cirrhosis liver tissues, and 111 HCC tissues. Similar to its expression pattern in breast cancer tissues, ASPM-i1 was primarily expressed in the cytoplasm of normal hepatocytes (≥1+) in a portion (average 28.3%) of normal liver tissues ( Figure 6E ), and the percentage of epithelial cells with weak (1+) ASPM-i1 staining was significantly increased in hepatitis, cirrhosis, and HCC tissues. Importantly, a large number of epithelial cells in HCC tissues expressed moderate (2+; average 24.3%) or strong (3+; average 3.43%) ASPM-i1 staining intensity. In contrast, in normal liver, hepatitis, and cirrhosis liver tissues, ASPM-i1 expression in the nucleus was negligible. In HCC tissues, only a small number of tumor cells expressed weak (1+; average 13.5%) or moderate (2+; average 4.7%) ASPM-i1 staining in their nuclei.

[0115] In contrast to the staining pattern of ASPM-i1 in liver tissue, the majority of hepatocytes in normal liver expressed ASPM-i2 (≥1+) in the cytoplasm (76.0%), and a significant portion of hepatocytes also expressed ASPM-i2 in the nucleus (44.1%) ( Figure 6EInterestingly, ASPM-i2 expression was moderately upregulated in HCC tissues, with approximately two-thirds of tumor cells showing moderate to strong (≥2+) ASPM-i2 staining intensity in the cytoplasm (64.0%) or nucleus (67.5%). Figure 6F ).

[0116] Overall, the very low expression frequency of ASPM-i1 in normal epithelial tissues, together with its specific upregulation in cancer cells, supports its use as a cancer cell-specific target with a favorable safety profile in cancer therapy.

[0117] Example 3: ASPM isoform 1 (ASPM-i1) specifically promotes the assembly of the PAR planar cell polarity complex and invadopodia formation in invasive cancer cells

[0118] Our previous findings of the crucial role of ASPM in cancer cell invasion and metastasis, as well as the specific role of ASPM-i1 in Wnt activity and tumorigenesis, prompted us to gain a deeper mechanistic understanding of how it regulates Wnt-dependent invasiveness in cancer cells. To this end, we isolated invasive breast cancer MDA-MB-436 cells using a modified Boyden chamber invasion assay (Transwell inserts; BD Biosciences). Transwell inserts were coated with a thin layer of growth factor-reduced reconstituted basement membrane (rBM; BD Biosciences), and cells were allowed to invade across the rBM for 12 hours. Cells that invaded through the insert and those that remained on the membrane were collected separately. We then used high-throughput MicroWestern array analysis to screen a list of 107 annotated human Wnt proteins (http: / / web.stanford.edu / group / nusselab / cgi-bin / wnt / ) (Ciaccio, MF, Wagner, JP, Chuu, CP, Lauffenburger, DA, and Jones, RB (2010). Systems analysis of EGF receptor signaling dynamics with microwestern arrays. Nat Methods 7, 148-155) for interaction with ASPM-i1 in invasive breast cancer. Several members of the PAR planar cell polarity (PCP) protein complex, including Par-6 family cell polarity regulator alpha (PAR6α), PAR6β, dishevelled protein 2 (DVL2), CDC42, and SMURF1, strongly interact with ASPM-i1 ( Figure 7 ).

[0119] Since non-canonical Wnt-PCP signaling translates tissue patterning information to individual cells, where it controls the morphogenetic and invasive behaviors of cells by regulating cell polarity and invadopodia (Luga, V., Zhang, L., Viloria-Petit, AM, Ogunjimi, AA, Inanlou, MR, Chiu, E., Buchanan, M., Hosein, AN, Basik, M., and Wrana, JL (2012). Exosomes mediate stromal mobilization of autocrine Wnt-PCP signaling in breast cancer cell migration. Cell 151, 1542-1556), we considered the possibility that ASPM-i1 could coordinate PAR-PCP proteins to regulate invadopodia dynamics and, therefore, cancer cell invasiveness. Therefore, we induced the formation of invadopodia in breast cancer MDA-MB-436 cells by plating them on gelatin matrix (Sigma-Aldrich) as previously described (Eckert, MA, Lwin, TM, Chang, AT, Kim, J., Danis, E., Ohno-Machado, L., and Yang, J. (2011). Twist1-induced invadopodia formation promotes tumor metastasis. Cancer Cell 19, 372-386). Cells were plated on gelatin for 3 hours or longer and then immunostained with anti-cortical actin and Alexa Fluor 647 muscarinic acid (F-actin staining), and the staining pattern was evaluated using confocal imaging analysis. Cortical actin protruding downward from the cells + F-actin+ structures are considered as invadopodia. Figure 8AAs shown, confocal imaging analysis revealed that ASPM-i1 colocalizes with DVL2, PAR6β, CDC42, and cortical actin in invadopodia of invasive cancer cells. To confirm that ASPM-i1 interacts with PAR / PCP proteins, specifically in invadopodia, we isolated invadopodia proteins from cells plated on a gelatin matrix for 3 hours to induce invadopodia formation. The cell bodies were excised from the dish surface, leaving the invadopodia embedded in the gelatin. The invadopodia proteins and the cell body protein fraction were then solubilized in IP buffer. For co-IP, cells were lysed with native lysis buffer (1 mM PMSF, 1 mM Na3VO4, 1 μg / ml pepstatin, 20 mM Na3VO4, phosphatase inhibitor cocktail, 0.5% NP-40, and 10% glycerol in PBS) and lysate (1 mg) was clarified by incubation with a 50% protein A-agarose bead slurry. 1 mL of the clarified lysate was then incubated with antibody-bound 50% protein A-agarose beads and 10 μL of 10% BSA overnight at 4°C. The beads were washed three times with wash buffer (0.5% NP-40, 0.1% Triton X-100, 1 mM PMSF, and 1 mM Na3VO4 in PBS). Proteins were visualized after SDS / PAGE and immunoblotting with the indicated antibodies. Immunoblotting analysis of invadopodia proteins fractionated from invasive breast cancer MDA-MB-436 cells demonstrated that ASPM interacted with DVL2, PAR6β, CDC42, and N-WASP in invadopodia, but not with other DVL isoforms or SMURF1 ( Figure 8B ).

[0120] Having demonstrated that ASPM-i1 specifically interacts with the PAR / PCP complex and is assembled in invadopodia of cancer cells, we next sought to gain a deeper functional understanding of its role in invadopodia biogenesis and cancer invasiveness. To this end, we used BLOCK-iT TMRNAi Designer (Invitrogen) synthesized four in silico-predicted ASPM-v1 (SEQ ID NO: 3)-specific small hairpin RNA (shRNA) oligonucleotides to stably attenuate the expression of ASPM transcript variant 1 (ASPM-v1). These oligonucleotides contained a 21-nucleotide target sequence separated by a 9-bp loop region within the mRNA region encoded by exon 18 (ASPM.e18) of the ASPM gene. Lentiviral vectors expressing each of these ASPM-v1-targeting siRNAs were constructed by ligating shRNA sequences containing sense and antisense strands separated by a 9-bp loop region for targeted cloning into pGLV2-U6-Puro. Each lentiviral vector was used to infect MDA-MB-436 cells and tested for its efficacy in downregulating ASPM-i1 transcript and protein abundance. A non-targeting siRNA (NT siRNA; SHC002V; Sigma-Aldrich) was used as a control in subsequent experiments.

[0121] like Figure 9A As shown, infection of breast cancer MDA-MB-436 cells with two ASPM.e18-specific shRNAs (including ASPM.e18 shRNA#1 and ASPM.e18 shRNA#4) significantly downregulated the protein abundance level of ASPM-i1 without affecting the protein abundance level of ASPM isoform 2. Importantly, specific attenuation of ASPM-v1 expression using ASPM.e18.#4 shRNA significantly reduced the recruitment of PAR-PCP proteins (including DVL2, PAR6β, and CDC42) and membrane-type matrix metalloproteinases (MT1-MMP; representing functional proteins on invadopodia) to invadopodia ( Figure 9B ), confirming the functional role of ASPM-i1 in the assembly of the invadopodia-specific PAR6-PCP complex. Complementing these molecular analyses, attenuation of ASPM-i1 significantly abolished the formation of cortical actin + F-actin + invadopodia in cancer cells and thereby inhibited their invasive ability ( Figure 9C These data collectively suggest that ASPM-i1 regulates invadopodia biogenesis and cancer invasiveness by promoting the assembly of a novel DVL2 / PAR6β / CDC42 / N-WASP protein complex in invadopodia.

[0122] Example 4: ASPM-i1 regulates multiple developmental and stemness-related pathways in cancer cells

[0123] ASPM has been identified as a key regulator of the Wnt signaling pathway. It was found that in pancreatic cancer cells and prostate cancer cells, ASPM expression is essential for the cell's response to typical Wnt ligands (such as Wnt-3a). Mechanistic studies have shown that ASPM interacts with upstream activators of β-catenin, including disheveled protein 2 (DVL2) or DVL3, axin and protease-activated receptor 1 (PAR1), and inhibits the proteasome-dependent degradation of DVL protein, thereby increasing the protein abundance level of β-catenin and enhancing the typical Wnt signaling that is important for its carcinogenicity. Consistently, although weakening ASPM expression leads to a sharp decrease in Wnt reporter activity in cancer cells, increasing DVL expression in these cells can restore their Wnt activity and stemness, indicating that DVL can functionally rescue ASPM defects and act as a key regulator of Wnt signaling-related cancer stemness.

[0124] The important role of ASPM in neuronal development and its specific expression in normal or malignant stem cells, as well as its pleiotropic roles in mitotic regulation, cell cycle and developmental pathways, raise the interesting possibility of its potential role in other developmental signaling pathways. To this end, we used a commercial reporter array (Cignal Finder Stem Cell & Differentiation 10-Pathway Reporter Array; Qiagen, Germany) to measure the activity of a set of hallmark developmental and stemness-related pathways. Briefly, ASPM.e18.#4 was used to attenuate the expression of ASPM-v1 in highly transfectable human embryonic kidney 293T cells (HEK293T) using lentiviral-mediated shRNA. Cells were transfected with reporter constructs in-well using Lipofectmine LTX reagent (ThermoFisher Scientific, Waltham, MA, USA) and then detected by using a dual-luciferase assay system (Promega, Madison, WI, USA). The activities of firefly and Renilla luciferase were measured using a luminometer (Molecualer Device, Waltham, MA USA). The results were expressed as the ratio of firefly luciferase (Fluc) activity to Renilla luciferase (Rluc) activity.

[0125] like Figure 10As shown, we demonstrated that in HEK293T cells with knockdown of ASPM-v1 expression, Wnt signaling pathway activity was significantly reduced. Notably and importantly, the data showed that knockdown of ASPM-v1 expression also significantly reduced the activity of Notch and Hedgehog (Hh) signaling pathways, as well as the stemness-related transcription factors OCT4 and KLF4. Together, these data demonstrate that ASPM-v1 not only regulates Wnt signaling but also other developmental and / or stemness-related pathways in cancer cells, highlighting its critical role in cancer stemness and progression.

[0126] Example 5 Computer simulation and experimental screening of ASPM-v1 targeting siRNA

[0127] To exploit ASPM-i1 as a therapeutic target to treat cancer growth and aggressiveness through invadopodia formation, we sought to develop siRNA therapeutics to specifically inhibit ASPM-i1 expression in cancer cells. To facilitate preclinical efficacy testing and primate toxicity studies of siRNA therapeutics targeting ASPM transcript variant 1 (ASPM-v1; NCBI RefSeq: NM_018136.4; encoding ASPM-i1), we searched for siRNA sequences targeting both human ASPM-v1 and the mRNA region encoded by exon 18 of the ASPM gene in cynomolgus macaques (Macaca fascicularis) (ASPM-v1.e18, unique to ASPM-v1). We aimed to design siRNAs targeting different regions of ASPM-v1 exon 18 mRNA. We divided human ASPM-v1 exon 18 into four evenly spaced segments of similar length and aligned them with the corresponding regions in the cynomolgus macaque gene using NCBI BLAST searches. Each of these segments was found to have a high degree of identity (96%-98%) between human and primate sequences (Table 1). Table 1. Four highly homologous mRNA regions encoded by exon 18 of the human and cynomolgus macaque ASPM genes

[0128] We then searched for various consensus subsegments within each of the four ASPM-v1.e18 segments (data not shown) and designed siRNAs for each of these subsegments based on the siRNA selection server of the Whitehead Institute for Biomedical Research (http: / / sirna.wi.mit.edu / home.php). We selected candidate siRNAs using the following three selection criteria: (1) GC content of 40-60%, (2) a negative difference (ΔΔG) in binding energy between the 5' sense and 5' antisense strands, and (3) an off-target score greater than 10. The off-target score of the siRNA was determined by performing a homology search of the siRNA against human mRNA sequences using NCBI BLAST, followed by extracting the number of mismatches in the non-seed region, seed region, and cleavage site region on the siRNA for calculation of the score, as previously described (U.S. Patent 8,809,292 B2), and (4) lacking known immunostimulatory motifs, including (5' to 3') "GUCCUUCAA" and "UGUGU" (Fedorov et al., 2006; Judge et al., 2005). Using these criteria, we identified 42 candidate siRNAs that met these selection criteria (step 1). To verify the gene silencing attenuation efficacy of ASPM-v1-targeting siRNA (siASPM-v1), we synthesized double-stranded siRNAs corresponding to the selected sequences (Dharmacon) and transfected each of them into highly transducible human embryonic kidney HEK293T cells using Lipofectamine LTX reagent (ThermoFisher Scientific). An siRNA (siASPM-v1.8602; 5'-GAGCUGCUAUCACUUUACAGC-3'), previously validated for its ability to attenuate ASPM-v1 expression, was also synthesized and included as a positive control (Hsu et al., 2019b). A non-target control siRNA (5'-UGGUUUACAUGUCGACUAAUU-3'; Dharmacon) was synthesized and included as a negative control. ASPM-v1 transcript levels were measured by quantitative real-time PCR (qRT-PCR) using the LightCycler FastStart DNA MASTERPLUS SYBR Green I Kit and the LightCycler System (Roche Diagnostics GmbH, Mannheim, Germany).Oligonucleotide primers were designed using Primer Bank (http: / / pga.mgh.harvard.edu / primerbank / index.html). All transduction experiments were performed in triplicate for statistical analysis. We ranked 42 candidate siRNAs based on their gene silencing effects on ASPM-v1 transcript levels. Notably, not all of these in silico-designed siASPM-v1s effectively attenuated ASPM-v1 expression; three of them did not affect ASPM-v1 transcript levels after transduction into HEK293 cells. Using a Student's t-test, we identified a list of 30 siRNAs from these 42 candidate siRNAs that significantly (P value less than 0.05) reduced ASPM-v1 expression when transduced into HEK293K cells.

[0129] To validate the attenuation effects of the siRNAs designed above, we synthesized double-stranded siRNAs corresponding to the selected sequences (Dharmacon) and transfected each into highly transducible human embryonic kidney HEK293T cells using Lipofectamine LTX reagent (ThermoFisher Scientific). We also synthesized an siRNA (siASPM-v1.8602; 5'-GAGCUGCUAUCACUUUACAGC-3'), which has previously been validated for its gene silencing effect on ASPM-v1 expression, and included it as a positive control (Hsu, CC, Liao, WY, Chan, TS, Chen, WY, Lee, CT, Shan, YS, Huang, PJ, Hou, YC, Li, CR, and Tsai, KK (2019b). The differential distributions of ASPM isoforms and their roles in Wnt signaling, cell cycle progression, and pancreatic cancer prognosis. J Pathol). A non-target control siRNA (NT siRNA; 5'-UGGUUUACAUGUCGACUAAUU-3'; Dharmacon) was synthesized and included as a negative control. We measured ASPM-v1 transcript levels using quantitative real-time PCR (qRT-PCR) using the LightCycler FastStart DNA MASTERPLUS SYBR Green I Kit and the LightCycler System (Roche Diagnostics GmbH, Mannheim, Germany). Oligonucleotide primers were designed using Primer Bank (http: / / pga.mgh.harvard.edu / primerbank / index.html). We then ranked the 45 candidate siRNAs based on their effect on attenuating ASPM-v1 transcript levels and selected the two highest-ranked siRNA sequences from each of the four human-monkey homologous fragments shown in Table 1 (Step 2). To further select the top-ranked siRNAs, we transduced breast cancer MDA-MB-436 cells with the eight siRNAs selected from step 2 and ranked them according to their respective attenuation effects (step 3). We then selected the three top-ranked siRNA sequences for subsequent analysis, including siASPM-v1.F2#1, siASPM-v1.F3#1, and siASPM-v1.F4#1 (step 4).

[0130] To compare the efficacy of each of the three selected siRNAs or their combinations in attenuating ASPM-v1 expression, we transduced MDA-MB-436 cells with each of the three siRNAs or their different combinations and analyzed their attenuation effects using qRT-PCR. Interestingly, we found that a 1:1 mixture of two siRNAs (including siASPM-v1.F3#1 and siASPM-v1.F4#1) and a single siRNA siASPM-v1.F2#1 achieved the best gene silencing effect on ASPM-v1 in different combinations ( Figure 11 It is noteworthy and important that a 1:1 mixture of siASPM-v1.F3#1 and siASPM-v1.F4#1 was chosen for subsequent development rather than a single siASPM-v1.F2#1 for the following reasons: (1) the target mRNA sequences of siASPM-v1.F3#1 and siASPM-v1.F4#1 are located in different fragments on exon 18 of the ASPM gene (i.e., fragments 3 and 4, respectively), and thus simultaneous targeting using a mixture of siRNAs can avoid potential changes in chromatin configuration that can reduce efficacy, and (2) the siRNA mixture consists of half the amount of each siRNA as a single siRNA, which can theoretically mitigate potential toxicities such as off-target silencing and immune stimulation.

[0131] Example 6 Biological effects of lipid nanoparticle-formulated ASPM-v1-targeted siRNA on cancer cells in vitro

[0132] Many types of human solid cancers, such as breast cancer, non-small cell lung cancer, pancreatic ductal adenocarcinoma (PDAC), sclerosing subtypes of gastric adenocarcinoma, and the "stem / serrated / stromal" molecular subtype of colorectal cancer, are characterized by a pronounced stromal response known as the "desmoplastic response," which poses a major obstacle to the efficient delivery of cancer therapeutics into tumors. Recently, two nanoparticle-formulated chemotherapies, including nab-paclitaxel and liposome-encapsulated irinotecan, have been shown to prolong survival in patients with advanced PDAC. Both agents significantly increased the amount of chemotherapeutic agents in treated tumors, demonstrating that nanoparticle formulations represent a clinically validated approach to improving the efficacy of treatments for desmoplastic cancers. In liver disease, parenteral administration of liposome-encapsulated siRNA specific for transthyretin (Patisiran, Alnylam) has been shown to reduce transthyretin production by up to 86.8% in the liver of patients with hereditary transthyretin-mediated amyloidosis and thus became the first clinically approved RNAi drug (Adams, D., Gonzalez-Duarte, A., O'Riordan, W.D., Yang, C.C., Ueda, M., Kristen, A.V., Tournev, I., Schmidt, H.H., Coelho, T., Berk, J.L., et al., (2018). Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N Engl J Med 379, 11-21). In addition, nanoparticle-delivered siRNA therapies, such as cyclodextrin polymer-based nanoparticles carrying siRNA targeting ribonucleotide reductase M2 (RRM2) and lipid nanoparticles carrying siRNA targeting VEGF-A and kinesin spindle protein (KSP), have shown promising pharmacodynamics and tolerability, as well as anti-tumor efficacy in some treated patients in Phase 1 clinical trials (Davis, M.E., Zuckerman, J.E., Choi, C.H., Seligson, D., Tolcher, A., Alabi, C.A., Yen, Y., Heidel, J.D., and Ribas, A. (2010). Evidence of RNAi in humans from systemically administered siRNA via targeted nanoparticles. Nature 464, 1067-1070).Recently, intravenous injection of liposomal nanoparticle (LNP)-encapsulated small activating RNA, designed to activate transcription of the CEBPA gene, showed an acceptable safety profile and potential synergistic efficacy with tyrosine kinase inhibitors in a phase Ib study in patients with advanced hepatocellular carcinoma (Sarker, D., Sodergren, M., Plummer, ER, Basu, B., Meyer, T., Huang, KW, Evans, TRJ, Spalding, D., Ma, YT, Palmer, DH, et al. (2020). First-in-human phase I trial of small activating RNA (saRNA) oligonucleotide MTL-CEBPA incombination with sorafenib in patients with advanced hepatocellular carcinoma (HCC). Journal of Clinical Oncology 38). These clinical advances, along with the critical role of ASPM-i1 in invadopodia biogenesis and cancer invasiveness, have motivated us to develop nanoparticle formulations and ASPM-v1-targeted siRNA gene therapies for the treatment of invasive and metastatic cancers.

[0133] Unmodified siRNA is susceptible to serum exonucleases and endonucleases, resulting in a short serum half-life and can induce immune responses through interferon and proinflammatory cytokines (Watts, JK, Deleavey, GF and Damha, MJ (2008). Chemically modified siRNA: tools and applications. Drug Discov Today 13, 842-855). Therefore, many chemical modifications have been explored to improve the stability of siRNA and reduce the immunogenicity of siRNA (Hassler, MR, Turanov, AA, Alterman, JF, Haraszti, RA, Coles, AH, Osborn, MF, Echeverria, D., Nikan, M., Salomon, WE, Roux, L. et al., (2018). Comparison of partially and fully chemically-modified siRNA in conjugate-mediated delivery in vivo. Nucleic Acids Res 46, 2185-2196). To avoid the potential immunogenicity of these siRNAs and increase their stability in serum, we added 2'-O-methylation modifications at the UA or CA sites of the antisense strand and all pyrimidines of the sense strand, as 2'-O-methylation of the selected siRNAs is associated with less immune activation upon systemic administration (Adami, RC, Seth, S., Harvie, P., Johns, R., Fam, R., Fosnaugh, K., Zhu, T., Farber, K., McCutcheon, M., Goodman, TT et al., (2011). An amino acid-based amphotericliposomal delivery system for systemic administration of siRNA. Mol Ther 19, 1141-1151). To enhance serum stability, we also added two deoxythymidine 3' overhangs with phosphorothioate bonds to the sense and antisense strands.

[0134] Double-stranded, partially chemically modified siASPM-v1.F3#1 and siASPM-v1.F4#1, as well as similarly modified non-target double-stranded oligonucleotides (sense strand: 5′-UGGUUUACAUGUCGACUAA-3′; non-target control siRNA) were synthesized by Dharmacon (Horizon Discovery Ltd., Waterbeach, UK). UU dinucleotides were added as overhangs to the 3′ ends of both oligonucleotide strands. Each of these was formulated with a lipid nanoparticle (LNP)-based delivery vehicle comprising an ionizable cationic amino lipid DLin-MC3-DMA (MC3) complexed with siRNA, the amphoteric phospholipid distearoyl-phosphatidylcholine (DSPC), cholesterol, and the coating lipid poly(ethylene glycol) lipid 1,2-dimyristoyl-rac-glycero-methoxy(poly(ethylene glycol)) (DMG-PEG) mixed in a molar ratio of 50:10:38.5:1.5 (Adams, D., Gonzalez-Duarte, A., O'Riordan, W.D., Yang, C.C., Ueda, M., Kristen, A.V., Tournev, I., Schmidt, H.H., Coelho, T., Berk, J.L., et al., (2018). Patsiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis. N Engl J Med 379, 11-21). The reasons for choosing this MC3-based LNP as the delivery vehicle for our ASPM-targeted siRNA therapy are threefold. First, the same LNP formulation was used in Onpattro, the first FDA-approved siRNA drug developed by Alnylam Pharmaceuticals.Secondly, this LNP formulation has been used for systemic delivery of siRNA targeting tumor driver genes such as BCR-ABL, VEGF-A, and kinesin spindle protein (KSP) in a chronic myeloid leukemia (CML) mouse model (Jyotsana, N., Sharma, A., Chaturvedi, A., Budida, R., Scherr, M., Kuchenbauer, F., Lindner, R., Noyan, F., Suhs, KW, Stangel, M., et al., (2019). Lipid nanoparticle-mediated siRNA delivery for safe targeting of human CML in vivo. Ann Hematol 98, 1905-1918) or in orthotopic murine models of hepatocellular carcinoma (HCC) (Tabernero, J., Shapiro, GI, LoRusso, PM, Cervantes, A., Schwartz, GK, Weiss, GJ, Paz-Ares, L., Cho, DC, Infante, JR, Alsina, M. et al., (2013). First-in-humans trial of an RNA interference therapeutic targeting VEGF and KSP incancer patients with liver involvement. Cancer Discov 3, 406-417). Third, systemic delivery of siRNA based on this LNP formulation was shown to be safe in a Phase I clinical trial and was generally well tolerated except for some infusion-related reactions and transient induction of proinflammatory cytokines. The particle size of MC3-based LNPs is in the range of 70-90 nm (Jayaraman et al., 2012), which is associated with prolonged circulation time and allows them to leak into tumor tissue through leaky endothelial cell fenestrations (estimated pore size of 380-780 nm), a phenomenon known as the "enhanced permeation and retention (EPR)" effect (Agarwal and Roy, 2013; Jain and Stylianopoulos, 2010).

[0135] We synthesized DLin-MC3-DMA and purchased DSPC (Avanti Polar Lipids, Alabaster, AL, USA), cholesterol (Sigma-Aldrich), and DMG-PEG (NOF America Corporation, White Plains, NY, USA). We encapsulated the chemically modified formulation of the mixture of siASPM-v1.F3.#1 and siASPM-v1.F4.#1 in an in-house designed microfluidic device, controlling the mixing conditions at a flow rate of 0.5 ml / min and a flow rate ratio of 1:3 (lipid:siRNA = 0.125 ml / min:0.375 ml / min). The size (number-weighted mean diameter) and zeta potential of the LNPs were measured using a Zetasizer Nano ZS ZEN3600 instrument (Malvern Instruments, Worcestershire, UK). Quanti-iT TM The RiboGreen RNA reagent and kit (Invitrogen, Waltham, MA, USA) were used to measure the encapsulation efficiency and total concentration of siRNA. The resulting 1:1 mixture of chemically modified siASPM-v1.F3#1 and siASPM-v1.F4#1 encapsulated in MC3-based LNPs was named "LNP-siASPM-v1."

[0136] We first verified that treatment of MDA-MB-436 cells with LNP-siASPM-v1 could reduce the transcript level of ASPM-v1 in a dose-dependent manner, with a 50% inhibitory concentration (IC50) of 0.43 nM ( Figure 12A Consistently, immunoblotting analysis confirmed that treatment dose-dependently reduced the protein abundance level of ASPM-i1 ( Figure 12B In contrast, treatment did not affect the transcript levels of ASPM transcript variant 2 (data not shown) or the protein abundance levels of ASPM-i2 ( Figure 12B ), which once again confirmed its specific attenuation effect on ASPM-v1 expression. Consistent with its attenuation effect on ASPM-i1, treatment of cancer cells with siASPM-v1 significantly abolished the formation of cortical actin + F-actin + invadopodia ( Figure 13A ) and its invasive ability ( Figure 13B ).

[0137] Previously, ASPM, particularly ASPM-i1, has been shown to contribute to canonical Wnt activity, stemness, and tumorigenesis in various types of cancer, such as pancreatic cancer, prostate cancer, and hepatocellular carcinoma (HCC) (Hsu, CC, Liao, WY, Chan, TS, Chen, WY, Lee, CT, Shan, YS, Huang, PJ, Hou, YC, Li, CR, and Tsai, KK (2019a). The differential distributions of ASPM isoforms and their roles in Wnt signaling, cell cycle progression, and pancreatic cancer prognosis. J Pathol 249, 498-508). Therefore, we sought to evaluate the effects of ASPM-v1-targeted siRNA on Wnt activity and stemness in cancer cells. To this end, we treated HCC HuH-1 cells with LNP-siASPM-v1 and verified that it could substantially reduce Wnt3A-stimulated Wnt-specific TEF / LEF reporter activity in HuH-1 cells ( Figure 14A Consistently, it also reduced the number of aldehyde dehydrogenase (ALDH)-positive cells, which are known to be abundant stem-like cells in HCC ( Figure 14B Functionally, transduction of HuH-1 cells with LNP-ASPM-v1 siRNA substantially inhibited their ability to form tumor spheres under serum-free and ultra-low attachment culture conditions ( Figure 14C These findings collectively support the Wnt and stemness inhibitory function of LNP-formulated ASPM-v1-targeting siRNA.

[0138] Example 7 Pharmacodynamic Study of ASPM-v1 Targeted siRNA Therapy Formulated with Lipid Nanoparticles

[0139] To determine the pharmacodynamic activity of systemic LNP-siASPM-v1 therapy in treated tumor cells, triple-negative breast cancer (TNBC) MDA-MB-436 cells were lentivirally transduced with a GFP and firefly luciferase (FF-Luc) fusion vector (UBC-EGFP-T2A-Luc; System Biosciences) and stained with BD Influx TMGFP-positive cells were sorted using a cell sorter (BD Biosciences). The cells were then injected orthotopically into the mammary fat pad of immunodeficient NOD / SCID mice. Ten days after cell inoculation, when tumors were detectable by bioluminescence (BLI), tumor-bearing mice received an intravenous (IV) injection of 100 μg (approximately 4 mg / kg) of LNP-siASPM-v1 per mouse. The treatment was repeated three days later, and the tumors were removed 24 hours after the second injection. The tumors were enzymatically dissociated into single cells and analyzed using a FACSAria TM GFP was sorted using III cell sorter (BD Biosciences) + Cancer cells were used for subsequent analysis ( Figure 15A ).

[0140] like Figure 15B As shown, the majority (average 88.7%) of GFP isolated from mice treated with LNP-siASPM-v1 + Tumor cells were Cy5 positive 24 hours after treatment, confirming successful siRNA transduction. The percentage of cells transduced with siRNA gradually decreased over time, with an estimated half-life of 4.8 days.

[0141] Next, to determine the accumulation of LNP-siASPM-v1 in tumor cells, tumor tissues removed from siRNA-treated mice were snap-frozen in liquid nitrogen, and sections were immunofluorescently stained with muscimol (an actin filament stain) to mark cell outlines. Figure 15C As shown, confocal imaging showed that systemically administered siRNA was successfully delivered to the cytoplasm of tumor cells in an orthotopic TNBC model.

[0142] Finally, to determine the effect of systemic LNP-siASPM-v1 therapy on the attenuation of ASPM-i1 protein abundance in treated tumor cells, freshly sorted GFP from treated tumors were collected. + Protein lysates of tumor cells were collected and blotted with ASPM-i1-specific rabbit polyclonal antibodies (Hsu et al., 2019a). As expected, siRNA therapy substantially reduced the protein abundance of ASPM-i1 compared to untreated tumors ( Figure 15D ), confirming that systemic siASPM-v1 therapy does specifically inhibit the expression of ASPM-i1 in treated tumor cells.

[0143] Example 8 Anti-tumor and anti-metastatic effects of ASPM-v1 targeted siRNA therapy in triple-negative breast cancer (TNBC)

[0144] Having demonstrated the expected inhibitory effect of LNP-ASPM-v1 siRNA on the formation of invadopodia and the invasive ability of cancer cells, we next attempted to investigate its therapeutic effect in vivo. We used an orthotopic breast cancer progression model to explore whether systemic LNP-siASPM-v1 could exert anti-metastatic efficacy. TNBC MDA-MB-436 cells (10 6 LNPs (100 μg [approximately 4 mg / kg] per mouse every 3 days; 10 doses total) were injected orthotopically into the mammary fat pad of NOD / SCID mice. Ten days after cell inoculation, when tumors were detectable by BLI, tumor-bearing mice received repeated intravenous injections (IV; 100 μg [approximately 4 mg / kg] per mouse every 3 days; 10 doses total) of LNP-siASPM-v1 or LNP-nontarget control siRNA (NT siRNA). Resulting primary or metastatic lung tumors ( Figure 16A The results showed that IV LNP-siASPM-v1 therapy at different dose levels (2 mg / kg or 4 mg / kg per injection) significantly reduced the growth of primary tumors in a dose-dependent manner, with the tumor control rate at the high dose level being 81.2% ( Figure 16B As expected, systemic gene therapy completely prevented the development of distant lung metastases ( Figure 16C ), highlighting the strong anti-tumor and anti-metastasis efficacy of ASPM-v1 targeted siRNA therapy.

[0145] Despite advances in adjuvant chemotherapy, approximately 40% of breast cancer patients who undergo surgery to remove their primary tumor will relapse and ultimately die from metastatic disease (Weigelt, B., Peterse, JL, and van't Veer, LJ (2005). Breast cancer metastasis: markers and models. Nat Rev Cancer 5, 591-602). Current adjuvant chemotherapy only improves the 15-year survival rate of breast cancer patients by 3%-10%, highlighting the urgent need to develop anti-metastatic therapies that are safer and more effective than chemotherapy. Along these lines, the ability of nanoparticles to improve tissue penetration and tumor uptake of drug delivery, as well as their potential to combine multiple therapeutic functions into a single platform, makes nanoparticle therapeutics a highly promising strategy for treating metastatic cancer (Schroeder, A., Heller, DA, Winslow, MM, Dahlman, JE, Pratt, GW, Langer, R., Jacks, T., & Anderson, DG (2011). Treating metastatic cancer with nanotechnology. Nat Rev Cancer 12, 39-50). Since ASPM-v1-targeted siRNA therapy demonstrated significant anti-metastatic efficacy in an orthotopic breast cancer model, we hypothesized that this nanogene therapy would also be highly effective in preventing metastatic disease. To address this possibility, we injected MDA-MB-436 cells into the tail vein of NOD / SCID mice. Twenty-four hours after cell inoculation, mice received an IV injection of LNP-siASPM-v1 (4 mg / kg per mouse every three days for a total of six doses) ( Figure 17A In fact, the therapy completely prevented the occurrence of distant metastases, especially in the lungs ( Figure 17B and Figure 17C ), supporting the therapeutic potential of ASPM-v1-targeted siRNA therapy in the adjuvant setting.

[0146] Example 9 Antitumor Efficacy of ASPM-v1 Targeted siRNA Therapy in Hepatocellular Carcinoma (HCC)

[0147] Our previous findings indicate that ASPM-v1-targeted siRNA therapy inhibits invadopodia formation and invasiveness, as well as Wnt activity and stemness properties of cancer cells ( Figure 14 ). Consistently, intratumoral (IT) injection of LNP-siASPM-v1 reduced primary tumor volume in the aforementioned orthotopic breast cancer model. These findings, coupled with the recent FDA approval of liposome-encapsulated siRNA therapy for transthyretin-mediated amyloidosis (Patisiran, Alnylam) and the critical role of the ASPM gene in HCC tumorigenicity and progression, prompted us to evaluate the therapeutic potential of ASPM-v1-targeted siRNA therapy for the treatment of localized and / or advanced HCC. Therefore, we administered LNP-siASPM-v1 to established HCC via IT injection in a subcutaneous xenograft mouse model, with or without simultaneous oral administration of sorafenib, a multikinase inhibitor routinely used as a first-line treatment for advanced HCC that also has Wnt inhibitory effects (Lachenmayer, A., Alsinet, C., Savic, R., Cabellos, L., Toffanin, S., Hoshida, Y., Villanueva, A., Minguez, B., Newell, P., Tsai, HW, et al. (2012). Wnt-pathway activation in two molecular classes of hepatocellular carcinoma and experimental modulation by sorafenib. Clin Cancer Res 18, 4997-5007). In this model, HuH-1 cells were lentivirally transduced with a fusion vector of GFP and firefly luciferase, and GFP-positive cells were sorted as described above. 6 100 μl (1:1 Matrigel:cells) of 8-week-old NOD / SCID mice were inoculated subcutaneously into the flank or orthotopically into the left liver lobe, and tumor mass and distribution were assessed by BLI.

[0148] like Figure 18AAs shown, intratumoral injection of LNP-siASPM-v1 (0.8 mg / kg or 2 mg / kg every 3 days, for a total of 3 doses) significantly attenuated tumor growth in a dose-dependent manner. Notably, the treatment significantly reduced the growth of primary tumors, with an average tumor control rate of 92.8% at the 2 mg / kg dose level. Although the anti-tumor efficacy of LNP-siASPM-v1 therapy at the 0.8 mg / kg dose level was less significant, it significantly enhanced the anti-tumor efficacy of the standard HCC therapeutic agent sorafenib, suggesting that LNP-formulated ASPM-v1-targeted siRNA and sorafenib have potential synergistic effects in the treatment of HCC ( Figure 18B ).

[0149] Next, we sought to further extend our findings to a more clinically relevant setting. Since image-guided local therapies such as ablation and transcatheter tumor therapy are widely accepted treatment options for early-stage HCC patients, we performed ultrasound-guided injection of LNP-formulated ASPM-v1-targeting siRNA in an orthotopic mouse model of HCC ( Figure 19A Human HCC HuH-1 cells were injected into the left lobe of the liver of NOD / SCID mice under ultrasound guidance. Three weeks after cell inoculation, LNP-siASPM-v1 was injected directly into the tumor under ultrasound guidance. Notably, low-dose injections of LNP-siASPM-v1 (0.8 mg / kg) into orthotopic HuH-1 tumors substantially attenuated their growth. Figure 19B ), supporting intratumoral ASPM-v1-targeted siRNA therapy as a clinically feasible approach to treat early-stage HCC patients presenting with accessible lesions.

[0150] Systemic administration of multikinase inhibitors or immune checkpoint inhibitors is a treatment option for patients with advanced HCC, but it is associated with very limited survival benefits or response rates. Therefore, we investigated whether systemic administration of LNP-formulated ASPM-v1-targeting siRNA could also exert anti-tumor efficacy in an orthotopic HCC model. Briefly, HuH-1 cells (1×10 6 100 μl (1:1 Matrigel:cells) of 8-week-old NOD / SCID mice were subcutaneously inoculated into the flank or orthotopically into the left liver lobe. Two weeks after tumor establishment, LNP-siASPM-v1 (100 μg [approximately 4 mg / kg] per mouse every 3 days; 6 doses in total) or LNP-non-target control siRNA ( Figure 20A ).like Figure 20BAs shown, systemic administration of LNP-siASPM-v1 can effectively transduce tumor cells in orthotopically established HCC. Importantly, systemic LNP-siASPM-v1 therapy can significantly attenuate tumor progression, with an average tumor control rate of 57.5% ( Figure 20C and Figure 20D ); therefore, mice receiving the therapy survived significantly longer than those receiving the control treatment ( Figure 20E ).

[0151] Example 10 Combinations of siRNAs that Effectively Downregulate ASPM-v1 Expression in Various Types of Human Cancers

[0152] Our previous findings in Example 5 showed that the gene silencing effect of ASPM-v1-specific siRNA varied greatly among different types of malignant cells, such as HEK293T cells and breast cancer MDA-MB-436 cells ( Figure 11 As we sought to select siRNAs that could effectively silence ASPM-v1 expression in various types of cancer, we began to de novo select siRNAs that could achieve optimal attenuation efficacy in different malignant cells.

[0153] To this end, we first selected ten siRNAs from the thirty described in Example 5 that achieved greater than 80% attenuation of ASPM-v1 expression in HEK293T cells. We then obtained synthetic double-stranded siRNAs (Dharmacon) and transduced each of these into HEK293T cells, the TNBC line MDA-MB-436 cells, and the HCC line HuH-1 cells using Lipofectamine LTX reagent (ThermoFisher Scientific). An siRNA (siASPM-v1.8602; 5'-GAGCUGCUAUCACUUUACAGC-3'), previously validated for attenuation of ASPM-v1 expression, was included as a positive control (Hsu et al., 2019b), and a non-target control siRNA (NT siRNA; 5'-UGGUUUACAUGUCGACUAAUU-3'; Dharmacon) was included as a negative control. We measured ASPM-v1 transcript levels using quantitative real-time PCR (qRT-PCR) using the LightCycler FastStart DNAMASTERPLUS SYBR Green I Kit and the LightCycler System (Roche Diagnostics GmbH, Mannheim, Germany). Oligonucleotide primers were designed using Primer Bank (http: / / pga.mgh.harvard.edu / primerbank / index.html) and included the forward primer: GCG AAG AGT CTT AGC ACA G and the reverse primer: GTG GAA TAT CTT CTC CAA TAT CCC. We averaged the attenuation efficacy of each of the 13 siRNAs in each strain and ranked their potency accordingly, identifying the top-ranked siRNA that consistently achieved attenuation efficacy greater than 80% across all three strains.

[0154] To develop the active pharmaceutical ingredient (API) of the siRNA therapeutic agent in our preferred embodiment of the present invention, we reasoned that (1) siRNAs targeting different fragments on exon 18 of ASPM-v1 mRNA could avoid potential changes in chromatin structure that could reduce efficacy, and (2) siRNA mixtures consisting of half the amount of each siRNA as a single siRNA could theoretically reduce potential toxicities such as off-target silencing and immunostimulatory effects. Therefore, we selected siASPM-v1.4822 (sense strand: SEQ ID NO: 4; antisense strand: SEQ ID NO: 5), which targets fragment 1 on exon 18 (ASPM-v1.e18.F1); and siASPM-v1.7636 (sense strand: SEQ ID NO: 6; antisense strand: SEQ ID NO: 7), which targets fragment 3 on exon 18 (ASPM-v1.e18.F3). We used their 1:1 combination as the API for ASPM-v1-targeted siRNA therapeutics for subsequent development.

[0155] To avoid the potential immunogenicity of these siRNAs and increase their stability in serum, we added 2'-O-methylation modifications at the UA or CA sites of the antisense strand and all pyrimidines of the sense strand, because 2'-O-methylation modifications of siRNA formulated with LNPs are associated with less immune activation when administered systemically (Adami, RC, Seth, S., Harvie, P., Johns, R., Fam, R., Fosnaugh, K., Zhu, T., Farber, K., McCutcheon, M., Goodman, TT et al., (2011). An amino acid-based amphoteric liposomal delivery system for systemic administration of siRNA. Mol Ther 19, 1141-1151). To enhance serum stability, we also added two deoxythymidine 3' overhangs with phosphorothioate bonds to the sense strand and antisense strand (Table 2). Table 2 Chemical modifications of siASPM-v1.7636 (siASPM-v1.m7635) and siASPM-v1.4822 (siASPM-v1.m4822) m, 2'-O-methyl RNA; *, phosphorothioate linkage. 1 Modified nucleotides are underlined.

[0156] To compare and verify the attenuation efficacy of the two newly selected siRNAs and their mixtures, we used Lipofectamine LTX reagent to transduce MDA-MB-436 cells with siASPM-v1.7636, siASPM-v1.4822, a 1:1 mixture thereof, or a non-target control siRNA (NT siRNA) with or without chemical modification for 48 hours, after which RNA was isolated and the transcript levels of ASPM-v1 were measured using qRT-PCR. Figure 21A As shown, except for the unmodified siASPM-v1.7636, all the tested siRNAs can achieve comparable attenuation efficacy of more than 70% for all tested sequences. In addition to the attenuation efficacy of chemically modified siASPM-v1.7636 being greater than that of unmodified siASPM-v1.7636, chemically modified siASPM-v1.7636 and siASPM-v1.4822 can achieve attenuation efficacy comparable to that of unmodified siRNA. We used the same transduction method to verify the attenuation efficacy of chemically modified siRNA in HuH-01 cells. Figure 21B As shown, all tested sequences achieved attenuation efficacies greater than 75%, except for siASPM-v1.4822 (average attenuation efficacy = 68.6%). Collectively, these data demonstrate that these siRNAs can achieve satisfactory attenuation efficacies in both TNBC and HCC cells, and their efficacy is not affected by the introduction of chemical modifications.

[0157] Having demonstrated gene silencing efficacy, a 1:1 mixture of siASPM-v1.7636 and siASPM-v1.4822 (hereinafter referred to as siASPM-v1 API) was used as the API for ASPM-v1-targeted siRNA therapeutics, a preferred embodiment of the present invention. To validate the effects of siASPM-v1 API in inhibiting invadopodia formation, invasion, and developmental pathway activity in cancer cells, HuH-01 or MDA-MD-436 cells were transduced with 100 nM siASPM-v1 API or chemically modified non-target control siRNA (NT siRNA) using Lipofectamine LTX reagent for 48 hours. The cells were then plated on gelatin substrate (Sigma-Aldrich, G1393) as previously described (Eckert et al., 2011). Cells were plated on gelatin for 6 hours or longer and then immunostained with anti-cortical actin (4F11; Abcam, Cambridge, UK) or Alexa Fluor 647 muscarinic acid (F-actin stain; Invitrogen), and the staining pattern was assessed using confocal imaging analysis using a Leica TCS SP5 confocal microscope system (Leica Microsystems GmbH, Wetzlar, Germany). + F-actin+ spots represent cross-sections of invadopodia protruding downward from the cell body. As shown in Figure 22, pretreatment of HhH-1 and MDA-MB-436 cells with siASPM-v1 API significantly reduced the number of invadopodia compared to cells treated with NT siRNA, with an average reduction of 64.8% (HuH-01) to 63.7% (MDA-MB-436).

[0158] Since the inhibitory effect of siASPM-v1 API on the formation of invadopodia of HCC and TNBC cells has been confirmed, we investigated whether it can effectively inhibit the invasive ability of cancer cells. HuH-1 cells or MDA-MB-436 cells were transduced with 100nM siASPM-v1 API using Lipofectamine LTX reagent for 48 hours. After that, the cells were seeded on Transwell inserts (BD Biosciences, San Jose, CA) with a thin layer of type I collagen (BD Biosciences) in the presence of 10% FBS and allowed to invade across the collagen for 12 hours. The cells that invaded through the insert were fixed, stained with SYTOX Green (Invitrogen), and counted using a fluorescence microscope. Figure 23As shown, consistent with the inhibitory effect on invadopodia, transduction of cells with siASPM-v1 API substantially reduced the invasive capacity of HuH-1 (average reduction of 89.2%) and MDA-MB-436 cells (average reduction of 75.3% compared with these cells treated with NT siRNA).

[0159] As described in our previous findings in Example 4, ASPM-i1 contributes to the activity of multiple developmental signaling pathways in cancer cells, including Wnt, Hedgehog, and Notch. To confirm that inhibiting the function of siASPM-v1 API by transducing cells can inhibit the activity of these development-related signaling pathways in cancer cells, we infected HuH-1 or MDA-MB-436 cells with a lentiviral vector carrying a triple luciferase reporter for Wnt, Hedgehog (Hh), and Notch (pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc; Addgene plasmid #113862) (Maier et al., 2019). In separate experiments, to further stimulate the activity of these pathways, cells were treated with recombinant human WMT3A (250 ng / ml, 16 h; R&D Systems, Minneapolis, MN), recombinant human sonic hedgehog (SHH; 3 μg / ml, 24 h; Sigma-Aldrich) (Liu et al., 2006), recombinant human JAG1-Fc (5 μg / ml, 24 h; Sigma-Aldrich, Steinheim, Germany) (Dees et al., 2011), or vehicle. Luciferase assay system, Luciferase assay system and The luciferase assay system (Promega, Madison, WI) measures Wnt, Hedgehog, and Notch reporter activities in unstimulated or stimulated cells.

[0160] As shown in Figure 24, transduction of HuH-1 cells with the siASPM-v1 API significantly reduced Wnt, Hedgehog, and Notch reporter activity, which was even more pronounced in ligand-stimulated cells. Similarly, transduction with the siASPM-v1 API significantly inhibited Wnt / Hedgehog / Notch reporter activity in both unstimulated and ligand-stimulated MDA-MB-436 cells. These data demonstrate that inhibition of ASPM-v1 expression by the siASPM-v1 API effectively suppresses these oncogenic pathways in diverse cancer cell types.

[0161] We expanded the above siRNA selection strategy to include other higher mammalian species in the design of ASPM-v1-targeting siRNAs. We selected the domestic dog (Dog) because its ASPM gene has a high percent identity with the human gene (82.69%), second only to the monkey ortholog (99.52%). We used NCBI BLAST search to align the exon 18 sequences of the human, canine, and monkey ASPM genes, identifying ten consistent subsegments with conserved sequences exceeding 25 nucleotides in length. Notably, the sequences of these subsegments are consistent in the human, canine, and cynomolgus macaque genes, allowing for flexible selection of relevant species in subsequent toxicity and preclinical testing. We designed and selected candidate siRNAs using the criteria described above.

[0162] To compare the gene silencing effects of candidate ASPM-v1-targeting siRNAs (siASPM-v1), we generated synthetic double-stranded siRNAs (Dharmacon) and transduced each into HuH-1 hepatocellular carcinoma (HCC) cells or HCT-116 colorectal cancer (CRC) cells using Lipofectamine LTX reagent (ThermoFisher Scientific). As described above, we measured ASPMv1 transcript levels using qRT-PCR. We ranked their potency and identified two top-ranked siRNAs: siASPM-v1.4360 (sense strand: SEQ ID NO: 8; antisense strand: SEQ ID NO: 9) and siASPM-v1.4822 (sense strand: SEQ ID NO: 4; antisense strand: SEQ ID NO: 5), which consistently achieved greater than 75% knockdown efficacy in both HuH-1 and HCT-116 cells. We verified that transduction of canine A-72 fibroblasts (Bioresource Collection and Research Center (BCRC), Hsinchu, Taiwan, China, #60480) with the two siASPM-v1s resulted in a satisfactory (>75%) KD for ASPM-v1 expression. To explore the potential utility of the selected siASPM-v1s as active pharmaceutical ingredients (APIs) for ASPM-v1-targeted siRNA therapeutics against extrahepatic cancers, we tested their gene silencing effects on ASPM-v1 in MDA-MB-436 triple-negative breast cancer (TNBC) cells and NCI-H209 and NCI-H146 small cell lung cancer (SCLC) cells (American Type Culture Collection, Manassas, VA). We transduced each cell line with the candidate siASPM-v1 using Lipofectamine LTX reagent (ThermoFisher Scientific) and measured ASPM-v1 transcript levels using qRT-PCR as described above. We validated that the two top-ranked siASPM-v1 selected from HCC and CRC cells, including siASPM-v1.4360 and siASPM-v1.4822, were the most effective siRNAs in MDA-MB-436 TNBC cells, with attenuation efficacies of 96.71% and 83.95%, respectively.Similarly, transduction of NCI-H209 and NCI-H146 SCLC cells with the two siASPM-v1s also achieved excellent ASPM-v1 gene silencing, achieving 84.49% and 86.31% attenuation in NCI-H209 cells and 81.37% and 83.77% attenuation in NCI-H146 cells, respectively. These highly consistent and robust data support the inclusion of these two siASPM-v1s in the subsequent development of ASPM-v1-targeted siRNA therapeutics for various cancers.

[0163] siASPM-v1.4360 and siASPM-v1.4822 target different mRNA subsegments on exon 18, and therefore we designated their 1:1 combination as another version of LNP-encapsulated siASPM-v1 API (siASPM-v1API_V2). In addition, to avoid the potential immunogenicity of these siRNAs and increase their stability in serum, we added 2'-O-methylation modifications at the UA or CA sites of the antisense strand and all pyrimidines of the sense strand, because 2'-O-methylation modifications of siRNA formulated with LNPs are associated with less immune activation when administered systemically (Adami, RC, Seth, S., Harvie, P., Johns, R., Fam, R., Fosnaugh, K., Zhu, T., Farber, K., McCutcheon, M., Goodman, TT et al., (2011). Anamino acid-based amphoteric liposomal delivery system for systemic administration of siRNA. Mol Ther 19, 1141-1151). To enhance serum stability, we added two deoxythymidine 3' overhangs with phosphorothioate bonds to the sense and antisense strands. The chemically modified siRNAs were named "siASPM-v1.m4360-4378" and "siASPM-v1.m4822-4840," respectively, where "m" indicates "modified" (Table 3). Table 3 Chemical modifications of siASPM-v1.4360 (siASPM-v1.m4360) m, 2'-O-methyl RNA; *, phosphorothioate linkage. 1 Modified nucleotides are underlined.

[0164] To compare and verify the gene silencing efficacy, we used Lipofectamine LTX reagent to transduce Huh-1 and HCT-116 cells with siASPM-v1.m4360, siASPM-v1.m4822, a 1:1 mixture thereof (siASPM-v1 API_V2), or non-target siRNA (siNT) with or without chemical modifications as shown in Tables 2 and 3 for 48 hours, after which RNA was isolated and the transcript levels of ASPM-v1 were measured using qRT-PCR. As shown below

[0165] Figure 25A In HuH-1 HCC cells, all tested siRNAs achieved approximately 70% gene silencing efficacy against ASPM-v1. Notably, chemically modified siRNAs achieved slightly better attenuation efficacy (approximately 75%) than unmodified siRNAs. Similarly, in HCT-116 CRC cells (

[0166] Figure 25B ), with all tested sequences achieving an average knockdown efficacy of 82.26%. These data demonstrate that siASPM-v1.m4360-4378, siASPM-v1.m4822-4840, or a 1:1 mixture (i.e., siASPM-v1 API_V2) can achieve satisfactory ASPM-v1 gene silencing in both HCC and CRC cells, and that their efficacy is unaffected by the introduction of chemical modifications.

[0167] Next, we characterized siASPM-v1 API_V2 for its efficacy in inhibiting invadopodia formation, invasion, and development-related pathways in cancer cells. First, we used Lipofectamine LTX reagent to transduce HuH-1 or HCT-116 cells with 100 nM siASPM-v1 API_V2 or chemically modified non-target siRNA (m-siNT) for 48 hours, after which the cells were plated on gelatin matrices (Sigma-Aldrich, G1393). Cells were plated on gelatin for 12 hours and then incubated with the invadopodia marker TKS5 (anti-TKS5; 1:200; clone 13H6.3, Merck, Burlington MA) or anti-Col1-3 / 4C (type I collagen cleavage site; 1:25, ImmunoGlobe) Immunostaining was performed using a Leica TCS SP5 confocal microscope system (Leica Microsystems GmbH, Himmelstadt, Germany), and the staining pattern was evaluated using confocal imaging analysis.+ Col1-3 / 4C + The spots represent cross-sections of functional invadopodia that protrude downward from the cell body and degrade the surrounding collagen 1 matrix. As shown in Figure 26, pretreatment of HhH-1 and HCT-116 cells with siASPM-v1 API_V2 significantly reduced the number of invadopodia compared to cells treated with siNT, with an average reduction of 90.69% in HuH-1 cells and 81.31% in HCT-116 cells.

[0168] Having demonstrated the inhibitory effect of siASPM-v1 API_V2 on invadopodia formation in cancer cells, we next investigated whether it could effectively inhibit cancer cell invasion. To this end, HuH-1 or HCT-116 cells were transduced with 100 nM siASPM-v1 API_V2 using Lipofectamine LTX reagent for 48 hours. The cells were then plated on Transwell inserts (BD Biosciences, San Jose, CA) with a thin layer of type I collagen (BD Biosciences) in the presence of 10% FBS and allowed to invade across the collagen for 12 hours. Cells that had invaded through the inserts were fixed, stained with SYTOX Green (Invitrogen), and counted using a fluorescence microscope. As shown in Figure 27, consistent with the inhibitory effect on invadopodia, transduction of cells with siASPM-v1 API_V2 substantially reduced the invasive ability of HuH-1 (average reduction of 69.1%) and HCT-116 cells (average reduction of 77.7%) compared with cells treated with m-siNT.

[0169] ASPM-i1 has been shown to critically control the activity of multiple developmental and oncogenic signaling pathways, including the Wnt, Hedgehog (Hh), and Notch pathways. We recently discovered that ASPM-i1 also increases the stability of Yes-associated protein (YAP) and PDZ-binding motif (TAZ) in cancer cells. Both are coactivators of the TEAD transcription factor. To demonstrate that inhibiting these developmental and stemness-related pathways in cancer cells by transducing cells with siASPM-v1 API_V2 could suppress their function, we infected HuH-1 or HCT-116 cells with lentiviral vectors carrying either a Wnt, Hh, and Notch triple luciferase reporter (pMuLE_EXPR_CMV-eGFP_TOP-NLuc1.1_12GLI-FLuc_CBF-GLuc; Addgene plasmid #113862) (Maier et al., 2019) or the Hippo pathway transcription factor TEAD (BPS Bioscience #79833, San Diego, CA). Cells were treated with recombinant human WNT3A (250 ng / ml, 16 hours; R&D Systems, Minneapolis, MN), recombinant human sonic hedgehog (SHH; 3 μg / ml, 24 hours; Sigma-Aldrich), and recombinant human JAG1-Fc (5 μg / ml, 24 hours; Sigma-Aldrich, Steinheim, Germany) to stimulate the activity of the Wnt, Hh, or Notch pathways. Luciferase assay system (Wnt reporter), Luciferase assay system (Hh and TEAD reporters) and The luciferase assay system (Notch reporter) (Promega, Madison, WI) was used to measure the activities of Wnt, Hh, Notch, and TEAD reporters in unstimulated or stimulated cells. Figure 28 As shown, transduction of HuH-1 cells with siASPM-v1API_V2 significantly reduced reporter activities of all tested pathways, including Wnt, Hh, Notch, and TEAD, confirming that inhibition of ASPM-v1 expression by siASPM-v1 API_V2 can effectively inhibit multiple oncogenic and developmental pathways in cancer cells.

[0170] The ability to form large, three-dimensional, spheroid-like structures, or "tumorspheres," under serum-free, anchorage-independent conditions reflects the tumorigenic potential of cancer cells. Given that knockdown of ASPM-v1 expression significantly inhibits the transcriptional activity of the developmental and stemness-related Wnt, Hh, and Notch pathways, as well as YAP / TEAD, we investigated whether treating cancer cells with siASPM-v1 API_V2 could inhibit their tumorsphere-forming ability. HuH-1 hepatocellular carcinoma cells or HCT-116 colorectal cancer cells were transduced with 100 nM siASPM-v1 API_V2 or m-siNT using Lipofectamine LTX reagent for 48 hours. Cells were then plated at limiting dilutions (10,000, 1,000, 100, and 10 cells per well) in 24-well non-adherent culture plates. Ten days later, the presence of tumorspheres was assessed. Data from the limiting dilution analysis were analyzed and plotted using ELDA software (http: / / bioinf.wehi.edu.au / software / elda / index.html). As shown in FIG29 , transduction of HhH-1 or HCT-116 cells with siASPM-v1 API_V2 significantly inhibited the tumor sphere formation ability of HuH-1 or HCT-116 cells, highlighting its therapeutic potential in hepatocellular carcinoma and colorectal cancer.

Claims

1. A polynucleotide comprising a nucleotide sequence complementary to the mRNA of the ASPM gene having the nucleotide sequence shown in SEQ ID NO: 1; or 2) a nucleotide sequence comprising a continuous segment having a sequence identity of at least 70%, at least 80% or at least 90% to the nucleotide sequence complementary to SEQ ID NO:

1.

2. The polynucleotide of claim 1 , comprising a nucleotide sequence complementary to an mRNA encoded by exon 18 of a transcript variant 1 of the human ASPM gene having the nucleotide sequence shown in SEQ ID NO: 3, or a nucleotide sequence comprising a continuous segment having a sequence identity of at least 70%, at least 80%, or at least 90% to a nucleotide sequence complementary to SEQ ID NO:

3.

3. The polynucleotide of claim 1 or 2, wherein the polynucleotide is shRNA, siRNA or dsRNA.

4. The polynucleotide of any one of the preceding claims, wherein the polynucleotide is an siRNA molecule, wherein the siRNA molecule comprises: (a) a duplex region; and (b) no overhang region or at least one overhang region, wherein each overhang region contains six or fewer nucleotides, wherein the duplex region consists of a sense region and an antisense region, wherein the sense region and the antisense region together form the duplex region and the antisense region and the sense region are each 15-30 nucleotides in length, and the antisense region comprises a sequence complementary to a sequence selected from SEQ ID NO:

3.

5. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule has the antisense region and the sense region, each of which is 15-25 bases in length.

6. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 3, 5, 7 or 9.

7. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 4 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 5 by no more than 3 nucleotides.

8. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO:4 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

5.

9. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand that form another double-stranded RNA dimer, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 6 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 7 by no more than 3 nucleotides.

10. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 6 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

7.

11. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand that form another double-stranded RNA dimer, wherein the sense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 8 by no more than 3 nucleotides, and the antisense strand comprises at least 15 consecutive nucleotides that differ from SEQ ID NO: 9 by no more than 3 nucleotides.

12. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 8 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:

9.

13. The polynucleotide of any one of the preceding claims, wherein the siRNA molecule has at least one overhang region or has no overhang region.

14. The polynucleotide of any one of the preceding claims, wherein one or both of the sense strand and the antisense strand are further modified into a modified siRNA.

15. The polynucleotide of any one of the preceding claims, wherein the modified nucleotides include 2'-O-methyl modified nucleotides, 2'-fluorophosphoramidates, 3' terminal deoxythymidine nucleotides, nucleotides containing unnatural bases, nucleotides containing 5' phosphorothioate groups, and terminal nucleotides linked to a cholesterol derivative and a dodecanoic acid bisdecanoylamino group.

16. The polynucleotide of any one of the preceding claims, wherein about 10% to about 30% of the nucleotides in the double-stranded region of the modified siRNA are 2'-O-methyl nucleotides, or about 10% to about 30% of the nucleotides in both strands of the modified siRNA are 2'-O-methyl nucleotides.

17. A pool of siRNA molecules, wherein the pool comprises one or more first siRNA molecules or modified siRNA molecules, second siRNA molecules or modified siRNA molecules, third siRNA molecules or modified siRNA molecules, and fourth siRNA molecules or modified siRNA molecules, wherein The first siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 3; The second siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 5; The third siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO: 7; and The fourth siRNA molecule is a chemically synthesized double-stranded siRNA molecule, wherein: (a) each strand of the double-stranded siRNA molecule is 15 to 30 nucleotides in length; and (b) one strand of the siRNA molecule comprises a sequence complementary to a sequence selected from SEQ ID NO:

9.

18. The pool of claim 17, wherein the pool comprises one or more second siRNA molecules or modified siRNA molecules thereof, third siRNA molecules or modified siRNA molecules thereof, and fourth siRNA molecules or modified siRNA molecules thereof.

19. The pool of claim 17, wherein the pool comprises one or more second siRNA molecules or modified siRNA molecules thereof, third siRNA molecules or modified siRNA molecules thereof, and fourth siRNA molecules or modified siRNA molecules thereof; in The second siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:4 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:5; The third siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence shown in SEQ ID NO: 6 and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 7; and The fourth siRNA molecule comprises a sense strand and an antisense strand, wherein the sense strand comprises the nucleotide sequence set forth in SEQ ID NO:8 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:

9.

20. A pharmaceutical composition comprising a polynucleotide according to any one of the preceding claims and a pharmaceutical carrier, diluent and / or adjuvant.

21. A nanoparticle comprising the polynucleotide of any preceding claim and a lipid nanoparticle, liposome, micelle, virosome, nucleic acid complex, or any mixture thereof.

22. A method for inhibiting the growth, locoregional spread and distant metastasis of a malignant tumor in a subject and / or treating a solid tumor and / or tumor metastasis in a subject, comprising administering to the subject a polynucleotide according to any one of the preceding claims, a pool according to any one of claims 17 or 18, a pharmaceutical composition according to claim 20 or a nanoparticle according to claim 21.

23. The method of claim 22, wherein the solid cancer is hepatocellular carcinoma, colorectal cancer, breast cancer, pancreatic cancer, gastric cancer, and lung cancer.

Images