Anti-lipopolysaccharide factor rALF-like protein and application thereof

By screening the anti-lipopolysaccharide factor rALF-like protein from the vannamei shrimp and using its LBD domain to specifically bind to bacterial lipopolysaccharide LPS, the prevention and control problems of WSSV and AHPND were solved, pathogen prevention and control and drug development in shrimp farming were achieved, and the resistance and economic benefits of shrimp were improved.

CN120718129APending Publication Date: 2025-09-30YELLOW SEA FISHERIES RES INST CHINESE ACAD OF FISHERIES SCI

Patent Information

Application Number
CN202511211620.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-28
Publication Date
2025-09-30

AI Technical Summary

Technical Problem

White spot syndrome virus (WSSV) and acute hepatopancreatic necrosis disease (AHPND) spread rapidly in Litopenaeus vannamei aquaculture. After infection, the shrimp's feed intake decreases and the hepatopancreas swells, leading to high mortality and difficulty in control. Existing technologies are difficult to effectively prevent and control.

Method used

The anti-lipopolysaccharide factor rALF-like protein was screened out from the vannamei shrimp. It has antibacterial and antiviral functions. It specifically binds to bacterial lipopolysaccharide LPS through its LBD domain, preventing LPS from binding to host cell receptors, inhibiting inflammatory responses, and producing herbivorous proteins in the aquaculture industry through plant vector transgenic technology.

Benefits of technology

It effectively inhibits the spread of WSSV and AHPND, improves the resistance of shrimp, provides new directions for pathogen prevention and control and drug development, and enhances the economic benefits of shrimp farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120718129A_ABST
    Figure CN120718129A_ABST
Patent Text Reader

Abstract

The invention discloses an anti-lipopolysaccharide factor rALF-like protein and application thereof, and belongs to the technical field of molecular biology. The anti-lipopolysaccharide factor rALF-like protein provided by the invention belongs to secretory protein, the rALF-like protein can be competitively combined with an LPS structural domain of bacteria to achieve the purpose of inhibiting inflammation, and the expression of the coding gene Pv-ALF-like gene in blood cells, hepatopancreas, gill and intestinal tissues is remarkably up-regulated, so that the anti-lipopolysaccharide factor rALF-like protein can be used for inhibiting inflammation. The rALF-like protein disclosed by the invention has antibacterial and antiviral effects, lays a foundation for developing antibacterial and antiviral drugs and functional feed additives, and plays an important role in improving the resistance link of prawns.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to an anti-lipopolysaccharide factor rALF-like protein and an application thereof. Background Art

[0002] Penaeus vannamei, also known as the whiteleg shrimp, is native to the Pacific coast of South America. Due to its rapid growth rate and strong environmental adaptability, growth traits are the most economically important traits of this species. However, with the continued expansion of shrimp aquaculture and the deterioration of the aquaculture environment, diseases have become increasingly common. White spot syndrome virus (WSSV) is a highly transmissible virus that causes reduced feed intake and hepatopancreatic enlargement in infected shrimp, resulting in significant economic losses for the shrimp industry. Furthermore, other bacterial infections are common challenges in shrimp aquaculture, hindering high-quality shrimp production. Common pathogens include Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus. Specifically, acute hepatopancreatic necrosis (AHPND) is a major threat to the shrimp industry. It spreads rapidly, has a high mortality rate, and is difficult to control through aquaculture management measures. Therefore, the research starts from both antiviral and anti-pathogenic bacteria directions to explore a new technology to solve the problems of shrimp farming, which is of great significance to improving the shrimp quality and economic benefits of shrimp farming. Summary of the Invention

[0003] Based on the above situation, the purpose of the present invention is to provide an anti-lipopolysaccharide factor rALF-like protein and its application. This invention screened and obtained a secreted protein rALF-like from the shrimp Litopenaeus vannamei with both antibacterial and antiviral functions, providing a new direction for shrimp farming and pathogen prevention and control.

[0004] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0005] The present invention provides an anti-lipopolysaccharide factor rALF-like protein, and the amino acid sequence of the anti-lipopolysaccharide factor rALF-like protein is shown as SEQ ID No.3.

[0006] The present invention also provides a gene encoding the anti-lipopolysaccharide factor rALF-like protein, and the nucleotide sequence of the encoding gene is shown in SEQ ID No. 1.

[0007] The present invention provides the use of the anti-lipopolysaccharide factor rALF-like protein in the preparation of antiviral and / or antibacterial biological preparations or medicines.

[0008] Furthermore, the anti-lipopolysaccharide factor rALF-like protein is a secretory protein.

[0009] Furthermore, the anti-lipopolysaccharide factor rALF-like protein has an LBD domain.

[0010] Furthermore, the population used includes Litopenaeus vannamei.

[0011] Furthermore, the virus includes white spot syndrome virus.

[0012] Furthermore, the bacteria include Staphylococcus aureus S. aureus, Escherichia coli E. coli, Vibrio parahaemolyticus Vp AHPND At least one of .

[0013] Furthermore, the vannamei shrimp can induce Pv-ALF-like gene expression under viral and / or bacterial infection, and shows significant upregulation in blood cells, hepatopancreas, gills and intestinal tissues.

[0014] Furthermore, the rALF-like protein specifically binds to bacterial lipopolysaccharide LPS through its LBD domain, preventing LPS from binding to host cell receptors, thereby inhibiting inflammation.

[0015] Furthermore, the anti-lipopolysaccharide factor rALF-like protein competitively binds to the LPS / PGN domain in bacteria.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] 1. This study successfully isolated the gene from the hemocytes, hepatopancreas, gills, and intestines of Litopenaeus vannamei using molecular biology techniques. Sequence analysis revealed that the Pv-ALF-like gene contained a signal peptide sequence, possessed the unique lipopolysaccharide domain (LBD) of ALF-like, and exhibited a highly conserved amino acid sequence.

[0018] 2. Dot-blot analysis confirmed that the secreted rALF-like protein described herein is secreted and expressed in both hemocytes and plasma following infection with acute hepatopancreatic necrosis disease (AHPND). When shrimp were infected with AHPND or white spot syndrome virus (WSSV), expression of the gene was significantly upregulated in hemocytes, hepatopancreas, gills, and intestine.

[0019] 3. This invention, for the first time, has isolated a secreted rALF-like protein from Litopenaeus vannamei with both antibacterial and antiviral properties, offering new insights into shrimp aquaculture and pathogen control. Specifically, these include: 1. Pathogen control: rALF-like can directly inhibit pathogens by binding to bacterial surface components (such as LPS / PGN); 2. Application potential: paving the way for the development of targeted antibacterial / antiviral drugs and functional feed additives; and 3. Targeted application of specific protein sources: Producing herbivorous proteins in aquaculture through plant-based transgenic technology plays a crucial role in enhancing shrimp resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an amino acid sequence alignment diagram, where the boxes represent the LBD domains of different species, black represents highly conserved amino acids, red represents relatively conserved amino acids, and blue represents generally conserved amino acids;

[0021] Figure 2 This is the result of Pv-ALF-like gene amplification;

[0022] Figure 3 For the identification of secretory anti-lipopolysaccharide factor by Dot-blot;

[0023] Figure 4 The expression pattern of Pv-ALF-like gene in Litopenaeus vannamei after infection with WSSV, where A represents blood cells, B represents hepatopancreas, C represents gills, and D represents intestines.

[0024] Figure 5 Vannamei shrimp infected with Vp AHPND The expression pattern of the posterior Pv-ALF-like gene, where A is blood cells, B is hepatopancreas, C is gill, and D is intestine;

[0025] Figure 6 The results of double enzyme digestion and transformation of Pv-ALF-like gene are shown in Figure 1. A is the electrophoresis diagram, lane 1: double enzyme digestion sample, lane 2: original plasmid electrophoresis; B is the DH5a plate diagram of positive recombinant transformation;

[0026] Figure 7 Figure 1 is the result of rALF-like protein purification and polyclonal antibody preparation; in Figure A, lanes 1, 2, 3, 4, and 5 are samples before induction, after induction, supernatant, precipitate, and purified, respectively; Figure B is the result of polyclonal antibody preparation;

[0027] Figure 8Figures 2 and 3 show the results of rALF-like protein binding to bacteria and competitive binding to pathogen-associated molecular patterns; A shows the Western blot results of rALF-like protein co-incubated with Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus; B shows the Western blot results of rHis-trxA-tag protein co-incubated with Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus; C shows the Western blot results of rALF-like protein co-incubated with LPS and PGN and then incubated with Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus; D shows the Western blot results of rHis-trxA-tag protein co-incubated with LPS and PGN (as a control) and then incubated with Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus.

[0028] Figure 9 This is a microscopic image of the agarose microsphere simulated bacteria binding experiment;

[0029] Figure 10 This is the antibacterial experiment of rALF-like protein, where A is Staphylococcus aureus; B is Escherichia coli; C is Vibrio parahaemolyticus; a is rALF-like protein, b is rHis-tag protein, and c is BSA protein. DETAILED DESCRIPTION

[0030] The technical solution of the present invention is further described in detail with reference to the following specific examples.

[0031] In the following examples, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from biological or chemical reagent companies.

[0032] Example 1: Analysis and amplification of Pv-ALF-like sequence information of Litopenaeus vannamei

[0033] 1. Sequence information analysis and amplification of the Pv-ALF-like gene of Litopenaeus vannamei

[0034] An upregulated gene with NCBI accession number LOC113830625 was identified from the Litopenaeus vannamei transcriptome database and subsequently verified by qRT-PCR. Primers for the Pv-ALF-like gene were designed using Primer software. PCR amplification yielded an 824-bp gene sequence (SEQ ID No. 1), including a 375-bp open reading frame (SEQ ID No. 2) encoding 124 amino acids (SEQ ID No. 3). BLAST online software alignment analysis led to the designation of the 824-bp gene as the Pv-ALF-like gene. Its key sequence features include an open reading frame encoding 124 amino acids and a conserved structural domain. The nucleotide sequence of the Pv-ALF-like gene is shown in SEQ ID No. 1, the CDS region sequence of the Pv-ALF-like gene is shown in SEQ ID No. 2, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 3.

[0035] The amino acid sequence encoded by the Pv-ALF-like gene was compared with the amino acids of other species using BLAST online software, and the sequences of the following species were mainly compared. Penaeus monodon ALF-like (XP_037785278.1), Penaeus indicus ALF-like (XP_063590858.1), Penaeus chinensis ALF-like (XP_047475653.1), Penaeus japonicus ALF-like (XP_042866095.1), Portunus trituberculatus ALF-like (XP_045120962.1), Scylla paramamosain ALF-like (XP_063877528.1), Chionoecetes opilio ALF (KAG0717214.1), Homarus americanus ALF-like (XP_042230805.1), Macrobrachium rosenbergii ALF-like (XP_066959710.1), Macrobrachium nipponense ALF-like (XP_064081001.1), Eriocheir sinensis ALF-like (XP_050711929.1), Cherax quadricarinatus ALF-like (XP_053652897.1) shows that they have a similarity of 53.16% with ALF-like molecules, where the box is the LBD domain, see Figure 1 shown.

[0036] 2. Amplification of the Pv-ALF-like gene

[0037] analyze Pv-ALF-like The gene sequence was obtained, and primers were designed using Premier 5.0 software and sent to Shanghai Jierui Bioengineering Co., Ltd. for primer synthesis.

[0038] The upstream and downstream primer sequences are: Pv-ALF-like- F: 5'- ATCGTCCGTGAATTGTTTCGT - 3', Pv- ALF-like- R: 5'-TAT GGGTCAGTTTGGGATTAC - 3'. After primer synthesis, the primer was dissolved and diluted to a certain concentration according to the instructions and stored in a -20 ℃ refrigerator. PCR amplification Pv-ALF-like The gene was amplified using cDNA from blood cells, hepatopancreas, gills and intestine tissues of Litopenaeus vannamei as templates.

[0039] PCR amplification was performed according to the system in Table 1. The specific PCR program settings were as follows: ① Pre-denaturation at 94°C for 5 min; ② Denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 40 s, for a total of 35 cycles of denaturation, annealing, and extension; ③ Post-extension at 72°C for 10 min; ④ Storage at 4°C for 10 min.

[0040] The PCR amplification products were then tested by agarose gel electrophoresis, and the band sizes were analyzed by taking photos in a gel imaging system. Agarose gel electrophoresis confirmed that the target gene fragments could be successfully amplified from various tissues of the shrimp Litopenaeus vannamei, and the theoretical values ​​were consistent with the predicted values. The results were sent to Shanghai Bioengineering for sequencing. Figure 2 shown.

[0041] Table 1 Pv-ALF-like gene PCR amplification system

[0042]

[0043] Sequence analysis showed that the Pv-ALF-like gene contained a signal peptide sequence, possessed an ALF-like-specific lipopolysaccharide domain (LBD), and had a highly conserved amino acid sequence.

[0044] Example 2: Identification of secretory anti-lipopolysaccharide factors by Dot blot

[0045] In this example, hemolymph was extracted from Litopenaeus vannamei shrimp infected with AHPND. Equal amounts of anticoagulant were mixed with the hemolymph and centrifuged at 3000 rpm / min for 10 minutes. The supernatant was plasma, and the hemocytes were precipitated. The hemocytes were then treated with Biyuntian protein lysis buffer to fully lyse the hemocytes and release the proteins. The mixture was then centrifuged at 6000 rpm / min for 10 minutes, and the supernatant was hemocyte protein.

[0046] Prepare PVDF membranes for dot blot hybridization. 10 μL of blood cells and plasma proteins (20 μg / μL) were spotted onto the PVDF membrane, air-dried, and blocked with 3% BSA overnight at 4°C. After washing three times with TBST, Anti-ALF-like (rabbit source, self-supplied) was added and incubated at 4°C for 2 h. Following three washes, the membranes were incubated with HRP-conjugated goat anti-rabbit secondary antibody (1:1000 dilution) at 37°C for 1 h. After washing three times with TBST, the membranes were developed using ECL luminescent solution and imaged using a chemiluminescent imager.

[0047] The results are as follows Figure 3 As shown, the content of Pv-ALF-like protein (the native ALF-like protein of Litopenaeus vannamei) in blood cells gradually increases with time of infection with Vibrio parahaemolyticus. Pv-ALF-like protein levels have also been detected in blood cells and plasma. Following bacterial infection, anti-lipopolysaccharide factor (ALF) is secreted from blood cells into the plasma to react with microorganisms. In fact, ALF is a secreted protein, secreted into the blood by tissues such as the liver. As an acute phase responder, it participates in the binding and neutralization of endotoxins, preventing excessive inflammatory responses. Dot-blot analysis revealed that Pv-ALF-like protein is soluble in plasma, indicating that it is a secreted protein.

[0048] Example 3: WSSV and AHPND induce Pv-ALF-like gene expression

[0049] To verify whether the Pv-ALF-like gene can function under viral and bacterial stress, infection experiments were conducted. In this example, the experimental material was Penaeus vannamei (approximately 4-5 grams per shrimp), all of which were obtained from Weifang Bangpu Seed Company, China. Before the experiment began, the shrimp were pre-cultured for 5 days at a salt concentration of 29‰, a temperature of 24±1°C, and an air pump for oxygen supply. During this period, the shrimp were maintained normally. The pathogen WSSV (4.5×10 6 copy) and Vibrio parahaemolyticus (3.5×10 6CFU / mL) was stored in the National Key Laboratory of Mariculture Breeding and Sustainable Production (Qingdao, China), Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences. Immunostimulation was performed by injection. The experiment was conducted in two groups, each with 45 shrimp. One group was injected with WSSV, and the other group was injected with Vp. AHPND , slowly injected into the abdomen of the shrimp, injecting 15 μL of WSSV extract and 50 μL of bacteria (Vp AHPND ).

[0050] Hemolymph, hepatopancreas, gills, and intestines were collected from shrimp at 0, 2, 6, 12, 24, 34, 48, and 72 hours after infection. Hemolymph was withdrawn with an anticoagulant (10% sodium citrate, pH 7.0) using a 5 mL sterile syringe and mixed with an equal proportion of hemolymph. Blood cells were separated from plasma by low-speed centrifugation. Three to five shrimp were sampled at each time point, with some tissues cryopreserved and others used for total RNA extraction.

[0051] The experimental results showed that when the shrimp Litopenaeus vannamei was infected with WSSV, the expression of Pv-ALF-like gene could be induced in blood cells, hepatopancreas, gills and intestinal tissues, and the expression trend was significantly upregulated in each tissue, such as Figure 4 In addition, infection with Vp AHPND It can also induce the expression of Pv-ALF-like genes in blood cells, hepatopancreas, gills and intestinal tissues, showing a significant up-regulation trend, such as Figure 5 In summary, the expression of β-catenin can be induced by both viral and bacterial infection in Litopenaeus vannamei, and the expression trend is significantly upregulated in hemocytes, hepatopancreas, gills and intestinal tissues.

[0052] Example 4. Prokaryotic protein expression and antibody preparation

[0053] The gene band amplified in Example 1 was double-enzyme digested with the plasmid. Double-enzyme digestion experiment of the target gene and plasmid: pET-32 a plasmid was purchased from Shanghai Sangon. The target gene and plasmid were mixed according to the system in Table 2 (Table 2), and incubated in a 37°C water bath for 3-4 hours. To achieve better enzyme ligation effect, the double-enzyme digestion product can be purified.

[0054] Table 2. Dosage composition of Pv-ALF-like and pET-32 a double enzyme digestion reaction system

[0055]

[0056] Enzyme ligation reaction experiment: according to the dosage in the table below, add the digested vector and target gene fragment (Table 2), incubate the enzyme ligation at 16 ℃ overnight, and after successful introduction into the host cell TOP10, perform plasmid mini-extraction, and transform the recombinant pET-32a-ALF-like into the competent E. coli cell BL21 (DE3) strain using the heat shock method. The engineered bacteria were successfully prepared and used for protein purification and protein function verification experiments. The double enzyme digestion and transformation results are shown in Figure 2. Figure 6 shown.

[0057] Table 3. Dosage composition of enzyme-linked reaction system

[0058]

[0059] After screening and identification, the strain was inoculated into 20 mL of liquid culture medium with ampicillin and cultured overnight at 37°C and 180 rpm until 14-16 h (OD 600 The pH value was 0.8-1.0, and the culture was performed the next day. 2 mL of bacteria were inoculated into 100 mL of liquid culture medium and cultured for 2 hours. Induction was then performed by adding 0.5 mM IPTG. The cells were then centrifuged at 8000 rpm for 10 minutes at 4°C. The cells were harvested and resuspended in sterile PBS. The cells were then ultrasonically disrupted on ice for 30 minutes. The supernatant and precipitate were then centrifuged and collected for solubility analysis.

[0060] The expressed target protein was specifically bound to a His-tag-bound Ni-IDA agarose gel affinity chromatography column and eluted with elution buffer to obtain the purified target protein, the prokaryotic protein rALF-like. Its concentration was determined using the BCA assay, and polyclonal antibodies were subsequently prepared. New Zealand long-eared white rabbits were immunized at a standard dose of 200 μg / kg. The adjuvant and antigen were fully emulsified and administered subcutaneously at multiple sites. Blood samples were collected at the end of the 5-week immunization period.

[0061] The prepared antibodies will be used to verify the function of prokaryotic proteins. Figure 7 As shown in A, lanes 1, 2, 3, 4, and 5 are samples before induction, after induction, supernatant, precipitate, and purified, respectively. In lane 5, there is an independent band at 25-35 kDa, and the band size is consistent with the theoretical value; Figure 7 Middle B is the result of polyclonal antibody preparation. The band at 25-35 kDa in lane 1 shown in the result is the band recognized by the prokaryotic protein and polyclonal antibody.

[0062] Example 5: Competitive Binding Analysis of rALF-like Protein Binding to Bacteria and Pathogen-Related Molecules

[0063] The anti-lipopolysaccharide factor rALF-like protein of Litopenaeus vannamei has an LBD domain that can bind to the LPS domain. However, in bacterial microorganisms, lipopolysaccharide (LPS) and peptidoglycan (PGN) are present.

[0064] 1. Based on this principle, this example uses a bacterial binding method to further verify whether rALF-like protein has this effect.

[0065] Microbial binding assays were performed using rALF-like proteins against Staphylococcus aureus (S. aureus), Escherichia coli (E. coli), and Vibrio parahaemolyticus (V. parahaemolyticus). Bacteria were cultured overnight, centrifuged at 6000 rpm for 10 minutes, and washed three times with sterile 1× TBS buffer (5 minutes each). 100 μL of rALF-like protein (0.2 mg / mL) and 3.5 × 10 6 The cells were incubated with 50 mM Tris-HCl (pH 8.0, 5 mM EDTA) in a buffer (50 mM L Tris-HCl, pH 8.0, 5 mM EDTA) at 37°C for 2 h. The cells were then washed three times with TBS buffer (containing 7% SDS), each for 5 min. The cells were resuspended in 100 μL of ddH2O, mixed with 50 μL of sample treatment buffer, and boiled for 5-8 min. The cells were then subjected to 12.5% ​​SDS-PAGE gel electrophoresis, transferred to a pre-wetted PVDF membrane, and run at a constant current of 300 mA in running buffer for 2 h. The membrane was blocked with TBS containing 5% nonfat dry milk at 37°C for 1 h. The membrane was then incubated with the primary antibody (diluted 1:1000 in TBS) overnight at 4°C. After overnight, the samples were washed with TBST for 3 × 10 min each time, incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (diluted in TBS at 1:2000) at 37°C for 2 h, then washed with TBST for 3 × 10 min each time and then washed with TBS for 1 × 10 min each time. The samples were then developed using the ECL chemiluminescence imaging method.

[0066] The results are as follows Figure 8 As shown in A, rALF-like is a prokaryotic protein, and the colored bands are protein markers. On the right are Staphylococcus aureus S. aureus, Escherichia coli E. coli, and Vibrio parahaemolyticus Vp AHPND Samples of the mixture after incubation with prokaryotic proteins. Among them, S. aureus, E. coli, VpAHPND After the samples were incubated with anti-lipopolysaccharide factor prokaryotic protein, they were identified by Anti-ALF-like. It was found that the bands appeared on the PVDF membrane, and the position and size were consistent with the prokaryotic protein. There were also differences in the binding ability between bacteria and prokaryotic protein. The experiment showed that S. aureus and E. coli had stronger binding ability, while Vp AHPND The control group used rHis-trxA tagged prokaryotic protein to bind to S. aureus, E. coli, Vp AHPND After incubation, SDS-PAGE electrophoresis and Western blot were performed, and the color was developed as shown in Figure 8 As shown in B, a band only appears at the target protein, and no band appears in the following three lanes, indicating that there is no binding interaction between rHis-trxA and bacteria.

[0067] 2. Competitive binding of pathogen-associated molecules was used to verify whether rALF-like protein binds to the LPS / PGN domain in bacteria

[0068] 50 μL of rALF-like protein (500 μg / mL) and 50 μL of LPS and PGN (100 μg / mL) were incubated with rotation at room temperature for 2 h. AHPND Bacteria (3.5×10 6 CFU / mL) to detect whether the binding activity is inhibited.

[0069] Overnight bacterial culture was centrifuged at 6000 rpm for 10 min, and the cells were washed three times with sterile 1× TBS buffer, 5 min each time. 100 μL of rALF-like protein (0.2 mg / mL) and bacteria (3.5×10 6 The cells were incubated with 50 μL Tris-HCl (pH 8.0, 5 mmol / L EDTA) in a buffer (50 mmol / L Tris-HCl, pH 8.0, 5 mmol / L EDTA) at 37°C for 2 h. The cells were then washed three times with TBS buffer (containing 7% SDS), each for 5 min. The cells were resuspended in 100 μL of ddH2O, mixed with 50 μL of sample treatment solution, and boiled for 5-8 min. The cells were then subjected to electrophoresis on a 12.5% ​​SDS-PAGE gel. The cells were then transferred to a membrane and visualized using an ECL chemiluminescence imaging system.

[0070] The results are as follows Figure 8 As shown in C, rALF-like protein was co-incubated with LPS and PGN and then with S. aureus, E. coli, Vp AHPNDThe results showed that rALF-like protein was incubated with LPS and PGN, and then with S. aureus, E. coli, Vp AHPND The bacteria were incubated and the experimental results showed that Figure 8 The results shown in C show that rALF-like is Figure 8 The protein bands were significantly weakened compared to those in A. After incubation of rALF-like protein in PGN, the protein bands were almost not expressed. Figure 8 As shown in Figure D, in the control group, no bands appeared on the PVDF membrane after incubation of the rHis-tag protein with LPS and PGN. These experiments revealed that PGN has a stronger binding capacity than LPS.

[0071] Western blot experiments confirmed that the rALF-like protein could bind to Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus. To verify the competitive effect of microbial polysaccharides, which are abundant in bacterial cell walls, rALF-like proteins were incubated with lipopolysaccharide (LPS) and peptidoglycan (PGN) in competitive binding experiments before interacting with bacteria. Western blot analysis revealed a significant decrease in binding, confirming that LPS / PGN can competitively bind to the rALF-like protein.

[0072] Example 6: rALF-like protein and bacteria binding experiment from a visual perspective

[0073] To further verify the binding between rALF-like protein and bacteria, agarose microspheres were used to simulate blood cells and label bacteria, and the binding between bacteria and rALF-like protein was observed under a fluorescence microscope from a visual perspective.

[0074] Fluorescein isothiocyanate (FITC) labeled bacteria: Staphylococcus aureus, Escherichia coli, Vibrio parahaemolyticus AHPND, inoculated on ordinary LB and 2216E culture media respectively. Vibrio was cultured overnight and then transferred once at 1:100. When the bacteria reached the middle and late logarithmic phase, they were collected and centrifuged at 3000 rpm for 10 min. They were washed twice with PBS buffer (0.14 M NaCL, 2.7 mM KCL, 10 mM Na2HPO4, and 1.8 mM KH2PO4), resuspended with carbonate buffer (Na2CO3 1.59 g / L, NaHCO3 2.94 g / L, pH 9.5), and FITC solution (10 g / L) was added. The cells were incubated at 37 °C for 1.5 h, centrifuged at 5000 rpm for 10 min, and the supernatant was discarded. The cells were washed twice with PBS buffer. The cells were resuspended with PBS to obtain a concentration of 1×10 9 / mL of bacterial solution.

[0075] Appropriate amounts of agarose microspheres were incubated with rALF-like protein (400 μg / mL), His-tag recombinant protein (400 μg / mL), BSA (400 μg / mL), and 1× PBS buffer at 4°C overnight. The microspheres were then washed three times with 1× TBS buffer for 5 minutes each, and then incubated with FITC-labeled bacteria.

[0076] The binding between agarose microspheres and bacteria was observed by fluorescence inverted microscope (Olympus, Japan). Figure 9 As shown, agarose microspheres incubated with rALF-like protein can bind to Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus. When His-tag recombinant protein, BSA, and PBS were incubated with agarose microspheres and then incubated with bacteria, it was found that agarose microspheres did not bind to bacteria.

[0077] This example demonstrates that agarose microspheres can effectively bind to labeled bacteria through in vitro binding experiments between fluorescently labeled bacteria (FITC labeled) and agarose microspheres incubated with rALF-like protein.

[0078] Example 7: In vitro antibacterial test of rALF-like protein

[0079] To further validate the functional properties of rALF-like proteins, their expression was induced by IPTG, followed by recombinant expression using a nickel column and subsequent concentration measurement using the BCA assay. Overnight bacterial cultures (Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus) were transfected at a 1:2 ratio for 2 h, diluted 100-fold, and evenly plated onto standard LB solid plates. Blank drug-resistant plates soaked with different protein solutions (rALF-like, rHis-tag, and BSA) were then attached to the plates for bacterial culture. The cells were incubated overnight and photographed after a clear zone of inhibition appeared. In the antibacterial experiments conducted, clear inhibition zones appeared around the blank drug-resistant pieces soaked with rALF-like protein in Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus, while no clear inhibition zones appeared around the blank drug-resistant pieces soaked with rHis-tag and BSA. After the blank drug-sensitive pieces were soaked with rALF-like protein, clear inhibition zones appeared on the plates coated with the above three bacteria, indicating that rALF-like protein also has a certain antibacterial effect. Figure 10 shown.

[0080] In vitro antibacterial assays using rALF-like proteins have shown that rALF-like proteins specifically bind to bacterial lipopolysaccharide (LPS) through their LBD domain, preventing LPS from binding to host cell receptors and thereby inhibiting the initiation of inflammatory responses. This neutralization mechanism effectively reduces LPS-induced inflammation and tissue damage, achieving an antibacterial effect. In fact, the fundamental mechanism of this antibacterial effect is that the LBD domain of the prokaryotic protein rALF-like binds to bacterial lipopolysaccharide (LPS), preventing LPS from binding to host cell receptors, thereby generating a neutralization reaction.

[0081] In summary, the above experiments revealed that we have isolated a secreted ALF-like molecule with antiviral and antibacterial properties from Litopenaeus vannamei. We obtained the rALF-like protein through prokaryotic expression and verified its properties, including competitive binding with LPS and PGN in bacteria. In vitro, the rALF-like protein specifically binds to bacterial lipopolysaccharide (LPS) through its LBD domain, preventing LPS from binding to host cell receptors, thereby inhibiting the initiation of inflammatory responses. The rALF-like protein also exhibits antiviral activity (WSSV). This invention provides practical application value for the prevention and control of shrimp pathogens, treatment, and the development of antibacterial products for healthy shrimp farming, and also has important practical significance for feed additives.

[0082] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. An anti-lipopolysaccharide factor rALF-like protein, characterized in that The amino acid sequence of the anti-lipopolysaccharide factor rALF-like protein is shown in SEQ ID No.

3.

2. The gene encoding the anti-lipopolysaccharide factor rALF-like protein according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID No.

1.

3. Use of the anti-lipopolysaccharide factor rALF-like protein according to claim 1 in the preparation of antiviral and / or antibacterial biological preparations or medicines.

4. The use according to claim 3, characterized in that The anti-lipopolysaccharide factor rALF-like protein is a secretory protein.

5. The use according to claim 3, characterized in that The applied population includes Litopenaeus vannamei.

6. The use according to claim 3, characterized in that Such viruses include white spot syndrome virus.

7. The use according to claim 3, characterized in that The bacteria include at least one of Staphylococcus aureus, Escherichia coli, and Vibrio parahaemolyticus.

8. The use according to claim 3, characterized in that The vannamei shrimp can induce Pv-ALF-like gene expression under virus and / or bacterial infection, and shows significant upregulation in blood cells, hepatopancreas, gills and intestinal tissues.

9. The use according to claim 3, characterized in that The anti-lipopolysaccharide factor rALF-like protein specifically binds to bacterial lipopolysaccharide LPS through its LBD domain, preventing LPS from binding to host cell receptors, thereby inhibiting inflammation.

Citation Information

Patent Citations

  • Marker gene composition for identifying and diagnosing white feces syndrome of prawns and application of marker gene composition

    CN120210350A

Cited By

  • Portunus trituberculatus anti-lipopolysaccharide factor coding gene PtALF-7 as well as protein and application thereof

    CN121362761A