Method for increasing the number of passages of a mammary epithelial cell line and use thereof

By introducing vectors containing HS4-SAR and MAR2 fragments into breast epithelial cell lines, the problem of limited passage times in breast epithelial cell lines has been solved, achieving efficient passage while maintaining stable gene expression, making it suitable for research and application of breast epithelial cell lines.

CN119876039BActive Publication Date: 2026-01-02NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510085252.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2026-01-02
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

After 50-60 passages, mammary epithelial cell lines exhibit decreased transgene expression levels and transgene silencing, limiting their passage number and use.

Method used

After ligating the HS4-SAR and MAR2 fragments into the target gene, they were transfected into mammary epithelial cells. Infection and selection were carried out using vectors containing HS4-SAR and MAR2 fragments, such as p-Ef1a-SV40LT-Puro or pEF1a-eGFP, to increase the number of cell passages.

Benefits of technology

The passage number of mammary epithelial cell lines was significantly increased. After 120 passages, the cells had normal morphology and gene expression levels were not reduced, achieving immortalization and efficacy. The established dairy goat mammary epithelial cell lines still have the ability to synthesize and secrete proteins, reducing the cost of cell research.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876039B_ABST
    Figure CN119876039B_ABST
Patent Text Reader

Abstract

The application discloses a method for improving the passaging times of a mammary epithelial cell line and application thereof, and belongs to the technical field of mammary epithelial cell lines. The application first finds that the exogenous fragment HS4-SAR fragment in the attachment area of the insulator-scaffold is connected with a p-Ef1a-SV40LT-Puro vector or a pEF1a-eGFP vector, and the transfection of commercial immortalized cell lines and primary cell lines can significantly improve the passaging times of the mammary epithelial cell lines, the cell morphology is still normal after 120 generations, the malignant transformation does not occur, the gene expression level does not decrease, and the immortalization is realized; the established goat mammary epithelial cell line still has the ability of synthesizing and secreting proteins; the method for improving the passaging times of the mammary epithelial cell line is simple and easy to operate, has a significant effect on the immortalized cell lines and the primary cell lines, and is expected to improve the stable passaging times of various mammary epithelial cell lines, and reduce the cell cost of related research.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of breast epithelial cell lines, and in particular to a method for increasing the number of passages of a breast epithelial cell line and its application. BACKGROUND

[0002] Breast epithelial cell lines refer to epithelial cells isolated and cultured from breast tissue, which can survive and proliferate in vitro for a long time. According to their source and characteristics, breast epithelial cell lines can be divided into two categories: primary cell lines and immortalized cell lines.

[0003] Primary cell lines refer to epithelial cells isolated directly from normal or diseased (such as tumor) breast tissue, which have similar biological characteristics to in vivo; the number of passages is limited, and the proliferation ability, differentiation or aging phenomenon usually occurs at about 10-20 passages; due to its closer to the real situation in vivo, it is suitable for studying normal physiological functions or early pathological processes.

[0004] Immortalized cell lines refer to cell lines modified by genes (such as introduction of SV40 large T antigen, hTERT, etc.) or isolated from tumor tissue, which can be passed indefinitely, maintain stable proliferation ability and morphological characteristics, and after genetic modification, some cell lines may lose part of the original characteristics, but still retain important pathological features. Common immortalized cell lines include MCF-7, MDA-MB-231, SK-BR-3, etc. These cell lines are widely used in breast cancer research, drug screening and development, regenerative medicine research, toxicology research, etc.

[0005] However, breast epithelial cell lines often encounter the phenomenon of reduced transgene expression level and transgene silencing, for example, Chinese invention (publication number CN 111154807A) discloses that the cell state of the 50th generation of breast epithelial cell line is not good, and the green fluorescence is not expressed at the 60th generation. Because the green fluorescence is expressed by fusion with the SV40LT gene, therefore, the SV40LT is silenced at the 60th generation. Gene silencing limits the number of passages and use of breast epithelial cell lines. Chromatin insulators and scaffold / matrix attachment regions have been integrated into CHO cells alone or in combination to improve transgene expression levels and reduce silencing. SUMMARY

[0006] The purpose of the present application is to provide a method for increasing the number of passages of a breast epithelial cell line and its application, to solve the current phenomenon of reduced transgene expression level and transgene silencing at 50-60 passages of a breast epithelial cell line, and to provide a method for significantly increasing the number of stable passages of a breast epithelial cell line.

[0007] To achieve the above object, the application provides application of HS4-SAR and MAR2 fragments in increasing the passage number of mammary epithelial cell lines, and the HS4-SAR and MAR2 fragments are connected to target genes respectively, and then the mammary epithelial cells are transferred into the mammary epithelial cells for conventional culture.

[0008] Preferably, the target gene is one of an SV40 large T antigen gene and an immortalization gene; the immortalization gene includes a telomerase TERT, a T antigen of SV40, a proto-oncogene and a tumor suppressor gene.

[0009] The application also provides application of a vector containing the HS4-SAR and MAR2 fragments in increasing the passage number of mammary epithelial cell lines, and the vector is one of a p-Ef1a-SV40LT-Puro vector and a pEF1a-eGFP vector.

[0010] Preferably, the construction method of the pEF1a-eGFP vector is as follows: taking a vector ROSA26-E F1a-Nramp1 donor as a template, taking EF-1a-egfp-F and EF-1a-egfp-R as primers, and taking Takara high-fidelity enzyme HSDNA Polymerase to prepare a reaction system according to the instructions of the enzyme, and the reaction procedure is as follows: 98 DEG C pre-denaturation for 3 minutes; 98 DEG C denaturation for 10 seconds, 60 DEG C annealing for 15 seconds, 72 DEG C extension for 3 minutes, 35 cycles; and 72 DEG C complete extension for 10 minutes.

[0011] Preferably, the sequence of the EF-1a-egfp-F is as shown in SEQ ID NO. 5, and the sequence of the EF-1a-egfp-R is as shown in SEQ ID NO. 6.

[0012] Preferably, the construction method of the p-Ef1a-SV40LT-Puro vector is as follows: taking Ef1a_Large T-antigen_Puro as a skeleton vector, and adopting NheI enzyme cutting, and recovering a 11672Bp target fragment after electrophoresis.

[0013] The application also provides a method for increasing the passage number of mammary epithelial cell lines, and the method comprises the following steps: wrapping the p-Ef1a-SV40LT-Puro vector containing the HS4-SAR fragment in a slow virus to obtain a slow virus particle, and then infecting mammary epithelial cells with the slow virus particle; adding 1ug / mL Puromycin into a culture solution for screening for 7 to 10 days, until a needle-point-sized cell clone can be observed in a cell culture dish, and then obtaining positive cells; and performing conventional culture and passage of the positive cells.

[0014] ​Preferably, the lentivirus particles are mixed with fresh DMEM / F12 culture solution at the same volume and added into the cell culture dish at the time of infection, and 8 μg / mL of polybrene is added to enhance the infection ability of the virus.

[0015] Preferably, the lentivirus particles are obtained by co-transfecting 293T cells with p-Ef1a-SV40LT-Puro vector containing HS4-SAR or MAR2 fragment as a lentivirus vector, and psPAX2 and pMD2.G as auxiliary packaging vectors.

[0016] A mammary epithelial cell line obtained by the method for increasing the number of passages of a mammary epithelial cell line.

[0017] Therefore, the present application provides a method for increasing the number of passages of a mammary epithelial cell line and its application, and the specific technical effects are as follows:

[0018] (1) The present application first found that the exogenous fragment HS4-SAR fragment of the insulator-scaffold attachment region was connected with p-Ef1a-SV40LT-Puro vector or pEF1a-eGFP vector, and transfected commercial immortalized cell lines and primary cell lines, which can significantly increase the number of passages of mammary epithelial cell lines, and the cell morphology is still normal, not malignant transformation, and the gene expression level is still not reduced, which realizes the immortalization.

[0019] (2) The expression amount of milk goat mammary epithelial cell line lactoprotein related genes built by the method provided by the present application is significantly higher than that of the control cell line, which indicates that the built milk goat mammary epithelial cell line still has the ability to synthesize and secrete proteins;

[0020] (3) The method for increasing the number of passages of a mammary epithelial cell line provided by the present application is simple and easy to operate, and has a significant effect on immortalized cell lines and primary cell lines, which is expected to increase the number of stable passages of various mammary epithelial cell lines and reduce the cell cost of related research. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the description of the embodiments of the present application will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0022] Figure 1is a structural diagram of pEF1a-eGFP, pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, pEF1a-eGFP-HS4-SAR vector in the embodiment one of the present application;

[0023] Figure 2 is inverted fluorescence microscope observation results (a), transfection efficiency statistical results (b), and relative expression amount statistical results (c) of different groups of cells transfected for 48h in the embodiment one of the present application;

[0024] Figure 3 is inverted fluorescence microscope observation results (A), fluorescence protein MFI graph (B), MFI column chart (C), and MFI fold column chart (D) of different groups of cells transfected for 14 days in the embodiment one of the present application;

[0025] Figure 4 is inverted fluorescence microscope observation results (A), fluorescence protein MFI graph (B), MFI column chart (C), and MFI fold column chart (D) of different groups of cells transfected for 60 days and 90 days in the embodiment one of the present application;

[0026] Figure 5 is a structural diagram of p-Ef1a-SV40LT-Puro vector in the embodiment two of the present application;

[0027] Figure 6 is a structural diagram of p-Ef1a-SV40LT-Puro-HS4 vector in the embodiment two of the present application;

[0028] Figure 7 is inverted fluorescence microscope observation results of breast epithelial cell identification in the embodiment three of the present application; part A is a bright field image of primary cells, and part B is an immunofluorescence staining identification image of primary cells CK-18;

[0029] Figure 8 is inverted fluorescence microscope observation results of different passage numbers in the embodiment three of the present application; the scale in the figure is 200μm;

[0030] Figure 9 is cell malignant transformation investigation results of transfected p-Ef1a-SV40LT-Puro-HS4 in the embodiment three of the present application;

[0031] Figure 10 is karyotype analysis results of transfected p-Ef1a-SV40LT-Puro-HS4 in the embodiment three of the present application;

[0032] Figure 11is the cell senescence detection result of the cell transfected with p-Ef1a-SV40LT-Puro-HS4 in Example Three of the present application; wherein Part A is the β-galactosidase staining diagram of primary mammary epithelial cells F8, and Part B is the β-galactosidase staining diagram of immortalized mammary epithelial cells;

[0033] Figure 12 is the oil red O detection result of the cell transfected with p-Ef1a-SV40LT-Puro-HS4 in Example Three of the present application; wherein Part A is the 40x oil red O staining result diagram, and Part B is the 100x oil red O staining result diagram;

[0034] Figure 13 is the relative expression amount of milk protein related genes of the cell transfected with p-Ef1a-SV40LT-Puro-HS4 in Example Four of the present application. DETAILED DESCRIPTION

[0035] The technical solutions of the present application are further described below by means of the accompanying drawings and examples.

[0036] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely by means of the accompanying drawings and examples. The following detailed description is the description of examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0037] The instrument equipment and reagent materials used in the examples are obtained through commercial channels. The method steps not described in detail in the examples are conventional technical means in the art.

[0038] Example One

[0039] The best fragment is screened, and the specific steps are as follows:

[0040] S11, send the sequence information of MAR2 (the sequence is shown as SEQ ID NO. 1) and HS4-SAR (the sequence is shown as SEQ ID NO. 2) to a biological company, respectively synthesize plasmids containing MAR2 and HS4-SAR fragments, and respectively name them as T-MAR2 and T-HS4-SAR.

[0041] SEQ ID NO. 1:

[0042] TATACGTGAATAGTTTTTCTTCCCTCTGTGTGTTTTAAAATAGTTACTAATGCTTTCTTGGATCTGCATTTAGGAGTTATCCTTTCCATTAAAAATATAAGCTGTTTCTTCCAAGGCGACTCCTGGGCGTGGAGCCTACCCTGGGGTATGGTTGATAAACACAGTGTCACTGTACATTGTTAGTTATAAATTATATAACTAATTTTAATTATAAAATTAACACTAATTATAATAGCATTATTAATGAAATTAACATTGATTATAATAAAACAACATTAATAATAAAATTAACATTGTAGACACTGGCTTGGAGTGCTATTAACCAAAACAGGCTGAGTGCCATTATTAGCAACAAGAGGCAAGATGATTTCCCTGCTTACAGAGAAATGGGGGCATTTTTAGGTAATGACAGAGTAATAGGTGTACTGATGGGGTAGGAGACATGGCTCAACAGTTAAGCTCTTGCTACACAGTTATTAGGACCGATTCAGATCCTAGCACCCACATAAAAGCAAAAAGGGCATCCTGTGAACTTCTCAGTTCCAACTC

[0043] SEQ ID NO. 2:

[0044]

[0045] S12, hu-MAR-F (sequence as shown in SEQ ID NO. 3) and hu-MAR-R (sequence as shown in SEQ ID NO. 4) as primers, according to the instructions of Takara high-fidelity enzyme HSDNA Polymerase enzyme to construct the reaction system, PCR amplification, PCR amplification conditions are 98℃ pre-denaturation 3min; 98℃ denaturation 10s, 60℃ annealing 15s, 72℃ extension 1min30s, 35 cycles; 72℃ complete extension 10min, purification of PCR product hu-MAR fragment (hu-MAR) is obtained.

[0046] SEQ ID NO. 3: GTCGACGGATCCCATTCTCCTTGATG

[0047] SEQ ID NO. 4: GTCGACGAATTCAAACAACTCAATAGCAAG

[0048] S13, MAR2, HS4-SAR and hu-MAR fragment homologous recombination to the downstream region of pEF1a-eGFP, the specific steps are as follows:

[0049] ROSA26-EF1a-Nramp1 donor (construction method see Yuan Mengke's doctoral dissertation of Northwest A&F University "Research on optimization and improvement of disease-resistant clone cattle gene editing efficiency based on CRISPR / Cas9 system") as a template, EF-1a-egfp-F (sequence as shown in SEQ ID NO. 5) and EF-1a-egfp-R (sequence as shown in SEQ ID NO. 6) as primers, according to the instructions of Takara high-fidelity enzyme HSDNA Polymerase enzyme to construct the reaction system, PCR amplification, amplification program is 98℃ pre-denaturation 3min; 98℃ denaturation 10s, 60℃ annealing 15s, 72℃ extension 3min, 35 cycles; 72℃ complete extension 10min. Add equal volume of ordinary Taq enzyme to extend for 20min again, agarose gel electrophoresis is carried out on the amplification product, the gel is recovered 2885bp fragment, connected to T-Vector pMD TM 19(Simple) as pEF1a-eGFP.

[0050] SEQ ID NO. 5: AAGCTTGCTCCGGTGCCCGTCAGTG

[0051] SEQ ID NO. 6: GTCGACTAAGATACATTGATGAGTTTGGAC

[0052] The T-MAR2, T-HS4-SAR obtained in step S11, and the hu-MAR obtained in step S12 are used as templates to design homologous recombination primers for PCR amplification. The homologous recombination primers are MAR2-F (the sequence is shown in SEQ ID NO. 7), MAR2-R (the sequence is shown in SEQ ID NO. 8), hu-MAR-F (the sequence is shown in SEQ ID NO. 9), hu-MAR-R (the sequence is shown in SEQ ID NO. 10), HS4-SAR-F (the sequence is shown in SEQ ID NO. 11), and HS4-SAR-R (the sequence is shown in SEQ ID NO. 12).

[0053] SEQ ID NO. 7: atcaatgtatcttagtcgacTATACGTGAATAGTTTTTCTTCCCT

[0054] SEQ ID NO. 8: gccgttcgacgattgtcgacGAGTTGGAACTGAGAAGTTCACA

[0055] SEQ ID NO. 9: atcaatgtatcttagtcgacGGATCCCATTCTCCTTGATGTA

[0056] SEQ ID NO. 10: gccgttcgacgattgtcgacGAATTCAAACAACTCAATAGCAAGA

[0057] SEQ ID NO. 11: atcaatgtatcttagtcgacCGGGGACAGCCCCC

[0058] SEQ ID NO. 12: gccgttcgacgattgtcgacGAATATATCTTATTTTAAAATCAGT

[0059] The reaction system is prepared according to the instructions of Takara high-fidelity enzyme HSDNA Polymerase enzyme, and PCR amplification is performed. The amplification procedure is 98°C pre-denaturation for 3 minutes; 98°C denaturation for 10 seconds, 60°C annealing for 15 seconds, 72°C extension for 1 minute and 30 seconds, 35 cycles; and 72°C complete extension for 10 minutes. The MAR2 fragment (589 bp), the hu-MAR2 fragment (1273 bp), and the HS4-SAR fragment (1050 bp) are recovered by gel.

[0060] The pEF1a-eGFP is digested by SalI enzyme, and a 5579 bp fragment is recovered by gel. The recovered fragment is connected with the recovered MAR2, hu-MAR2, and HS4-SAR fragments, respectively, to obtain the pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR2, and pEF1a-eGFP-HS4-SAR. -Basic Seamless Cloning and Assembly Kit homologous recombination kit, the recovered MAR2 fragment, hu-MAR2 fragment and HS4-SAR fragment were respectively connected with pEF1a-eGFP, and the correctly connected vectors were respectively named as pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, pEF1a-eGFP-HS4-SAR (the obtained recombination vector structure is shown in Figure 1 ).

[0061] S14, after resuscitating the MAC-T cells, the cells were cultured at 37℃, 5% CO2 to a cell confluence of 80%.

[0062] According to the instructions of Lipofectamine TM 3000 transfection reagent (Invitrogen, Carlsbad, CA, USA), 15 μL of Lipofectamine 3000 and 10 μL of P3000 transfection reagent were added to 5 μg of vector, and then the mixture containing pEF1a-eGFP-MAR2, pEF1a-eGFP-hu-MAR, pEF1a-eGFP-HS4-SAR or pEF1a-eGFP vector was added to the cell dish with a confluence of 80%, and then the cells were transfected at 37℃, 5% CO2 for 48 hours. After that, inverted fluorescence microscope was used for observation, and the results are shown in Figure 2 , the cells were collected, and 3 repeats were used for flow cytometry analysis of eGFP expression transfection efficiency Figure 2 (B) and fluorescence protein expression Figure 2 (C). The results showed that the transfection efficiency of pEF1a-eGFP-hu-MAR and the expression of fluorescence protein were significantly different from the control group, and the other two groups had no significant difference from the control group.

[0063] S15, 1 μg·mL -1 PURO was added to the cells after transfection for 48 hours to screen the cells transfected with the vector and kill the cells not transfected with the vector. About 1 week after transfection, stable transfection cell colonies were formed, and the control group not transfected with plasmid was all dead. Then the cells were cultured in DMEM / F12 medium containing 0.5 μg·mL -1 PURO and DMEM / F12 medium without PURO, and the medium was replaced every 2-3 days. The cells were photographed under an inverted fluorescence microscope on the 14th day after transfection, and the cells were collected for flow cytometry analysis of eGFP expression. The expression level of eGFP was determined by measuring MFI. The results are shown in Figure 3The results showed that the cells containing hu-MAR and HS4-SAR fragment stably transfected cells could slightly improve the expression of fluorescent protein relative to the control group, but the difference was not significant.

[0064] The passage culture was continued, and inverted fluorescence microscope observation was performed at 60 days and 90 days after transfection, and the results are shown in Figure 4 , wherein part A is the fluorescence image of the 60th day and 90th day after transfection without puro or containing 0.5 ug / ml puro, part B is the MFI graph, part C is the column chart of MFI, and part D is the retention rate of fluorescent protein expression intensity. The results showed that although the MFI and fluorescent protein expression intensity of the cells containing MAR2 fragment containing 0.5 ug / mL puro at 90 days were significantly higher than those of the pEF1a-eGFP group, the MFI and fluorescent protein expression intensity of the cells containing HS4-SAR fragment at 60 days and 90 days were significantly higher than those of the pEF1a-eGFP group. Therefore, the HS4-SAR fragment was selected for subsequent experiments.

[0065] Example Two

[0066] The immortalized lentivirus plasmid containing the HS4-SAR fragment was constructed, and the specific steps were as follows:

[0067] S21, using Ef1a_Large T-antigen_Puro as the backbone vector, cutting with NheI enzyme, and recovering the target fragment (11672bp) after electrophoresis, named p-Ef1a-SV40LT-Puro (the vector structure is shown in Figure 5 ).

[0068] S22, amplification of HS4-SAR fragment. Using T-HS4-SAR synthesized by the company as the template, and HS4-SAR-F (the sequence is shown in SEQ ID NO. 13) and HS4-SAR-R (the sequence is shown in SEQ ID NO. 14) as primers for PCR amplification, and recovering the target fragment after electrophoresis.

[0069] SEQ ID NO. 13: atacgaagttatcggctagcCGGGGACAGCCCCC

[0070] SEQ ID NO. 14: tacagtccggaccagctagcGAATATATCTTATTTTAAAATCAGT

[0071] S23, the p-Efla-SV40LT-Puro obtained in step S21 and the glue recovery product obtained in S22 are connected by using the homologous recombination kit of full formula gold, and the recombinant vector is named as p-Efla-SV40LT-Puro-HS4 (the structure of the vector is as shown in Figure 6

[0072] Example Three

[0073] The effect of the HS4 fragment on the passage number and state of the Saanen dairy goat mammary epithelial cell line was investigated, and the specific steps were as follows:

[0074] S31, the Saanen dairy goat mammary epithelial cells were obtained by the tissue adhesion method.

[0075] The steps for obtaining the Saanen dairy goat mammary epithelial cells were as follows: ① A lactating dairy goat was taken from the cloned goat base of Northwest A&F University, the skin of the udder was cut with a blade, the udder was cut, the mammary gland tissue in the middle of the size of a fingernail and the bottom of the udder was taken, and was placed in a 6 cm diameter dish. After washing with twice the amount of antibiotic physiological saline, the milk was squeezed into the dish and poured into iodophor, and was moved to the operation table. ② Put into PBS containing antibiotics, and wash off the milk by squeezing. Wash until the eluent is free of milk. Use forceps to pick up the mammary gland tissue, and you can see small particles. Cut the small particles and place them in the center of a 24-well plate. ③ After about 7 days, cells can be seen migrating out. When the cells fill the field of view under low magnification, add trypsin for digestion and passaging.

[0076] S32, mammary epithelial cell identification.

[0077] Discard the culture medium, wash with 1 mL of PBS for 3 times, 5 min each time; add 500 μL of 4% paraformaldehyde to each well for fixation for 15 min; wash with PBS for 3 times, 3 min each time; add 0.1% Triton X-100 (dissolved in PBS, concentration is 100 μL / 10 mL) to each well, penetrate for 10 min at room temperature; wash with 0.1% Triton X-100 and PBS for 2 times, 5 min each time; block with 5% (0.5 g / 10 mL, dissolved in PBS) skimmed milk powder at room temperature for 1 h; discard the blocking solution, wash with PBS for 2 times, 3 min each time; dilute CK-18 primary antibody (1:100) in primary antibody diluent, add 300 μL to each well, and incubate at 4°C overnight (more than 18 h); wash with PBS for 5 times, 3 min each time; dilute the fluorescently labeled Alexa Fluor 488 labeled goat anti-mouse IgG (H+L) secondary antibody in PBS according to 1:500, add 300 μL to each well, and incubate at room temperature for 1-2 h in the dark; wash with PBS for 3 times, 5 min each time; add 300 μL of DAPI (0.01%) to each well, and incubate at room temperature for 3 min; wash with PBS for 3 times, 5 min each time; then observe under an inverted fluorescence microscope, and the results are as shown in Figure 7 ​As shown, the migrated cells were stained with CK-18, indicating that the separated cells were pure mammary epithelial cells and could be used for subsequent immortalization cell construction.

[0078] S33, p-Ef1a-SV40LT-Puro and p-Ef1a-SV40LT-Puro-HS4 constructed in Example Two were used as lentivirus vectors, and psPAX2 and pMD2.G were used as auxiliary packaging vectors, and 293T cells were co-transfected to obtain lentivirus particles.

[0079] The specific steps for obtaining lentivirus particles were as follows: p-Ef1a-SV40LT-Puro / p-Ef1a-SV40LT-Puro-HS4 recombinant expression vectors, packaging vectors psPAX2 and pMD2.G were co-transfected into HEK-293T cells, and the transfection ratio of the three vectors was p-Ef1a-SV40LT-Puro: psPAX2: pMD2.G = 4:3:1. The specific transfection steps were referred to the Lipofectamine 2000 liposome transfection reagent instruction. After 8 hours of transfection, fresh DMEM culture solution was replaced, and the cells were cultured in a 37°C 5% CO2 incubator for 48 hours. After the culture solution turned orange yellow, the culture supernatant was collected, centrifuged at 1500 rpm for 5 minutes to remove excess cell debris in the culture solution, and then filtered with a 0.45 μm filter. The lentivirus was concentrated, and stored at -80°C after long-term storage. Do not freeze-thaw repeatedly to reduce the virus titer and affect the infection efficiency.

[0080] S34, when the density of the digested Saanen goat mammary epithelial cells in step S31 reached 60-70%, the lentivirus particles obtained in step S33 were used for infection:

[0081] ①The virus supernatant was mixed with an equal volume of fresh DMEM / F12 culture solution, and 8 μg / mL of polybrene was added to enhance the infection ability of the virus. After 24 hours of culture at 37°C in a 5% CO2 incubator, the culture supernatant containing the virus was discarded. The cells were gently rinsed twice with PBS, and fresh DMEM / F12 culture solution was added. The cells were cultured at 37°C in a 5% CO2 incubator for subsequent experiments. ②If the cell density is too high after the medium is changed, the cells need to be passaged. After 72 hours of infection, 1 μg / mL of Puromycin was added to the culture solution for 7 to 10 days, until cell clones of pinhead size were observed in the cell culture dish, and positive cells were obtained.

[0082] The positive cells were routinely subcultured, and the 10th passage (F10), 20th passage (F20), 30th passage (F30), 40th passage (F40), 50th passage (F50), 60th passage (F60), and 70th passage (F70) were observed under an inverted fluorescence microscope, and the results are shown in Figure 8 Fig. 2. The cell morphology of the breast epithelial cell line without HS4 changed at the 40th passage, and the cells grew very slowly at the 60th passage. However, the cell morphology of the cell line containing the HS4-SAR fragment remained stable at the 120th passage.

[0083] S35, malignant transformation (soft agar) of the cells transfected with p-Ef1a-SV40LT-Puro-HS4 was detected, and HELA cells and the cells subcultured for 100 passages in step S31 were used as controls. The specific steps are as follows:

[0084] Two concentrations of 1.2% and 0.7% agarose solutions were prepared using ultrapure water. The cells in the logarithmic phase were trypsinized and centrifuged, and then resuspended into single cells with 2x DMEM / F12 culture solution. The cells were counted and the cell density was adjusted to 1000 cells / mL with DME / F12 cell culture solution. The cell suspension and the 0.7% agarose solution were mixed in equal proportions, and 200 μL was taken and placed in a cell culture dish with a 1.2% agarose bottom layer to form a double agar layer. The culture was incubated in a 37°C, 5% CO2 incubator. After two weeks, the clone formation was observed under a microscope, and then 0.005% crystal violet was added for staining for 30 min, and the cells were photographed under a microscope.

[0085] The results are shown in Figure 9 Fig. 3. HELA is a cancer cell and has tumorigenicity, and is used as a positive control. The primary GMECs are normal cells and do not have tumorigenicity, and are used as a negative control. The constructed breast epithelial cell line also does not form colonies, indicating that the cell line has not been malignant transformed.

[0086] S36, karyotype analysis of the cells transfected with p-Ef1a-SV40LT-Puro-HS4: the DNA content is indicated by the DNA index. The cells to be tested (immortalized breast epithelial cell line) and the internal reference cells (normal breast epithelial cell line) were collected and fixed with ice-cold 70% ethanol. PI staining solution was used for staining. The stained cells to be tested were divided into two equal parts and mixed with the internal reference cells that had been subjected to the same staining treatment in a ratio of 1:1. Flow cytometry was used to analyze 20,000 cells for each sample.

[0087] The results are shown in Figure 10 Fig. 4. The immortalized breast epithelial cell line is a non-integer multiple cell, which is consistent with the results of previous immortalization of cells using SV40 large T antigen transfection or infection, and is a normal phenomenon.

[0088] S37, carry out senescence detection on the cells transfected with p-Ef1a-SV40LT-Puro-HS4, and take the cells after digestion in step S31 and passaged for 8 generations (primary F8) as a control, and the specific steps are as follows:

[0089] The cell senescence β-galactosidase staining kit of Biyun Tian Company is used; the operation steps are as follows: for the cells cultured in a 6-well plate, the cell culture solution is aspirated, washed once with PBS, 1 mL of β-galactosidase staining fixing solution is added, and fixed at room temperature for 15 min; the cell fixing solution is aspirated, and the cells are washed with PBS for 3 times, each time for 3 min; the PBS is aspirated, and 1 mL of staining working solution is added to each hole. The staining working solution is prepared using a 15 mL polypropylene centrifuge tube: 10 μL of β-galactosidase staining solution A, 10 μL of β-galactosidase staining solution B, 930 μL of β-galactosidase staining solution C, and 50 μL of X-Gal solution; incubate at 37°C overnight, and seal the 6-well plate with sealing film to prevent evaporation; observe and take pictures under an inverted fluorescence microscope.

[0090] The results are shown in Figure 11 , a large number of β-gal positive cells appear in primary F8, and almost no β-gal positive cells appear in the cell line transfected with p-Ef1a-SV40LT-Puro-HS4. It is shown that the cell line has overcome replicative senescence and achieved immortalization.

[0091] S38, carry out oil red O detection on the cells transfected with p-Ef1a-SV40LT-Puro-HS4: adopt the oil red O kit of Solibao, and the specific operation steps are as follows:

[0092] Remove the cell culture medium, wash twice with PBS, and fix with oil red O fixing solution for 20-30 min; discard the fixing solution, wash twice with distilled water, and immerse with 60% isopropanol for 20-30 s; after discarding the 60% isopropanol, add the newly prepared oil red O staining solution, and immerse for 10-20 min; discard the staining solution, and rinse with 60% isopropanol for 10-20 s until the interstitium is clear; wash with distilled water for 2-5 times until no excess staining solution is discharged; add distilled water to cover the cells and observe under a microscope. The results are shown in Figure 12 , red lipid droplets of different sizes are diffusely distributed in the cytoplasm, indicating that the immortalized mammary epithelial cell line has lactation function and can be used for related experimental research.

[0093] Example Four

[0094] Investigate the ability of the cell line transfected with p-Ef1a-SV40LT-Puro-HS4 to synthesize and secrete casein, and the specific steps are as follows:

[0095] The Sannen goat mammary epithelial cell line which has been passaged for 100 generations is inoculated into a 6-well plate, and when the cells are about 80-90% confluent, an induction culture solution is added for induction. The induction culture solution contains 5 μg / mL prolactin, 1x ITS, 3 μg / mL hydrocortisone and 10 ng / mL EGF for induction for 48 h. RNA is extracted. The cells without prolactin are used as a control. The expression of milk protein-related genes is detected by qPCR, and the results are shown in Figure 13 As shown in Table 1, the cells are sensitive to prolactin, and the expression of CSN2 in the cells containing prolactin is significantly higher than that in the cells without prolactin.

[0096] Therefore, the present application first found that the exogenous fragment HS4-SAR fragment outside the insulator-scaffold attachment region is connected with a p-Ef1a-SV40LT-Puro vector or a pEF1a-eGFP vector, and transfected into commercial immortalized cell lines and primary cell lines, which can significantly improve the number of passages of the mammary epithelial cell line. The cell morphology is still normal, not malignant transformation, and the gene expression level has not decreased after 120 generations of passage, achieving immortalization. The established goat mammary epithelial cell line still has the ability to synthesize and secrete proteins. The method for improving the number of passages of the mammary epithelial cell line is simple and easy to operate, and has a significant effect on immortalized cell lines and primary cell lines. It is expected to improve the number of stable passages of various mammary epithelial cell lines, and reduce the cost of related research cells.

[0097] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application but not to limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A method of increasing the number of passages of a mammary epithelial cell line, comprising, The recombinant vector p-Ef1a-SV40LT-Puro-HS4 is packaged into a lentivirus particle, and the breast epithelial cells are infected with the lentivirus particle; 1 μg / mL of Puromycin is added to the culture solution for screening for 7-10 days, until a needle-point-sized cell clone can be observed in the cell culture dish, that is, a positive cell is obtained, and the positive cell is routinely cultured and subcultured; The construction method of the recombinant vector p-Ef1a-SV40LT-Puro-HS4 is as follows: S1, taking Ef1a_Large T-antigen_Puro as a skeleton vector, the vector is cut with NheI, and a 11672 bp target fragment is recovered from the gel after electrophoresis, and is named as p-Ef1a-SV40LT-Puro; S2, taking T-HS4-SAR synthesized by the company as a template, and taking HS4-SAR-F and HS4-SAR-R as primers, a PCR amplification is performed, and a target fragment is recovered from the gel after electrophoresis; S3, the p-Ef1a-SV40LT-Puro obtained in S1 and the recovered product obtained in S2 are connected by using a homologous recombination kit to obtain a recombinant vector, which is named as p-Ef1a-SV40LT-Puro-HS4; The sequence of HS4-SAR-F is shown as SEQ ID NO. 13; and the sequence of HS4-SAR-R is shown as SEQ ID NO.

14. The sequence of the HS4-SAR fragment is shown as SEQ ID NO.

2.

2. The method for increasing the number of passages of a mammary epithelial cell line according to claim 1, characterized in that: The lentivirus particle is mixed with fresh DMEM / F12 culture solution in an equal volume at the time of infection, and 8 μg / mL of polybrene is added to the cell culture dish to enhance the infection ability of the virus.

3. The method for increasing the number of passages of a mammary epithelial cell line according to claim 1, wherein, The lentivirus particle is obtained by co-transfecting 293T cells with the recombinant vector p-Ef1a-SV40LT-Puro-HS4 as a lentivirus vector, and psPAX2 and pMD2.G as auxiliary packaging vectors.

4. A mammary epithelial cell line obtained by the method of any one of claims 1 to 3 for increasing the number of passages of a mammary epithelial cell line, characterized in that: The breast epithelial cell line is a cell line transfected with p-Ef1a-SV40LT-Puro-HS4.

Citation Information

Patent Citations

  • Building method of secreting type Laoshan dairy goat mammary gland epithelial cell line

    CN111154807A

  • KR20240095087A