Lehmannia strain hm1 strain and application thereof

Abstract

The present application relates to a strain of reinekeia sp. HM1 and its application, the strain has the preservation number of CGMCC NO.34547. The strain has high-efficiency phosphorus solubilization (the ability of dissolving calcium phytate is more than 1g / L) and polyphosphorus ability, has key phosphorus solubilization and polyphosphorus genes, and participates in double-function phosphorus metabolic cycle. Secondly, the strain carries multiple plant interaction, growth-promoting, high-efficiency soil colonization related functional genes, and the ability of producing IAA is up to 50mg / L, which can significantly improve crop quality. The total phosphorus content of the above-ground part of tobacco and corn treated by HM1 is significantly increased. The fresh weight of the above-ground part of corn, the content of free amino acid and soluble protein in the leaf are improved by treating corn with HM1. The content of free amino acid in fresh leaf of tea tree is significantly improved by treating tea tree with HM1. Therefore, the reinekeia sp. HM1 strain of the present application is a high-efficiency multifunctional strain, which can be widely applied in phosphorus solubilization, polyphosphorus and crop quality improvement.

Description

TECHNICAL FIELD

[0001] The present application relates to a microbial strain, in particular a strain of Rheinheimera HM1 and its application in the fields of environmental phosphorus release, phosphorus accumulation and crop quality improvement. BACKGROUND

[0002] The current balance of phosphorus in the ecosystem faces multiple contradictions, including the contradiction between phosphorus stock and soil phosphorus fixation; the contradiction between resource depletion risk and low phosphorus bioavailability; the contradiction between low crop fertilizer utilization rate and phosphorus loss leading to eutrophication and biodiversity reduction. In the biological mechanism of improving phosphorus availability, phosphorus solubilizing bacteria, as a special kind of microorganism, can convert insoluble inorganic phosphorus or organic phosphorus compounds into soluble phosphate through various mechanisms, thereby alleviating the multiple phosphorus limitation problems existing in the ecosystem to a certain extent. Screening of diverse and efficient phosphorus solubilizing bacteria is a key point for breaking the bottleneck of phosphorus cycle and realizing the sustainable utilization of phosphorus resources.

[0003] In recent years, a large number of studies have found that phosphorus solubilizing bacteria, as an "ecological bridge" connecting insoluble phosphorus pool and biologically available phosphorus, have shown great potential in the fields of agricultural yield increase and environmental remediation. Phosphorus solubilizing bacteria can be used as biofertilizers to improve phosphorus fertilizer utilization rate. For example, microorganisms such as Bacillus spp., Bacillus cereus, Bacillus megaterium and Burkholderia spp. can significantly improve the absorption level of plants to phosphate, thereby effectively promoting crop growth. In summary, phosphorus solubilizing bacteria can help to alleviate the contradiction between the increasing demand of organisms for limited phosphorus resources in the world by improving the utilization efficiency of soil phosphorus, promoting plant growth, improving soil health, and remediating the environment.

[0004] The existing ordinary microbial strains have relatively single function, poor environmental adaptability and limited growth-promoting effect. Ordinary phosphorus solubilizing bacteria can only activate insoluble phosphorus and lack the ability of phosphorus accumulation, which cannot prevent phosphorus loss; and ordinary phosphorus accumulating bacteria lack the ability of phosphorus solubilizing, which cannot release the fixed phosphorus in the soil. At present, the reports of phosphorus solubilizing bacteria are mostly focused on Bacillus and Pseudomonas, while the research on phosphorus accumulating bacteria is mostly focused on Dechloromonas, Tetrasphaera and other related genera. The functions of Rheinheimera are mainly in the fields of group inhibition, efficient denitrification in wastewater treatment and participation in organic pollutant degradation (such as ammonia nitrogen and petroleum hydrocarbons), however, so far, no strain of this genus has been found to have high-efficiency phosphorus solubilizing ability, and no report has been found about the direct correlation between this genus and phosphorus accumulation process. SUMMARY

[0005] The application provides a Rheinheimera sp. HM1, which has multiple functions such as phosphorus solubilization, phosphorus accumulation, efficient soil colonization and improvement of crop quality, and has a wider application in agricultural production.

[0006] The application also provides live bacteria, metabolites or fermentation liquor of the Rheinheimera sp. HM1, and an agriculturally acceptable carrier, and application of the live bacteria, the metabolites or the fermentation liquor or the agriculturally acceptable carrier in water environment or soil phosphorus solubilization, phosphorus accumulation and improvement of crop quality.

[0007] The application also provides live bacteria, metabolites or fermentation liquor of the Rheinheimera sp. HM1, and an agriculturally acceptable carrier, and application of the live bacteria, the metabolites or the fermentation liquor or the agriculturally acceptable carrier in water environment or soil phosphorus solubilization, phosphorus accumulation and improvement of crop quality.

[0008] A microbial preparation, characterized in that the live bacteria, metabolites or fermentation liquor of the Rheinheimera sp. HM1 strain are contained.

[0009] The microbial preparation also comprises an agriculturally acceptable carrier.

[0010] The application of the Rheinheimera sp. HM1 in any of the following aspects comprises activation of inorganic phosphorus or organic phosphorus in water or soil, enrichment, fixation and removal of phosphorus in water or soil, and improvement of total phosphorus content, biomass or amino acid content of crops.

[0011] The crops include tobacco, corn or tea trees, and after treatment of the microbial preparation containing the Rheinheimera sp. HM1 strain, the total phosphorus content of the above-ground parts or the free amino acid content of the leaves is significantly improved.

[0012] The microbial preparation is the live bacteria containing the Rheinheimera sp. HM1 strain, and the crop is a tea tree, and the amino acid content of one bud and two leaves is extremely significantly increased.

[0013] The above-mentioned purposes of the application are achieved by the following technical solutions.

[0014] The application screens the phosphorus-dissolving bacteria existing in the phosphorus-rich sediment by using different carbon sources (soluble starch, glucose and sodium carboxymethyl cellulose), and finds that a Rhine Helmer's bacteria strain HM1 (preserved number CGMCC No. 34547) is isolated from the phosphorus-rich sediment in Hongfeng Lake in Guizhou Province, which has multiple functions such as high-efficiency phosphorus dissolution, phosphorus accumulation, high-efficiency soil colonization and improvement of crop quality. The HM1 has a high phosphorus dissolution amount of 1075.54 mg / L (determined by molybdenum-antimony anti-colorimetry) in the calcium phytate culture medium, which is extremely significantly higher than the phosphorus dissolution amount (about 200 mg / L) of common phosphorus-dissolving bacteria. In the blue-white spot identification experiment of the HM1 on the BCIP phosphorus-limited and phosphorus-excessive solid culture medium, the 5-bromo-4-chloro-3-indoxyl phosphate is hydrolyzed within 48 h to produce 5-bromo-4-chloro-3-indoxyl phosphate dimer particles, so that the cells of the HM1 are dyed blue, which indicates that the strain has a strong phosphorus accumulation capacity. The strain has a good colonization capacity in the soil environment, and the IAA production capacity reaches 51.15 mg / L. The total phosphorus content of the tobacco and corn treated by the HM1 is significantly increased. The fresh weight of the corn, the free amino acid content and the soluble protein content in the leaf are increased. In addition, the amino acid content of the tea tree (Qiancha No. 1 variety) treated by the HM1 is significantly increased from 2.31% of the control group to 2.92% of the treatment group. Illumina genome sequencing reveals that the HM1 contains multiple colonization, phosphorus dissolution, phosphorus accumulation and plant growth promotion and plant resistance induction genes. These evidences all support that the HM1 is indeed a high-efficiency multifunctional strain.

[0015] The HM1 strain of the application is a Rhine Helmer's bacteria which is isolated for the first time and has multiple functions such as high-efficiency phosphorus dissolution, phosphorus accumulation, soil colonization and improvement of crop quality. Therefore, the application of the Rhine Helmer's bacteria HM1 in soil or water environment for phosphorus dissolution, phosphorus accumulation, plant quality improvement, including activation of organic phosphorus in water or soil, enrichment, fixation and removal of phosphorus in water or soil, preparation of phosphorus-dissolving, phosphorus-accumulating and crop quality improving microbial agents for improving the total phosphorus content, biomass or quality-related indexes of crops, should be within the protection scope of the application.

[0016] The application has the following beneficial effects:

[0017] The present application first isolates a multifunctional and efficient strain named Rheinheimera sp. HM1 through systematic screening work. The strain not only has good phosphorus solubilization and polyphosphorus capacity, which is particularly prominent in Rheinheimera genus, but also can significantly promote plant growth and increase the amino acid content of crops. At the same time, the good soil colonization ability of HM1 ensures its effectiveness in the agroecosystem. Therefore, the HM1 strain has great potential as a biological fertilizer in agriculture, which helps to reduce the dependence on chemical fertilizers and alleviate environmental pollution. More importantly, it provides a valuable model strain for studying the dual-function mechanism of phosphorus solubilization and polyphosphorus and the interaction between plants and microorganisms, which shows important value and broad application prospects in both basic research and application development.

[0018] The preservation information of Rheinheimera sp. HM1 is as follows:

[0019] The strain classification name is Rheinheimera sp.

[0020] The strain preservation number is CGMCC No. 34547

[0021] The preservation address is No. 3, Yihuangbeili, Xizhimenwai Street, Beijing, China, China General Microbiological Culture Collection Center

[0022] The preservation date is May 14, 2025 BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is the morphological diagram of HM1 strain under organic phosphorus solid culture medium.

[0024] Figure 2 is the phylogenetic tree comparison diagram of HM1 strain.

[0025] Figure 3 is the polyphosphorus capacity identification diagram of HM1 strain. DC1-55 is a polyphosphorus strain as a positive control. DC1-76 is a non-polyphosphorus strain as a negative control.

[0026] Figure 4 is the phenotype diagram of tobacco and corn treated by HM1 strain.

[0027] Figure 5 is the amino acid content of tea tree bud leaves treated by HM1 strain. DETAILED DESCRIPTION

[0028] The present application will be further described below in combination with specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0029] Unless otherwise indicated, the reagents and materials used in the following examples are commercially available.

[0030] The medium formula used in the following examples of the present application is as follows:

[0031] LB medium: 5 g / L yeast extract, 10 g / L sodium chloride and 10 g / L tryptone, pH 7.0-7.5.

[0032] Egg yolk insoluble organic phosphorus medium: 10 g / L glucose, 0.03 g / L FeSO4·7H2O, 0.03 g / L MnSO4·4H2O, 0.3 g / L MgSO4·7H2O, 0.3 g / L sodium chloride, 0.3 g / L potassium chloride, 0.5 g / L ammonium sulfate, 16 g / L agar, pH 7.0-7.5, sterilized at 115°C for 20 min. After sterilization and cooling, 20 mg / L egg yolk was added, shaken well and poured into plates. The corresponding liquid medium does not contain agar.

[0033] Calcium phytate insoluble organic phosphorus liquid medium: 18 g / L cellulose, 0.03 g / L FeSO4·7H2O, 0.03 g / L MnSO4·4H2O, 0.3 g / L magnesium sulfate heptahydrate, 0.3 g / L sodium chloride, 0.3 g / L potassium chloride, 1.25 g / L yeast extract, 12.5 g / L calcium phytate, pH 7.0-7.5, sterilized at 115°C for 20 min.

[0034] The preparation of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) solid medium is as follows: First, prepare a glucose-MOPS mixture by accurately weighing 4.186 g of MOPS (3-morpholinopropanesulfonic acid) and 0.3585 g of N-tris(hydroxymethyl)methylglycine, dissolving them in a small amount of deionized water, then adjusting the pH to 7.4 with a KOH (10 mol / L) solution, and finally making up to 22 mL. Then add the following components in order: 0.05 g of glucose, 0.01 mL of trace element mixture, 0.0125 mL of 0.02 mol / L CaCl2·2H2O solution, 0.5 mL of 0.276 mol / L K2SO4 solution, 5 mL of 5 mol / L NaCl solution, 0.105 mL of 2.5 mol / L MgCl2·6H2O solution, 0.5 mL of freshly prepared 0.01% FeSO4 solution, and 2.5 mL of 1.9 mol / L NH4Cl solution. Finally, make up to 50 mL with distilled water and mix well for use.

[0035] The preparation steps of the phosphorus-limited medium are as follows: first, 50 mL of glucose-MOPS mixed solution is measured, 0.0087 g of K2HPO4 and 0.01 g of BCIP are added and stirred to dissolve. Then, 0.1 mL of VB1 aqueous solution with a concentration of 1 g / L is added dropwise, and then the solution is made up to 200 mL with distilled water. During the process of making up, it needs to be operated slowly and stirred in time to ensure that the components are uniformly distributed. Thus, the preparation of the phosphorus-limited medium is completed, the pH is adjusted to 7.2, and 0.22 μm bacterial filter membrane is used for sterile filtration treatment for standby. The preparation method of the phosphorus-excessive medium is the same as that of the phosphorus-limited medium, the only difference is that the amount of K2HPO4 is adjusted to 0.1732 g.

[0036] Example 1: Isolation and identification of Rheinheimera sp. HM1

[0037] (1) Strain isolation: phosphorus-rich sediments were collected from Hongfeng Lake in Guizhou Province, and the optimal dilution concentration of the sediments was determined to be 10 -4 by using the dilution plate method. Further combined with different treatment methods, including shaking culture time, ultrasonic treatment and different carbon sources (soluble starch, glucose and sodium carboxymethyl cellulose), the phosphorus-solubilizing bacteria existing in the phosphorus-rich sediments were screened. Single colonies with phosphorus-solubilizing rings were selected and repeated streaked until the purified single clone strains were obtained. Then they were spotted on egg yolk insoluble phosphorus source medium, and the diameter (D) of the transparent ring of the strain and the diameter (d) of the colony were recorded. The phosphorus solubilization index (PSI = D / d) was used to preliminarily evaluate the phosphorus solubilization ability of the strain. The morphology of HM1 is shown in Figure 1 , and its phosphorus solubilization ring index is 2.05, indicating that the strain has strong phosphorus solubilization ability.

[0038] (2) Strain identification: further PCR amplification of the 16S rDNA gene of the single clone HM1 strain was carried out by using bacterial 16S rDNA universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5-GGCTACCTTGTTACGACTT-3'), and the amplification product was sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequence obtained by sequencing is:

[0039] TCCAGCGGGGTTTTCGGACCTAGCGGCGGACGGGTGAATAATGCGTAGGAAGCTACCCGATAGAGGGGGATACCAGTTGGAAACGAC

[0040] TGTTAATACCGCATAATGTCTACGGACCAAAGTGTGGGACCTTCGGGCCACATGCTATCGGATGCGCCTACGTGGGATTAGCTAGTT

[0041] GGTGGGGTAATGGCTCACCAAGGCGACGATCCCTAGCTGGTTTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACT

[0042] CCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTT

[0043] GTAAAGCACTTTCAGTAGGGAGGAAGGGTGTTGTGTTAATAGCACAGCATTTTGACGTTACCTACAGAAGAAGCACCGGCTAACTCT

[0044] GTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGTTTTTTAAGTCAG

[0045] ATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTGAAACTGGAAAACTAGAGTGTGTGAGAGGGGGGTAGAATTCCAAGTGTAG

[0046] CGGTGAAATGCGTAGAGATTTGGAGGAATACCAGTGGCGAAGGCGGCCCCCTGGCACAACACTGACGCTCAGGTGCGAAAGCGTGGG

[0047] GAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTAGCTGTTCGTGACCTTGTGTCGTGAGTAGCGCAGC

[0048] TAACGCATTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCA

[0049] TGTGGTTTAATTCGACGCAACGCGAAGAACCTTACCTACTCTTGACATCTACAGAAGACTGCAGAGATGCGGTTGTGCCTTCGGGAA

[0050] CTGTAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAACGAGCCGCAAC (SEQ ID NO. 1).

[0051] The 16S rDNA sequence was aligned using the National Center for Biotechnology Information Basic Local Alignment Search Tool (NCBI blast: https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to confirm that HM1 belongs to Rheinheimera. Further combined with the strain genome sequencing results (high-throughput sequencing was entrusted to Shanghai Bioengineering Co., Ltd.), the 16S rDNA sequence (SEQ ID NO. 1) obtained by PCR sequencing and the HM1 genome sequence were aligned, the repeated sequence was selected, and the phylogenetic tree of the HM1 strain was constructed by NCBI and MEGA11, and the results are shown in Figure 2 Finally, it was confirmed that the HM1 strain indeed belongs to Rheinheimera, and was named Rheinheimera HM1. The strain was preserved in the China General Microbiological Culture Collection Center, and the preservation date was May 14, 2025, and the preservation number was CGMCC NO: 34547.

[0052] Example 2: Analysis of phosphorus solubilization, polyphosphorus, high-efficiency soil colonization and crop quality improvement and yield increase ability of HM1

[0053] (1) Analysis of high-efficiency phosphorus solubilization and polyphosphorus ability: the purified HM1 strain was inoculated into LB liquid medium, and cultured at 28°C constant temperature shaker, 200 r / m, to OD 600=1, and then inoculated in egg yolk insoluble phosphorus liquid medium or calcium phytate insoluble phosphorus liquid medium at 5%, and cultured at 28 DEG C for 3 days under 200 r / min, centrifuged at 12000 rpm for 10 min, and the supernatant was used as a blank control, and the soluble phosphorus content was determined by using molybdenum-antimony anti-colorimetric method, and each treatment was set with 3 repetitions. The molybdenum-antimony anti-colorimetric method determines that the phosphorus solubilizing capacity of HM1 for dissolving egg yolk organic phosphorus is about 722.0 mg / L, and the capacity of HM1 for dissolving calcium phytate is about 1075.5 mg / L. The above results show that HM1 has high efficient organic phosphorus solubilizing capacity. It has been shown that polyphosphorus microorganisms can hydrolyze 5-bromo-4-chloro-3-indoxyl phosphate, and the product is a blue compound (5-bromo-4-chloro-3-indoxyl phosphate dimer microparticles), which makes the cell itself dyed blue, and therefore, the strain which can turn blue in BCIP phosphorus limited and phosphorus excessive solid medium is a polyphosphorus bacteria. The present application uses the principle, and through a blue-white spot identification experiment, it is found that HM1 can turn blue in 48 hours in BCIP phosphorus limited solid medium and phosphorus excessive medium, as shown in Figure 1. The above results show that HM1 has both phosphorus solubilizing and polyphosphorus double characteristics. Figure 3

[0054] (2) Analysis of the production capacity of plant growth promoting substance IAA: the HM1 strain is inoculated in LB liquid medium (containing 500 mg / L L-Tryptophan), and three parallel samples are set for each strain, and cultured on a shaker (28 DEG C, 200 r / min) until OD 600 value reaches 1, and then the bacterial suspension is centrifuged at 10,000 r / min for 10 min to separate the supernatant. 1 mL of the supernatant is taken, 1 mL of Salkowski colorimetric solution is added, and after shaking and mixing, it is placed in a dark environment for 30 min of reaction, and then the OD 530 value of the reaction solution is determined, and by comparison with the standard curve, the content of IAA in unit volume of the reaction solution is calculated. It is found by Salkowski colorimetric method that the content of IAA produced by HM1 is about 51.15 mg / L.

[0055] (3) High efficient soil colonization of HM1 and analysis of promoting crop quality: the colonization analysis result shows that the number of bacteria of HM1 can still be maintained at ≥10 5 CFU / g after 50 d of inoculation, which shows that the phosphorus solubilizing bacteria HM1 has good colonization capacity (Table 1). The pot experiment uses the live bacterial suspension of HM1 to treat plants. The preparation of the live bacterial suspension: the HM1 is inoculated in LB liquid medium, cultured at 28 DEG C and 200 r / min until OD 600 value reaches 1, centrifuged at 6000 rpm for 10 min, the supernatant is removed, and then resuspended with sterile water to prepare the live bacterial suspension with OD 600 ​The bacterial suspension was used to treat the tobacco and corn plants. The plants were divided into control and treatment groups. The control group was treated with sterile water, and the treatment group was treated with the bacterial suspension. The total treatment time was 3 times, with an interval of 7 days. The growth and physiological indicators of the plants were measured after 25 days of treatment. The soluble protein was determined using the Gexi Suanmao Brilliant Blue Kit, the amino acid content was determined using the Solebao Hydrated Indanetrione Kit, and the total phosphorus of the plant was determined using the Solebao Tissue Total Phosphorus Kit.

[0056] The experimental data showed that the HM1 live bacterial suspension had significant growth-promoting and quality-improving effects on tobacco, corn, and tea trees. The total phosphorus content of the treated tobacco and corn shoots increased significantly (Table 2), indirectly confirming the phosphorus solubilizing ability of HM1. The tobacco root fresh weight increased significantly, and the corn was superior to the control in terms of plant height, shoot fresh weight, and leaf free amino acid and soluble protein content (Table 2), reflecting its role in promoting the overall growth of crops. In terms of quality, the amino acid content of tea trees (Qiancha No. 1) was significantly improved due to the treatment of HM1 (Table 2). Figure 4 Figure 5 The genomic analysis results provide a molecular-level explanation for these phenotypes: the HM1 strain encodes a large number of phosphorus solubilizing genes (Table 3), phosphorus accumulating genes (Table 4), and gene clusters that promote plant growth, enhance resistance, utilize plant substrates, and achieve effective colonization (Table 5). These evidences collectively indicate that HM1 is a powerful and multifunctional strain with great application potential in phosphorus solubilization, phosphorus accumulation, and crop quality improvement.

[0057] Table 1 Colonization rate of HM1 in soil (10 5 cfu / g)

[0058]

[0059] Table 2 Agronomic traits and physiological indicators of tobacco and corn treated with HM1 strain

[0060]

[0061] The values are represented as mean ± standard deviation (n = 3). * indicates a significant difference between the corresponding control treated with sterile water (P < 0.05, Student's t-test), and ** indicates a highly significant difference between the corresponding control treated with sterile water (P < 0.01, Student's t-test).

[0062] Table 3 Genes related to the organic phosphorus solubilizing properties of HM1

[0063]

[0064]

[0065] ​Table 4 Genes associated with HM1 polyphosphate properties

[0066]

[0067] Table 5 Genes involved in plant-microbe interactions in HM1

[0068]

[0069]

Claims

1. A strain of Alzheimer's disease ( Rheinheimera strain HM1, characterized by: The strain has the accession number CGMCC NO. 34547.

2. A microbial preparation, characterized in that: The product contains live cells or fermentation broth of the Rheinheimer's strain HM1 as described in claim 1.

3. The microbial preparation according to claim 2 further includes an agriculturally acceptable carrier.

4. The use of the Rheinheirose HM1 strain of claim 1 in any of the following aspects, the application being selected from: activation of organic phosphorus in water or soil; increasing the total phosphorus content, biomass or free amino acid content of crops, said crops being tobacco, corn or tea.

5. The application according to claim 4, characterized in that: After the crop was treated with a microbial preparation containing the Rheinheirlella HM1 strain, the total phosphorus content in its aboveground parts and the free amino acid content in its leaves were both increased.

6. The application according to claim 5, characterized in that: The microbial preparation contains live bacteria of the Rheinheiter bacterium HM1 strain, and the crop is a tea plant with increased free amino acid content in its one bud and two leaves.

Images