Tumor immunotherapy method based on Mn-DNA nano vaccine

Abstract

The invention relates to a tumor immunotherapy method based on a Mn-DNA nano vaccine. The invention provides a nano-particle for tumor immunotherapy. The nano-particle comprises metal ions Mn < 2 + >, exogenous dsDNA, antigen peptide and targeting peptide. The invention also provides a method for preparing the nanoparticles, a vaccine or a pharmaceutical composition containing the nanoparticles, application of the nanoparticles and the vaccine or the pharmaceutical composition in tumor immunotherapy, and the like. The nanoparticles can be accurately delivered to antigen presenting cells, so that the antigen presenting cells are promoted to be mature, the antigen presenting capability is enhanced, and the tumor targeting property and the anti-tumor activity are remarkably enhanced. The raw materials used in the invention can be degraded in vivo, and the biosafety is high.

Description

Technical Field

[0001] The present invention belongs to the field of biomaterials science and technology, and specifically relates to a nanoparticle for tumor treatment and its preparation method and application, in particular to a preparation method and application of a nanovaccine based on activating the STING pathway as a therapeutic effect on tumors. Background Art

[0002] Advances in nanotechnology have provided opportunities for the design and development of nanoscale anti-tumor vaccines in medicine. Nanoparticles can enter living cells via endocytosis. Nanovaccines offer key advantages, including adjustable size, high loading capacity, customizable surface chemistry, controlled release, and serum stability. By encapsulating antigens, DNA, or RNA within or attaching them to the vaccine surface through chemical synthesis, and using liposomes, virosomes, and dendrimers as adjuvants, the stability of encapsulated DNA, mRNA, and protein antigens can be improved, while also enhancing their bioavailability by enhancing antigen delivery.

[0003] Metals are important components of various living organisms and are involved in almost all basic life processes. 2+ The immunostimulatory activity of Mn has been observed many times. 2+ It can stimulate the immune response through the cGAS-STING signaling pathway in cells. 2+ It can directly bind to cGAS in cells, increasing cGAS's sensitivity to dsDNA and its enzymatic activity, and promoting the production of the second messenger cGAMP. The supply of dsDNA can come from micronuclei caused by genomic instability and dsDNA in the cytoplasm, escape from the nucleus, mitochondria or lysosomes, or be extracted from surrounding dead cells. 2+ It also enhances the activity of STING by increasing the affinity between cGAMP and STING, thereby enhancing the expression of downstream type I IFN.

[0004] The anti-tumor effects of type I interferons are manifested in two ways. First, type I IFNs can act directly on tumor tissue, blocking tumor cell growth and inducing apoptosis. Second, they also have indirect anti-tumor activity, promoting tumor cell clearance by activating immune cells, thereby preventing tumor metastasis and progression. Within the tumor microenvironment, both dendritic cells and tumor cells produce type I IFNs in response to the cGAS-STING pathway. Upregulated type I IFN expression hinders the progression of early-stage tumor cells. Type I IFNs secreted by tumor cells activate host anti-tumor mechanisms, reducing tumorigenicity and metastasis. Within the tumor microenvironment, damaged DNA from tumor cells and the subsequent cGAMP produced are recognized and taken up by DCs, promoting activation of the cGAS-STING signaling pathway within DCs. The resulting type I IFNs trigger an anti-tumor immune response through the infiltration of immune cells such as T cells and NK cells, further killing tumor cells. Summary of the Invention

[0005] For nanovaccines used for cancer immunity, the use of appropriate immunomodulatory adjuvants and antigens can induce effective and long-lasting adaptive immunity. 2+ The coordination assembly was combined with click chemistry and other reactions to synthesize nano-vaccine particles with simple and economical raw materials, high efficacy and targeting properties, which were successfully applied to the tumor model of living mice.

[0006] In some embodiments, the present invention provides a nanoparticle for tumor immunotherapy, comprising a metal ion Mn 2+ , exogenous dsDNA, antigenic peptides and targeting peptides, for example, it may include antigenic peptide / targeting peptide@Mn-DNA nanoparticles.

[0007] In some embodiments, the nanoparticles have a particle size of 100-250 nm, such as 100, 120, 140, 150, 160, 180, 200, 220, 250 nm, or any range therebetween. In some embodiments, the nanoparticles have a particle size of less than 100 nm or greater than 250 nm, as long as they are suitable for use in tumor immunotherapy.

[0008] In some embodiments, the dsDNA used in the present invention is not particularly limited. Advantageously, it can promote the activation of antigen-presenting cells, such as DCs, and can be appropriately selected by those skilled in the art. In some embodiments, the dsDNA can have a modification, such as a DBCO modification. Preferably, the sequence of one strand of the dsDNA is: TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 1).

[0009] In some embodiments, the antigenic peptide used in the present invention is not particularly limited, and advantageously it can promote the activation of antigen-presenting cells such as DC, and can be appropriately selected by those skilled in the art. In some embodiments, the antigenic peptide includes a non-tumor antigen or a tumor-associated antigen. In some embodiments, the antigenic peptide includes an antigenic peptide derived from a tumor-associated antigen, for example, an antigenic peptide derived from ovarian cancer, lung cancer, gastric cancer, breast cancer, liver cancer, pancreatic cancer, skin cancer, malignant melanoma, head and neck cancer, sarcoma, bile duct cancer, bladder cancer, kidney cancer, colon cancer, placental choriocarcinoma, cervical cancer, testicular cancer, uterine cancer, or leukemia. In some embodiments, the tumor-associated antigenic peptide can be selected from MART-1, Melan-A, gp100, ADAbp, PSA-1, PSA-2, PSA-3, MAGE, GAGE, MUC, CEA, CRC, NY-ESO-1. In some embodiments, the antigenic peptide is an OVA antigenic peptide, which may have a modification, for example, modified with cysteine. In some embodiments, the preferred antigenic peptide sequence is: CSSSIINFEKL (SEQ ID NO: 5).

[0010] In some embodiments, the targeting peptide used in the present invention is not particularly limited. Advantageously, it can target antigen-presenting cells such as DCs, promote the precise delivery of nanoparticles, and significantly enhance tumor targeting and anti-tumor activity. In some embodiments, the targeting peptide is a targeting peptide targeting SRB1, which can be appropriately selected by those skilled in the art based on the target. In some embodiments, the preferred targeting peptide may have modifications, such as cysteine ​​modifications. In some embodiments, the sequence of the preferred targeting peptide is: Ac-FAEKFKEAVKDYFAKFWDGSGC (SEQ ID NO: 6).

[0011] In some embodiments, the present invention provides a vaccine or pharmaceutical composition comprising the nanoparticles described herein. In some embodiments, the vaccine or pharmaceutical composition optionally further comprises an adjuvant or a pharmaceutically acceptable carrier, which can be readily selected by a person skilled in the art. In some embodiments, the nanoparticle vaccine or pharmaceutical composition can be prepared as a kit.

[0012] In some embodiments, the present invention provides a method for preparing nanoparticles, comprising reacting dsDNA with MnCl2 in an aqueous medium. In some embodiments, the weight ratio of the MnCl2 to dsDNA molecules can be 1:4-1:6, preferably 1:5. In some embodiments, the reaction temperature can be 95-100°C, and the reaction time can be 0.8-1.2 hours, for example, 1 hour. In some embodiments, the method comprises cross-linking the dsDNA, the antigenic peptide, and the targeting peptide, and then reacting the cross-linked peptide with MnCl2 in an aqueous medium to produce the nanoparticles.

[0013] In some embodiments, the present invention provides uses of the nanoparticle, vaccine, or pharmaceutical composition, wherein the uses include any one of the following:

[0014] (1) Use in the preparation of tumor therapeutic agents;

[0015] (2) Use in the preparation of drugs for targeted attack on tumors;

[0016] (3) Use in the preparation of drugs for regulating the immunosuppressive microenvironment;

[0017] (4) Use in the preparation of drugs for enhancing the activity of anti-tumor immune pathways;

[0018] (5) Use in the preparation of drugs for enhancing immune stimulation effects;

[0019] (6) Use in the preparation of drugs that promote the activation and maturation of immune cells;

[0020] (7) Use in the preparation of drugs for activating the killing ability of immune cells;

[0021] (8) Use in the preparation of drugs for reducing tumor cells.

[0022] In some embodiments, the tumor includes tumors that can be treated by activating the STING pathway, preferably including breast tumors, colon tumors, gastrointestinal tumors, kidney tumors, lung tumors, liver tumors, ovarian tumors, pancreatic tumors, rectal tumors, stomach tumors, testicular tumors, thymus tumors, cervical tumors, prostate tumors, bladder tumors, skin tumors, nasopharyngeal tumors, esophageal tumors, oral tumors, head and neck tumors, bone tumors, cartilage tumors, muscle tumors, lymph node tumors, bone marrow tumors and brain tumors.

[0023] In some embodiments, the present invention provides a nanoparticle for tumor treatment, which is synthesized based on Mn 2+ and exogenous dsDNA, nanoparticles containing antigenic peptides and targeting peptides.

[0024] In some embodiments, according to the nanoparticles for tumor immunotherapy of the present invention, the particle size of the nanoparticles is 100-250 nm.

[0025] In some embodiments, according to the nanoparticles for tumor immunotherapy of the present invention, the Mn 2+ Derived from MnCl2 solution.

[0026] In some embodiments, according to the nanoparticles for tumor immunotherapy of the present invention, the dsDNA is a DNA chain modified with DBCO, and the sequence is as follows:

[0027] DNA sequences used in the experiment

[0028] name Sequence (5′-3′) a TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 1) b TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA (SEQ ID NO: 2) a-DBCO DBCO-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACAAAAAA (SEQ ID NO: 3) b-DBCO AAAAATGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA-DBCO (SEQ ID NO: 4) a-Cy5 Cy5-TACAGATCTACTAGTGATTCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 1) b-Cy5 Cy5-TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA (SEQ ID NO: 2)

[0029] In some embodiments, according to the nanoparticles for tumor immunotherapy of the present invention, the antigenic peptide is a short OVA antigen peptide modified with cysteine, and the sequence is: CSSSIINFEKL (SEQ ID NO: 5).

[0030] In some embodiments, according to the nanoparticles for tumor immunotherapy of the present invention, the targeting peptide is a cysteine-modified targeting peptide targeting SRB1, and the sequence is Ac-FAEKFKEAVKDYFAKFWDGSGC (SEQ ID NO: 6).

[0031] In some embodiments, the present invention provides a method for preparing nanoparticles for tumor treatment, comprising: dissolving DNA and MnCl2 in an aqueous medium, reacting at high temperature, cooling, and then ultrafiltration to obtain the nanoparticles.

[0032] In some embodiments, according to the method for preparing nanoparticles of the present invention, the weight ratio of MnCl2 to double-stranded DNA molecules is 1:5;

[0033] In some embodiments, according to the method for preparing nanoparticles of the present invention, the high-temperature treatment temperature of the reaction solution is 95-100° C., and the reaction time is 1 hour.

[0034] In some embodiments, according to the method for preparing nanoparticles of the present invention, the ultrafiltration is performed using an ultrafiltration tube at 10,000 rpm, 4° C., and 10 min for three times to obtain nanoparticles.

[0035] In some embodiments, the present invention provides a tumor vaccine comprising an antigenic peptide, a targeting peptide, and the above-mentioned Mn-DNA nanoparticles.

[0036] In some embodiments, according to the method for preparing nanoparticles of the present invention, DNA-DBCO, a cross-linking agent, an antigenic peptide, and a targeting peptide are added to a Hepes buffer adjusted to a pH of 7.2 and shaken to obtain a successfully cross-linked DNA-PEG-antigen peptide (DNA-PEG-OVA) or DNA-PEG-targeting peptide (DNA-PEG-Tp);

[0037] In some embodiments, the synthesis of the nanovaccine OVA / Tp@Mn-DNA and the synthesis of OVA@Mn-DNA: the reaction conditions are consistent with the synthesis of DNA-Mn described in the second aspect, wherein the DNA chain is replaced with DNA-PEG-OVA or DNA-PEG-Tp.

[0038] In some embodiments, it has been found that the combination of active ingredients of the present invention exhibits a synergistic effect that is not achieved when each active ingredient is used alone, thereby being particularly beneficial for tumor immunotherapy. In some embodiments, it has been found that the nanoparticles of the present invention have synergistically improved one or more of the following activities or capabilities compared to a control (e.g., a control not using nanoparticles, or a control using nanoparticles without one or more components of the nanoparticles of the present invention, or a control using nanoparticles different from the nanoparticles of the present invention): tumor therapeutic agent activity, tumor attack ability, immunosuppressive microenvironment regulation activity, anti-tumor immune pathway activity, immunostimulatory activity, immune cell activation and maturation activity, immune cell activation and killing ability, tumor cell reduction ability, precise delivery ability, cGAS-STING signaling pathway activity, antigen presenting cell maturation activity, antigen presentation ability, activation and differentiation of CD8+ T cells in the tumor immune microenvironment, and tumor targeting activity, especially including, for example, promoting the secretion of cytokines such as IFNβ, activating signal factors related to the downstream pathway of STING, promoting the expression of cell surface co-stimulatory molecules (such as CD80 and CD86), promoting the expression of cell surface molecules such as CD11c and H-2Kb / SIINFEKL, and promoting the expression of tumor tissue lymphocytes such as CD8 + cell proliferation, promote the production of CTL functional markers such as CD107a, reduce tumor volume and improve the survival of cancer patients.

[0039] In some embodiments, the present invention provides a use of the nanovaccine of the present invention, wherein the use includes any one of the following:

[0040] (1) Use in the preparation of tumor therapeutic agents;

[0041] (2) Use in the preparation of drugs for targeted attack on tumors;

[0042] (3) Use in the preparation of drugs for regulating the immunosuppressive microenvironment;

[0043] (4) Use in the preparation of drugs for enhancing the activity of anti-tumor immune pathways;

[0044] (5) Use in the preparation of drugs for enhancing immune stimulation effects;

[0045] (6) Use in the preparation of drugs that promote the activation and maturation of immune cells;

[0046] (7) Use in the preparation of drugs for activating the killing ability of immune cells;

[0047] (8) Use in the preparation of drugs for reducing tumor cells.

[0048] The beneficial technical effects of the present invention include but are not limited to:

[0049] The equipment and operation process used in the synthesis of the OVA / Tp@Mn-DNA nanovaccine of the present invention are simple, convenient and highly accessible;

[0050] The OVA / Tp@Mn-DNA nanovaccine of the present invention can precisely deliver nanoparticles to antigen-presenting cells by modifying specific antigen peptides and targeting peptides. After the Mn-DNA in the particles is released, it can enhance the activity of the cGAS-STING signaling pathway, promote the maturation of antigen-presenting cells, enhance antigen presentation ability, and thus promote the activation and differentiation of CD8+ T cells in the tumor immune microenvironment.

[0051] The OVA / Tp@Mn-DNA nanovaccine of the present invention utilizes antigenic peptides and targeting peptides to significantly enhance the tumor targeting of the vaccine;

[0052] The raw materials used in the present invention are all degradable in the body, no heavy metal elements are introduced, and the biosafety is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 : Shows the schematic diagram of the synthesis of OVA / Tp@Mn-DNA nanovaccine.

[0054] Figure 2 : Shows transmission electron microscopy (TEM) and scanning electron microscopy (SEM) images of the Mn-DNA nanoparticles prepared in Ratio 1.

[0055] Figure 3 : Shows the dynamic light scattering (DLS) particle size distribution and zeta potential analysis of the comparative example 1 Mn-DNA nanoparticles and the example OVA / Tp@Mn-DNA nanovaccine.

[0056] Figure 4 : Shows the CCK8 detection results of cell activity after co-culture of OVA / Tp@Mn-DNA nanovaccine with macrophages.

[0057] Figure 5 : Shows the co-localization results of comparative example 2 after co-culture of OVA / Tp@Mn-DNA nanoparticles with macrophages.

[0058] Figure 6 : Shows the ELISA test results of IFNβ secretion after co-culture of macrophages with different concentrations of comparative example OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccine.

[0059] Figure 7 : Shows the Western Blot quantitative results of STING downstream pathway-related signal factors after co-culture of OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccine with macrophages in Comparative Example 2.

[0060] Figure 8 : Shows the expression of cell surface co-stimulatory molecules (CD80 and CD86) after co-culture of Mn-DNA in Comparative Example 1, OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccine in Comparative Example 2 with DC cells.

[0061] Figure 9 : Shows the expression of CD11c and H-2Kb / SIINFEKL on the cell surface after co-culture of Mn-DNA in Comparative Example 1, OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccine in Comparative Example 2 with DC cells.

[0062] Figure 10 : Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccines were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and flow cytometry was used to detect the expression of co-stimulatory molecules (CD80 and CD86) on the surface of tumor APC cells.

[0063] Figure 11 : Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccines were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and flow cytometry was used to detect the expression of CD11c and H-2Kb / SIINFEKL on the surface of tumor APC cells.

[0064] Figure 12 :Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccines were injected into tumor-bearing mice (melanoma implanted on the ventral side), and flow cytometry was used to detect CD8 +Cell number.

[0065] Figure 13 : Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccines were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and the production of CTL functional marker CD107a was evaluated by flow cytometry.

[0066] Figure 14 : Shows the comparison of tumor growth volume after intratumoral injection of Mn-DNA in comparative example 1, OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccine in comparative example 2 into tumor-bearing mice (melanoma implanted on the ventral side).

[0067] Figure 15 : Shows the survival comparison of comparative example 1 Mn-DNA, comparative example 2 OVA@Mn-DNA nanoparticles or OVA / Tp@Mn-DNA nanovaccines injected intratumorally into tumor-bearing mice (melanoma implanted on the ventral side). DETAILED DESCRIPTION

[0068] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0069] It should be understood that the terms described in the present invention are only for describing particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges in the present invention, it should be understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Each smaller range between any stated value or intermediate value within a stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0070] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of any conflict with any incorporated document, the content of this specification shall prevail.

[0071] Nanovaccines

[0072] Figure 1Figure 3 is a schematic diagram of the synthesis and in vivo working mechanism of OVA / Tp@Mn-DNA nanovaccine. We modified the short antigen peptide and targeting peptide with N3-PEG-MAL to crosslink DNA with these two peptides. Subsequently, DNA reacted with Mn ligand to synthesize OVA / Tp@Mn-DNA nanoparticles. OVA / Tp@Mn-DNA can synergistically exert anti-tumor effects through the following pathways: (1) Targeting peptide can achieve efficient delivery of nanoparticles; (2) dsDNA and Mn 2+ It can activate the cGAS / STING pathway and trigger IFN-I response; (3) mature DC cells can improve antigen presentation and enhance the cytotoxic effect of CTL; (4) Mn 2+ It can also increase the infiltration of cytotoxic T lymphocytes in tumors.

[0073] Preparation method

[0074] One aspect of the present invention provides a nanoparticle for tumor treatment, synthesizing a nanoparticle based on Mn 2+ and exogenous dsDNA, nanoparticles containing antigenic peptides and targeting peptides.

[0075] In a preferred embodiment, the preparation method of the present invention comprises the following steps:

[0076] (1) DNA-DBCO, cross-linked peptide, antigen peptide and targeting peptide were added to Hepes buffer adjusted to pH 7.2 and shaken to obtain successfully cross-linked DNA-PEG-antigen peptide (DNA-PEG-OVA) or DNA-PEG-targeting peptide (DNA-PEG-Tp).

[0077] (2) The nanoparticles obtained in step (1) and MnCl2 are placed in an aqueous medium, reacted at high temperature, cooled, and ultrafiltered three times to obtain nanoparticles.

[0078] use

[0079] One aspect of the present invention provides a use of the nanoparticles of the present invention, which includes any one of the following:

[0080] (1) Use in the preparation of tumor therapeutic agents;

[0081] (2) Use in the preparation of drugs for targeted tumor attack

[0082] (3) Use in the preparation of drugs for regulating the immunosuppressive microenvironment;

[0083] (4) Use in the preparation of drugs for enhancing the activity of anti-tumor immune pathways;

[0084] (5) Use in the preparation of drugs for enhancing immune stimulation effects

[0085] (6) Use in the preparation of drugs that promote the activation and maturation of immune cells

[0086] (7) Use in the preparation of drugs for activating the killing ability of immune cells

[0087] (8) Use in the preparation of drugs for reducing tumor cells

[0088] The term "tumor" as used herein includes both benign and malignant tumors. Benign tumors are those that grow slowly, do not infiltrate surrounding tissues, or metastasize, and generally do not pose a threat to life. Malignant tumors, on the other hand, are characterized by rapid invasion, metastasis, and growth, posing a serious threat to life and health. Cancer refers to malignant tumors, including those arising from epithelial tissues and sarcomas arising from mesenchymal tissues.

[0089] Examples of tumors described herein include, but are not limited to, breast tumors, colon tumors, gastrointestinal tumors, kidney tumors, lung tumors, liver tumors, ovarian tumors, pancreatic tumors, rectal tumors, stomach tumors, testicular tumors, thymus tumors, cervical tumors, prostate tumors, bladder tumors, skin tumors, nasopharyngeal tumors, esophageal tumors, oral tumors, head and neck tumors, bone tumors, cartilage tumors, muscle tumors, lymph node tumors, bone marrow tumors, and brain tumors.

[0090] Example

[0091] 1. Reagents and Instruments

[0092] MnCl2·4H2O was purchased from Shanghai Test. N3-PEG-MAL was purchased from Risenbel. 100 kD ultrafiltration tubes were purchased from Millipore. Hepes solution was purchased from Shanghai Sangon Biotechnology Co., Ltd. A cysteine-modified OVA antigen peptide with the sequence: CSSSIINFEKL (SEQ ID NO: 5) was ordered from Nanjing GenScript. A FITC-modified OVA antigen peptide with FITC at the K position of the aforementioned sequence was also ordered. A cysteine-modified targeting peptide targeting SRB1 was ordered from Hefei Guopeptide Biotechnology. For ease of description, this article will abbreviate it as Tp. The sequence is Ac-FAEKFKEAVKDYFAKFWDGSGC (SEQ ID NO: 6). A DBCO-modified DNA chain was ordered from Shanghai Sangon Biotechnology Co., Ltd. Details of all DNA sequences customized by Shanghai Sangon Biotechnology are shown in the table below.

[0093] name Sequence (5′-3′) a TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 1) b TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA (SEQ ID NO: 2) a-DBCO DBCO-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACAAAAAA (SEQ ID NO: 3) b-DBCO AAAAATGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA-DBCO (SEQ ID NO: 4) a-Cy5 Cy5-TACAGATCTACTAGTGATTCTATGACTGATCTGTACATGATCTACA (SEQ ID NO: 1) b-Cy5 Cy5-TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA (SEQ ID NO: 2)

[0094] The DLS sample cell DTS0012 and the zeta potential sample cell DTS1070 were purchased from Spectroscopy. The CCK-8 kit was purchased from Shanghai Yisheng Biotechnology. DNA absorbance was measured at 260 nm using a UV-2450 UV-visible spectrophotometer (Shimadzu, Japan). FITC fluorescence was measured at 488 nm using a Fluoromax-4 fluorophotometer (Horiba). A 200-mesh copper grid was purchased from Zhongjing Keji. The morphology and particle size of the nanoparticles were observed and photographed using a Carl Zeiss IGMAHD field-emission scanning electron microscope and a JEOL JEM-2100Plus transmission electron microscope. The hydration kinetic diameter and zeta potential of the nanoparticles were measured using a Malvern Zetasizer Nano ZS90 nanometer.

[0095] RAW264.7 cells (mouse monocytic macrophage leukemia cells) were purchased from Wuhan Punosai Life Science Co., Ltd. Cell culture media (DMEM and PRMI 1640), PBS, and Hoechst 33342 were purchased from Thermo Fisher Scientific (MA, USA). Fetal bovine serum (FBS) was purchased from Biological Industries, Israel. 0.25% trypsin was purchased from Cytiva, USA. Fluorescence imaging of cells was performed using a Nikon Ti-E + A1 SI confocal laser scanning fluorescence microscope (Japan). Mouse IFNβ ELISA kits were purchased from Beijing Solebao Technology Co., Ltd. and Shenzhen Xinbosheng Biotechnology Co., Ltd. PVDF membranes were purchased from Millipore. Western blotting antibodies against STING, p-STING, IRF3, p-IRF3, TBK1, and p-TBK1, as well as secondary antibodies, were purchased from CST. Ultrasensitive ELC luminescent solution was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd. Gel electrophoresis was performed on an electrophoresis instrument manufactured by Wuhan Junyi Technology Co., Ltd. A BCA protein concentration assay kit was purchased from Beyotime. Flow cytometry experiments were performed using a BD FACS Celesta flow cytometer and a CytoFLEXTM flow cytometer (Beckman, USA). Antibodies for flow cytometric staining were purchased from Biolegend. Ultrapure water with a resistivity of 18.2 MΩ·cm⁻¹ was obtained using a Millipore water purifier (Billerica, MA, USA) and used to prepare solutions.

[0096] 2. Synthesis of Nanovaccines

[0097] First, a cysteine-modified antigen peptide (OVA) with the sequence CSSSIINFEKL (SEQ ID NO:5) and a cysteine-modified targeting peptide (Tp) with the sequence Ac-FAEKFKEAVKDYFAKFWDGSGC (SEQ ID NO:6) were cross-linked to a DBCO-modified DNA strand. The cross-linking system consisted of a final concentration of 100 μM for the antigen peptide, 120 μM for the N3-PEG-MAL cross-linker, and 50 mM for Hepes (pH adjusted to 7.2). The reaction was incubated at 37°C in the dark with shaking for 2 hours. Following the reaction, an equal volume of 50 μM DNA-DBCO was added. The reaction was incubated in the dark for 2.5 hours at room temperature with shaking. The reaction was completed, yielding successfully cross-linked DNA-PEG-antigen peptide (DNA-PEG-OVA) or DNA-PEG-targeting peptide (DNA-PEG-Tp). Next, add 20 μl of 25 μM OVA / Tp-DNA strands, 5 μl of 20 mM MnCl₂, and 75 μl of ddH₂O to every 100 μl of the synthesis system. Incubate at 95°C for 1 hour. Cool to 4°C after completion of the reaction. Ultrafiltration is then performed three times at 10,000 rpm, 4°C, for 10 minutes to obtain the nanovaccine.

[0098] 3. Anti-tumor Application of Nanovaccines (Mice)

[0099] 6-8 week old C57BL / 6J female mice were used and 3.5×10 5 The day of tumor implantation was designated as day 0. On days 7, 14, and 21, mice bearing tumors were intratumorally injected with OVA / Tp@Mn-DNA particles containing 20 μg of antigen peptide. Starting from day 0, the weight of the mice was recorded every two days using a scale. Once the tumors had grown, the length and width of the tumors were measured using a vernier caliper every two days. When the tumor volume exceeded 1500 mm, the mice were measured. 3 When euthanized, use CO2.

[0100] Comparative Example 1

[0101] The synthesis of Mn-DNA nanoparticles is shown below.

[0102] To every 100 μl of synthesis system, add 20 μl of 25 μM double-stranded DNA, 5 μl of 20 mM MnCl₂, and 75 μl of ddH₂O. Incubate at 95°C for 1 h. After the reaction, cool to 4°C. Ultrafiltration is then performed three times at 10,000 rpm, 4°C, for 10 min to obtain nanoparticles.

[0103] Comparative Example 2

[0104] The synthesis of OVA@Mn-DNA nanoparticles is shown below.

[0105] First, a cysteine-modified antigen peptide, OVA, with the sequence CSSSIINFEKL (SEQ ID NO: 5), was cross-linked to a DBCO-modified DNA strand. The cross-linking system consisted of a final concentration of 100 μM of the antigen peptide, 120 μM of the N3-PEG-MAL cross-linker, and 50 mM of Hepes (pH adjusted to 7.2). The reaction was incubated at 37°C in the dark with shaking for 2 hours. Following the reaction, an equal volume of 50 μM DNA-DBCO was added. The mixture was shaken at room temperature in the dark for 2.5 hours. The reaction was completed, yielding a successfully cross-linked DNA-PEG-antigen peptide (DNA-PEG-OVA). Next, 20 μL of 25 μM OVA / Tp-DNA strand, 5 μL of 20 mM MnCl₂, and 75 μL of ddH₂O were added to each 100 μL of the synthesis system. The reaction was incubated at 95°C for 1 hour. After the reaction, the mixture was cooled to 4°C. The nano-vaccine was obtained by ultrafiltration three times at 10000 rpm, 4°C, and 10 min.

[0106] Test Case

[0107] OVA / Tp@Mn-DNA nanoparticles synthesis and in vivo working mechanism Figure 1 As shown in Figure 2, DNA was cross-linked to the two peptides by modifying the short antigen peptide and the targeting peptide with N3-PEG-MAL. DNA reacted with the Mn ligand to synthesize OVA / Tp@Mn-DNA nanoparticles. OVA / Tp@Mn-DNA exerts its anti-tumor effect through the following pathways: (1) The targeting peptide can achieve efficient delivery of nanoparticles; (2) dsDNA and Mn 2+ It can activate the cGAS / STING pathway and trigger IFN-I response; (3) mature DC cells can improve antigen presentation and enhance the cytotoxic effect of CTL; (4) Mn 2+ It can also increase the infiltration of cytotoxic T lymphocytes in tumors.

[0108] The scanning transmission electron microscopy and scanning electron microscopy of the Mn-DNA nanoparticles prepared in Comparative Example 1 are as follows: Figure 2 As shown, it was shown that the nanoparticles were successfully synthesized and characterized as being uniform and monodisperse.

[0109] Particle size and zeta potential Figure 3As shown, the hydration kinetic diameters (A) of the Mn-DNA nanoparticles prepared in Comparative Example 1 and the OVA / Tp@Mn-DNA nanoparticles prepared in Example 1 are approximately 220 nm and 190 nm, respectively. The OVA / Tp@Mn-DNA nanoparticles prepared in Example 1 exhibit slightly lower potential than the Mn-DNA nanoparticles prepared in Comparative Example 1, indicating that the synthesized OVA / Tp@Mn-DNA nanoparticles are more stable.

[0110] After co-culture of OVA / Tp@Mn-DNA nanovaccine with macrophages, cell activity was detected and the results showed that the nanovaccine had no toxic effect on macrophages. Figure 4 shown.

[0111] The OVA / Tp@Mn-DNA nanoparticles prepared in Comparative Example 2 were treated with fluorescence and co-cultured with macrophages. The co-localization was observed using a confocal microscope. The results showed that macrophages effectively took up OVA antigens and DNA on the surface of the nanoparticles. Figure 5 shown.

[0112] The results of ELISA test on IFNβ secretion by stimulating macrophages with nanoparticles showed that the OVA / Tp@Mn-DNA nanovaccine with a concentration of 2 μM had the strongest stimulating effect. Figure 6 shown.

[0113] Macrophages were stimulated by nanoparticles, and the signaling factors of the STING downstream pathway were quantified by Western Blot. The results showed that the OVA / Tp@Mn-DNA nanovaccine in Example 1 had a more significant effect on activating the STING signaling pathway, such as Figure 7 shown.

[0114] The DC cells were stimulated by nanoparticles, and the expression of CD80 and CD86 on the cell surface was detected by flow cytometry. The results showed that the OVA / Tp@Mn-DNA nanovaccine in Example 1 stimulated the upregulation of CD80 and CD86 expression, indicating the maturation of DC cells. Figure 8 shown.

[0115] DC cells were stimulated by nanoparticles, and the expression of CD11c and H-2Kb / SIINFEKL on the cell surface was detected by flow cytometry. The results showed that the OVA / Tp@Mn-DNA nanovaccine in Example 1 stimulated the upregulation of CD11c and H-2Kb / SIINFEKL expression, indicating that the antigen presentation ability of DC cells was enhanced. Figure 9 shown.

[0116] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and flow cytometry was used to detect the expression of CD80 and CD86 on the cell surface, demonstrating that Example OVA / Tp@Mn-DNA nanovaccine enhanced the maturation stimulation of DC cells in vivo. Figure 10 shown.

[0117] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and the expression of CD11c and H-2Kb / SIINFEKL on the cell surface was detected by flow cytometry, which demonstrated that the antigen presentation ability of Example OVA / Tp@Mn-DNA nanovaccine in vivo was improved, as shown in Figure 2. Figure 11 shown.

[0118] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side), and flow cytometry was used to detect CD8 + The results showed that the OVA / Tp@Mn-DNA nanovaccine in the example was more effective in enhancing the tumor infiltration of CTL. Figure 12 shown.

[0119] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were intratumorally injected into tumor-bearing mice (melanoma implanted on the ventral side). Flow cytometry was used to evaluate the production of CD107a, a functional marker of CTLs. The results showed that OVA / Tp@Mn-DNA nanovaccine stimulated CTLs to exert the strongest toxicity, as shown in Figure 2. Figure 13 shown.

[0120] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were injected intratumorally into tumor-bearing mice (melanoma implanted on the ventral side), and the tumor volume in the mice was monitored and measured. The results showed that Example OVA / Tp@Mn-DNA nanovaccine had a good effect in inhibiting tumor growth, such as Figure 14 shown.

[0121] Comparative Example 1 Mn-DNA, Comparative Example 2 OVA@Mn-DNA nanoparticles or Example OVA / Tp@Mn-DNA nanovaccine were injected intratumorally into tumor-bearing mice (melanoma implanted on the ventral side), and the survival of the mice was monitored and counted. The results showed that Example OVA / Tp@Mn-DNA nanovaccine had a good therapeutic effect, such as Figure 15 shown.

[0122] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention, and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they may modify the technical solutions described in the above embodiments or replace some of the technical features therein with equivalents. However, such modifications or replacements do not deviate from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A nanoparticle for tumor immunotherapy comprising a metal ion Mn 2+ , exogenous dsDNA, antigenic peptides and targeting peptides.

2. The nanoparticle according to claim 1, wherein The particle size of the nanoparticles is 100-250 nm.

3. The nanoparticles according to claim 1 or 2, wherein The dsDNA has a DBCO modification, and preferably the sequence of one chain in the dsDNA is TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA as shown in SEQ ID NO:

1.

4. The nanoparticle according to claim 1 or 2, wherein The antigen peptide is an OVA antigen peptide modified with cysteine, and preferably its sequence is CSSSIINFEKL as shown in SEQ ID NO:

5.

5. The nanoparticle according to claim 1 or 2, wherein The targeting peptide is a targeting peptide targeting SRB1, preferably a targeting peptide with cysteine ​​modification, and preferably its sequence is Ac-FAEKFKEAVKDYFAKFWDGSGC shown in SEQ ID NO:

6.

6. A vaccine or pharmaceutical composition comprising the nanoparticle according to any one of claims 1 to 5.

7. A method for preparing the nanoparticles according to any one of claims 1 to 5, comprising reacting dsDNA with MnCl2 in an aqueous medium.

8. The method according to claim 7, wherein: (1) the weight ratio of MnCl2 to dsDNA molecules is 1:4-1:6; and / or (2) The reaction temperature is 95-100°C and the reaction time is 0.8-1.2h.

9. The method according to claim 7 or 8, comprising cross-linking dsDNA, antigenic peptide and targeting peptide, and then reacting the cross-linked peptide with MnCl2 in an aqueous medium to obtain the nanoparticles.

10. Use of the nanoparticle according to any one of claims 1 to 5 or the vaccine or pharmaceutical composition according to claim 6, wherein: The purposes include any of the following: (1) Use in the preparation of tumor therapeutic agents; (2) Use in the preparation of drugs for targeted attack on tumors; (3) Use in the preparation of drugs for regulating the immunosuppressive microenvironment; (4) Use in the preparation of drugs for enhancing the activity of anti-tumor immune pathways; (5) Use in the preparation of drugs for enhancing immune stimulation effects; (6) Use in the preparation of drugs that promote the activation and maturation of immune cells; (7) Use in the preparation of drugs for activating the killing ability of immune cells; (8) Use in the preparation of drugs for reducing tumor cells; Wherein, optionally, the tumor includes a tumor that can be treated by activating the STING pathway, preferably including breast tumors, colon tumors, gastrointestinal tumors, kidney tumors, lung tumors, liver tumors, ovarian tumors, pancreatic tumors, rectal tumors, stomach tumors, testicular tumors, thymus tumors, cervical tumors, prostate tumors, bladder tumors, skin tumors, nasopharyngeal tumors, esophageal tumors, oral tumors, head and neck tumors, bone tumors, cartilage tumors, muscle tumors, lymph node tumors, bone marrow tumors and brain tumors.

Images