Establishment method and application of agate red cherry VIGS system

Abstract

The invention belongs to the technical field of forest tree gene engineering, and particularly relates to a construction method of an agate red cherry seedling PDS gene virus-induced gene silencing (VIGS) system based on agrobacterium tumefaciens mediation. According to the method, a recombinant virus vector containing a PDS gene specific fragment as shown in SEQ ID NO.1 is constructed, the recombinant virus vector is introduced into an agate red cherry leaf tissue by utilizing an agrobacterium infection technology, and efficient silencing of a target gene is successfully realized. As a first VIGS technical platform established in the woody fruit tree agate red cherry, the system can visually verify the gene function by inducing the typical albino phenotype of the plant leaf of the agate red seedling, and breaks through the technical bottlenecks of long period and low efficiency of the traditional woody plant gene function research. The achievement fills the blank of a woody fruit tree VIGS technical system, provides a traceable research tool for analyzing a molecular mechanism formed by key traits of the agate red cherries, and has milestone significance for promoting functional genomics research of rosaceae fruit trees.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and particularly relates to the establishment of a system for silencing specific genes of agate red cherries using virus-induced gene silencing (VIGS) technology, and its application in the study of cherry gene function. Background Art

[0002] Cherry is a tree in the genus Prunus in the Rosaceae family. Traditional hybrid breeding often suffers from high genetic heterogeneity and a long juvenile period (5-7 years), resulting in inefficient trait improvement. Homologous genetic transformation systems are limited by technical bottlenecks such as the difficulty of woody plant regeneration and the long transformation cycle, severely hindering in-depth research on gene function. The Agate Red Cherry (Cerasus pseudocerasus Lindl.) is a specialty fruit tree resource in Guizhou Province. Studies on its phylogenetic relationships suggest that it may be a seedling variant derived from a hybridization between European sweet cherry and Chinese sour cherry. This phylogenetic diversity gives the Agate Red Cherry broad application prospects, including research on varietal improvement, stress response, and functional analysis of both Chinese and European cherries.

[0003] Virus-induced gene silencing (VIGS) is a transient silencing technology that uses recombinant viral vectors to deliver target gene fragments, rapidly inhibiting endogenous gene expression without relying on genetic transformation, providing a revolutionary strategy for studying gene function in woody plants. Compared with gene editing (such as CRISPR) or stable transgenic technology, VIGS has three core advantages: (1) short cycle: phenotypic observation can be shortened to several weeks; (2) strong universality: no need to establish a stable genetic transformation system; (3) high throughput: supporting the simultaneous silencing of multiple genes. Currently, this technology has been maturely applied in herbaceous plants such as tomatoes and tobacco, but no successful reports have been reported in woody fruit trees in the Rosaceae family (especially Agate Red Cherry). The technical difficulties are mainly due to the low compatibility between the viral vector and the host and the insufficient infection efficiency.

[0004] Phytoene desaturase (PDS) gene is a classic reporter gene in the VIGS system. Its silencing can block the carotenoid synthesis pathway, resulting in an albino phenotype in plant tissues, providing an intuitive visual marker for silencing efficiency. Summary of the Invention

[0005] The technical problem addressed by this invention is to establish a VIGS system for cherries and utilize it to silence specific genes in cherries. This successful VIGS system is the first of its kind in cherries. This system enables rapid and efficient identification of the biological functions of cherries' genes, allowing for investigation of the functional mechanisms of target genes based on changes in plant phenotypes. The establishment of this VIGS system is of groundbreaking significance for the study of functional genes in cherries, a woody fruit tree.

[0006] The technical solution of the present invention is: a method for establishing a VIGS system of agate red cherry, which is obtained by infecting agate red cherry seedlings with a recombinant viral plasmid carrying a target gene fragment mediated by Agrobacterium, and the target gene fragment is shown in SEQ ID NO.1.

[0007] The method for establishing a VIGS system for agate red cherry comprises the following steps: (1) cultivating agate red cherry seedlings: after agate red cherry seeds germinate, they are potted in a greenhouse and infected when they grow to 20 days old; (2) cloning the target gene fragment: selecting the agate red cherry PDS gene, using the Sol Genomics Network VIGS Tool to design VIGS primers for the CpPDS gene, extracting agate red cherry RNA, and reverse-transcribing it into cDNA, using the reverse-transcribed cDNA as a template, and performing PCR amplification with a high-fidelity enzyme to obtain the target gene fragment; (3) enzyme digestion of the pTRV2 viral plasmid vector: selecting appropriate enzyme digestion sites, performing double enzyme digestion on the pTRV2 vector, and recovering the enzyme digestion products by gel gel after enzyme digestion; (4) constructing a recombinant viral plasmid vector: connecting the viral vector pTRV2 linearized in step (3) with the target gene fragment obtained in step (2) to obtain pTRV2. The recombinant viral plasmid connected with TRV2 and the target gene fragment was then transformed into Agrobacterium; (5) Agrobacterium-mediated infection of the recombinant viral plasmid into the agate red cherry seedlings: the pTRV1 Agrobacterium solution and the pTRV2-CpPDS recombinant viral plasmid Agrobacterium solution were mixed in equal proportions, and then the leaves of the agate red cherry seedlings were infected by the pressure infiltration method; (6) Verification of the silencing effect: the new leaves grown from the infected agate red cherry seedlings gradually showed albino phenotype 1-2 weeks later, and the expression level of the PDS gene was analyzed using qRT-PCR.

[0008] The forward primer sequence of the target gene fragment is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3.

[0009] The step (4) is specifically as follows: ① Take 1 mL of Agrobacterium liquid containing the recombinant viral plasmid and transfer it to 50 mL of LB liquid culture medium for activation, and culture it in a shaking incubator at 28°C and 180 rpm until the OD 600② After centrifuging the bacterial solution obtained in step ①, discard the supernatant; collect the bacteria and resuspend them in the prepared resuspension solution, and adjust the bacterial solution concentration to OD 600 =1.0; ③ The pTRV1 Agrobacterium solution was mixed with the pTRV2 and recombinant virus plasmid Agrobacterium solutions in a volume ratio of 1:1, and the mixture was allowed to stand at 28°C for 2-3 hours before infecting the Agate Red Cherry seedlings; the mixed Agrobacterium solution of pTRV1 and pTRV2 served as the empty load control; ④ Aspirate the bacterial solution with a 1 mL sterile syringe with the needle removed, and slowly inject it into the back of the Agate Red Cherry leaf until the bacterial solution penetrates the entire leaf surface; after inoculation, culture in the dark at 24°C for 2 days, and then culture normally with 16 h light / 8 h dark.

[0010] The LB liquid culture medium in step ① contains 100 mg / L rifampicin and 50 mg / L kanamycin.

[0011] The resuspension in step ② contains 10 mmol / L magnesium chloride, 10 mmol / L 2-morpholineethanesulfonic acid and 100 mmol / L acetosyringone.

[0012] In the step (6), the qRT-PCR gene expression analysis uses the CpRSP3 gene as an internal reference to detect the expression level of the CpPDS gene; the forward primer is shown in the sequence SEQ ID NO.4, and the reverse primer is shown in the sequence SEQ ID NO.5; the forward primer of the CpRSP3 internal reference gene is shown in the sequence SEQ ID NO.6, and the reverse primer is shown in the sequence SEQ ID NO.7.

[0013] The present invention has the beneficial effect of successfully establishing a VIGS system in Cherry (Ceratitis australis) for the first time. This system can rapidly and efficiently identify the biological functions of Cherry (Ceratitis australis) genes, and can explore the functional mechanisms of target genes based on changes in plant phenotypes. The establishment of this VIGS system is of groundbreaking significance for the study of functional genes in Cherry (Ceratitis australis).

[0014] Specifically, the pTRV2-CpPDS recombinant vector for the Agate Red Cherry was constructed for the first time. Using Agrobacterium injection to infect the leaves of Agate Red Cherry seedlings, an efficient and stable VIGS platform was successfully established. The Agate Red Cherry CpPDS gene was highly expressed in the leaves, and after silencing, the effectiveness of the system was quickly verified by photobleaching. This system not only provides tools for elucidating the molecular mechanisms of Agate Red Cherry quality formation but can also be expanded to related Rosaceae fruit trees such as peach and plum, accelerating functional genomic research in woody plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1The electrophoresis results of the detection of the PCR product of the PDS gene of Agate Red Cherry are shown in Figure 1. M stands for DL2000 DNA Maker, and lanes 1-2 are the amplified CpPDS genes.

[0016] Figure 2 PCR detection of positive clones of E. coli DH5α transformed with pTRV2-CpPDS recombinant vector, M is DL2000 DNA Marker, lanes 1-5 are pTRV2-CpPDS PCR products;

[0017] Figure 3 PCR detection of positive clones of Agrobacterium GV3101 transformed with pTRV2-CpPDS recombinant vector, M is DL2000 DNA Marker, lanes 1-5 are pTRV2-CpPDS PCR products;

[0018] Figure 4 Schematic diagram of the construction of pTRV2-CpPDS silencing vector;

[0019] Figure 5 This is a picture of the albino phenotype of new leaves that appeared after the silent vector infected the Agate Red Cherry seedlings;

[0020] Figure 6 These are the different leaf phenotypes of Agate Red Cherry;

[0021] Figure 7 This is a graph showing the silencing efficiency of CpPDS. DETAILED DESCRIPTION

[0022] The present invention is described in detail below by specific examples, but the scope of protection of the present invention is not limited. Unless otherwise specified, the experimental methods adopted in the present invention are all conventional methods, and the experimental equipment, materials, reagents, etc. used can be obtained from commercial channels.

[0023] Example 1

[0024] Obtaining CpPDS gene interference fragment

[0025] After sampling, the leaves of the Agate Red Cherry were quickly frozen with liquid nitrogen and stored at -80°C. Total RNA of the Agate Red Cherry was extracted using the Omega Plant RNA Extraction Kit as follows:

[0026] (1) After grinding the plant leaves with liquid ammonia, collect ≤100 mg of plant sample into a 1.5 mL centrifuge tube, immediately add 500 μL RCL Buffer / 10 μL 2-mercaptoethanol mixture, and vortex to mix immediately;

[0027] (2) Incubate in a 55°C water bath for 1-3 min, then centrifuge at 10,000 × g for 5 min at room temperature;

[0028] (3) Place the gDNA Filter Column into a 2 mL collection tube, transfer the supernatant to the homogenizer column, and centrifuge at 14,000 × g for 2 min at room temperature. Discard the homogenizer column and retain the filtrate.

[0029] (4) Add an equal volume of RCB Buffer to the filtrate and vortex mix for 20 seconds;

[0030] (5) Place the RNA Mini Column into a 2 mL collection tube and transfer half of the mixture (<700 uL)

[0031] Transfer to the binding column, centrifuge at 12,000 × g for 1 min at room temperature, and discard the filtrate;

[0032] (6) Repeat step (5) until all the mixed solution has been transferred through the column;

[0033] (7) The RNAMini Column was placed in the same 2 mL collection tube.

[0034] Add 400 μL RWF Wash Buffer to the RNA Mini Column and centrifuge at 10,000 × g at room temperature.

[0035] 30s, discard the filtrate;

[0036] (8) Place the RNA Mini Column in the same 2 mL collection tube, add 500 μL RNA Wash Buffer II to the binding column, centrifuge at 10,000 × g for 30 seconds at room temperature, and discard the filtrate;

[0037] (9) Repeat step (8) for a second wash with RNA Wash Buffer II;

[0038] (10) The RNA Mini Column was placed in the same 2 mL collection tube and centrifuged at 10,000 × g at room temperature.

[0039] Centrifuge for 2 minutes to dry the binding column matrix;

[0040] (11) Place the RNA Mini Column in a new 1.5 mL centrifuge tube, take 50-100 μL of DEPC Water, accurately add it to the center of the binding column membrane, place it at room temperature for 2 minutes, and centrifuge it at 10,000 × g for 1 minute.

[0041] Elute RNA.

[0042] After electrophoresis to detect the integrity of the RNA band, reverse transcription was performed into cDNA according to the method described in the Genstar reverse transcription kit. Using the above cDNA as a template, primers with pTRV2 homology arms were designed based on the CpPDS sequence on the Vazyme online website https: / / crm.vazyme.com / cetool / singlefragment.html as shown below:

[0043] CpPDS-F: gagacgcgtgagctcggtaccACTCCAGTTGATATCCTAAAGCTTCTAT; CpPDS-R: aaggttaccgaattctctagaTGTAGCATCAATAATTTCTGAATCACTG. The following mixture was prepared in a PCR tube. The reaction system is shown in Table 1:

[0044] Table 1 PCR reaction system

[0045]

[0046] Mix gently and centrifuge, add paraffin and place the tube on the PCR instrument, set the reaction program to amplify the target fragment. Figure 1 As shown, the expected target fragment was amplified according to the PCR reaction system.

[0047] After the PCR products were detected by 1% agarose gel electrophoresis, PCR products with target fragment sizes were recovered using the TIANgelMaxi Purification Kit from Beijing Tiangen Biochemical Technology Co., Ltd.

[0048] Example 2

[0049] Construction of recombinant viral vectors

[0050] The pTRV2 backbone was double-digested with restriction endonucleases Xba I and Kpn I from Takara (20 μL of digestion system, 37°C, 4 h), according to the reaction system described in Table 2. The pTRV2 linearized vector was recovered using the Takara Gel Extraction Kit, following the instructions in the kit manual.

[0051] Table 2 Double enzyme digestion reaction system

[0052]

[0053]

[0054] Then use Shanghai Sangon Seamless Cloning Kit SeamlessCloning Master Max to connect the vector and insert fragment, and react according to the reaction system described in Table 3:

[0055] Table 3 Insert fragment and linearized vector ligation reaction system

[0056]

[0057] After gently mixing with a pipette, the mixture was connected at 25°C for 30 minutes. The ligation product was transformed into Escherichia coli DH5α. After positive clones were identified by PCR in the bacterial solution, the plasmid was extracted and sequenced to obtain a recombinant viral vector that was successfully connected and named pTRV2-CpPDS. The silencing vector was obtained as shown in FIG. Figure 2 shown.

[0058] Example 3

[0059] Agrobacterium-mediated silencing vector infects Agate Red Cherry

[0060] (1) Transformation of Agrobacterium GV3101

[0061] ① Extract the plasmid from the correctly sequenced bacterial solution, take out the Agrobacterium GV3101 stored in the -80℃ ultra-low temperature freezer, and use a pipette to draw 5μL of plasmid and add it to 100μL Agrobacterium GV3101.

[0062] ② Place on ice for 30 minutes, freeze in liquid nitrogen for 5 minutes, and then place in a 37°C water bath for 5 minutes. After a 2-minute ice bath, add 800 μL of antibiotic-free LB medium in a clean bench and shake in a shaker at 28°C for 4 hours.

[0063] ③ Take 200 μL of the bacterial solution after 4 hours of culture and spread it on LB solid medium containing 100 mg / L rifampicin and 100 mg / L kanamycin, and culture it upside down at 28°C for 24-48 hours;

[0064] ④Pick a single colony that grows normally and verify whether it is a positive clone by PCR;

[0065] ⑤ Take a single colony that has been verified as a positive clone and inoculate it into 50 mL of LB liquid medium containing 100 mg / L rifampicin, and culture it at 28°C and 200 rpm for 24 hours;

[0066] ⑥ Store the bacterial solution after 24 hours of culture in a -80℃ ultra-low temperature refrigerator for later use.

[0067] (2) Preparation of infection solution

[0068] ① Add Agrobacterium tumefaciens containing pTRV1, pTRV2, and pTRV2-CpPDS into 5 mL of LB liquid medium (100 mg / L rifampicin and 50 mg / L kanamycin) for activation, and shake at 28°C at 180 rpm.

[0069] The culture was shaken for 24 h.

[0070] ② Add 1 mL of the activated bacterial solution prepared in the above step to 50 mL of LB liquid culture medium (containing 100 mg / L rifampicin, 50 mg / L kanamycin, and 100 mmol / L acetosyringone) and culture in a shaker at 28°C for about 24 h.

[0071] ③ Place the bacterial suspension obtained in the previous step in a centrifuge and centrifuge at 8000 rpm for 5 minutes. Discard the supernatant to collect the cells and resuspend them in a buffer solution (containing 10 mmol / L magnesium chloride, 10 mmol / L 2-morpholineethanesulfonic acid, and 100 mmol / L acetosyringone) to an OD600 of 1.0. Mix pTRV1 with pTRV2 and pTRV2-CpPDS in equal proportions and incubate in a 28°C incubator for 3-4 hours to infect Agate Red Cherry plants.

[0072] (3) Infection of Agate Red Cherry

[0073] Use a 1 mL sterile needle-free syringe to draw up the bacterial solution and inject it into the back of the Agate Red Cherry leaves using the pressure infiltration method until the bacterial solution penetrates the entire leaf surface. Then culture it in the dark at room temperature for 2 days, and then culture it normally with 16 h light / 8 h dark, and observe its phenotypic changes.

[0074] Example 4

[0075] Silence effect results verification

[0076] (1) Albino phenotype

[0077] One week after infection, new leaves of the experimental group inoculated with the recombinant viral vector pTRV2-CpPDS began to show albinism symptoms. Three weeks after infection, the albinism phenomenon gradually spread, indicating that the silencing vector began to take effect. Figure 5-6 As shown, there was no change in the control group.

[0078] (2) Viral vector silencing effect detection

[0079] ① Extract RNA from the control and silenced plants according to the method in Example 1.

[0080] ②Reverse transcription of mRNA

[0081] According to the instructions of the reverse transcription kit TransScript First-Strand cDNA Synthesis SuperMix, the following reaction system was prepared according to Table 4:

[0082] Table 4. mRNA reverse transcription reaction system

[0083]

[0084]

[0085] After mixing, place the tube in a PCR instrument and set the following program: 37°C for 2 minutes, 50°C for 15 minutes, and 85°C for 2 minutes. After the reaction is complete, store the product at -20°C for subsequent real-time quantitative PCR reactions.

[0086] ③ Real-time quantitative PCR

[0087] The cDNA obtained in the above steps was used for real-time quantitative PCR reaction. The following reaction system was prepared according to Table 5:

[0088] Table 5. mRNA real-time quantitative PCR system

[0089]

[0090] After mixing, place in a real-time quantitative PCR instrument and set the program as follows: 94°C, 30s; 94°C, 5s, 60°C, 30s, 40 cycles; dissociation stage.

[0091] The internal reference used CpRSP3, and the primer sequences are as follows SEQ ID NO.4-7:

[0092] qCpPDS-F:TGAACCTTGCCGTCCCTT

[0093] qCpPDS-R:TCACCGAACGCTTGCCTC

[0094] qCpRSP3-F: TCAAGGTCAGGTAAGGGGGTC

[0095] qCpRSP3-R:GTGAGGTGATTGTTAGTGGAAAGC

[0096] Use 2 -ΔΔCt The relative changes in CpPDS expression after silencing were analyzed by the method. Figure 7As shown in the figure, the expression level of CpPDS gene was significantly lower than that of the control group, indicating that the expression of CpPDS of Agate Red Cherry was inhibited. Combined with the phenotype of the leaves of the Agate Red Cherry experimental group, it was shown that the expression level of PDS gene after VIGS gene silencing in this experiment was significantly decreased.

[0097] Establishing a rapid and reliable homologous transformation system is particularly important for woody fruit trees. This system allows for the functional identification of relevant genes and the utilization of their genetic characteristics for molecular breeding. However, homologous verification is currently difficult in Prunus cherries (Rosaceae). Using a gene silencing system induced by the Agate Red Cherry virus allows for efficient and precise functional verification of target genes, eliminating the need for traditional tissue culture regeneration and genetic transformation of Agate Red Cherry.

[0098] The above-described embodiments are only preferred embodiments of the present invention, and are not all feasible embodiments of the present invention. Any improved design based on the principles of this technology, including but not limited to the optimized combination of carrier elements, adaptive adjustment of vaccination methods, strategies to improve silencing efficiency and other derivative technical solutions, all fall within the scope of protection of the claims of this technical solution. Equivalent technical solutions obtained by conventional experimental means by those skilled in the art without departing from the core innovative concept of this technology should be deemed to be included in the scope of protection of this patent.

Claims

1. A method for establishing an agate red cherry VIGS system, characterized by: The obtained product is obtained by infecting agate red cherry seedlings with a recombinant viral plasmid carrying a target gene fragment mediated by Agrobacterium, and the target gene fragment is shown in SEQ ID NO.

1.

2. The method for establishing a VIGS system of agate red cherry according to claim 1, characterized in that: The following steps are involved: (1) Cultivation of Agate Red Cherry Seedlings: After germination of Agate Red Cherry seeds, plant them in pots in a greenhouse and infect them when they grow to 20 days old; (2) Cloning of target gene fragments: Select the Agate Red Cherry PDS gene, use the Sol Genomics Network VIGS Tool to design VIGS primers for the CpPDS gene, extract Agate Red Cherry RNA, and reverse transcribe it into cDNA. Use the reverse transcribed cDNA as a template and perform PCR amplification with a high-fidelity enzyme to obtain the target gene fragment; (3) Enzyme digestion of the pTRV2 viral plasmid vector: Select appropriate enzyme digestion sites and perform double enzyme digestion on the pTRV2 vector. After enzyme digestion, the enzyme digestion products are recovered by gel gel; (4) Construction of recombinant viral plasmid vectors: Connect the viral vector pTRV2 linearized in step (3) with the target gene fragment obtained in step (2) to obtain pTRV2. The recombinant viral plasmid connected with TRV2 and the target gene fragment was then transformed into Agrobacterium; (5) Agrobacterium-mediated infection of the recombinant viral plasmid into the agate red cherry seedlings: the pTRV1 Agrobacterium solution and the pTRV2-CpPDS recombinant viral plasmid Agrobacterium solution were mixed in equal proportions, and then the leaves of the agate red cherry seedlings were infected by the pressure infiltration method; (6) Verification of the silencing effect: the new leaves grown from the infected agate red cherry seedlings gradually showed albino phenotype 1-2 weeks later, and the expression level of the PDS gene was analyzed using qRT-PCR.

3. The method for establishing a VIGS system of agate red cherry according to claim 2, characterized in that: The forward primer sequence of the target gene fragment is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. The method for establishing a VIGS system of agate red cherry according to claim 1, characterized in that: The step (4) is specifically as follows: ① Take 1 mL of Agrobacterium liquid containing the recombinant viral plasmid and transfer it to 50 mL of LB liquid culture medium for activation, and culture it in a shaking incubator at 28°C and 180 rpm until the OD 600 is around 1.0; ② After centrifuging the bacterial solution obtained in step ①, discard the supernatant; collect the bacteria and resuspend them in the prepared resuspension solution, and adjust the bacterial solution concentration to OD 600 =1.0; ③ The pTRV1 Agrobacterium solution was mixed with the pTRV2 and recombinant virus plasmid Agrobacterium solutions in a volume ratio of 1:1, and the mixture was allowed to stand at 28°C for 2-3 hours before infecting the Agate Red Cherry seedlings; the mixed Agrobacterium solution of pTRV1 and pTRV2 served as the empty control; ④ Aspirate the bacterial solution with a 1 mL sterile syringe with the needle removed, and slowly inject it into the back of the Agate Red Cherry leaf until the bacterial solution penetrates the entire leaf surface; after inoculation, culture in the dark at 24°C for 2 days, and then culture normally with 16 h light / 8 h dark.

5. The method for establishing a VIGS system of agate red cherry according to claim 4, characterized in that: The LB liquid culture medium in step ① contains 100 mg / L rifampicin and 50 mg / L kanamycin.

6. The method for establishing a VIGS system of agate red cherry according to claim 4, characterized in that: The resuspension in step ② contains 10 mmol / L magnesium chloride, 10 mmol / L 2-morpholineethanesulfonic acid and 100 mmol / L acetosyringone.

7. The method for establishing a VIGS system of agate red cherry according to claim 2, characterized in that: In the step (6), the qRT-PCR gene expression analysis uses the CpRSP3 gene as an internal reference to detect the expression level of the CpPDS gene; the forward primer is shown in the sequence SEQ ID NO.4, and the reverse primer is shown in the sequence SEQ ID NO.5; the forward primer of the CpRSP3 internal reference gene is shown in the sequence SEQ ID NO.6, and the reverse primer is shown in the sequence SEQ ID NO.7.

Images