Soybean GmMYB6 protein and application of coding gene thereof

Abstract

The invention relates to the field of genetic engineering and plant genetic breeding, and discloses a soybean GmMYB6 protein and application of a coding gene thereof. The invention provides a GmMYB6 protein and a coding gene thereof, the GmMYB6 protein is closely related to the stalk strength and lignin content of a plant, and the stalk strength and lignin content of the plant can be effectively regulated and controlled by knocking out the coding gene of the GmMYB6 protein from the plant. The GmMYB6 protein and the coding gene thereof provided by the invention can be used for cultivating lodging-resistant soybean varieties, and have a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the fields of genetic engineering and plant genetic breeding, in particular to the application of soybean GmMYB6 protein and its encoding gene. Background Art

[0002] Soybean ( Glycine max Plant lodging is a limiting factor in soybean cultivation, negatively impacting yield. Soybean is an important economic and oilseed crop, accounting for 59% of global oil production and providing 70% of global plant protein for humans and animals. Soybean lodging severely limits both yield and quality. Therefore, developing lodging-resistant plants is a potential strategy for increasing soybean yield. This can be achieved by increasing stem strength, enabling plants to adapt to high-density plantings and thereby boosting soybean yield.

[0003] Lignin is an organic compound found in plant cell walls, providing structural integrity and resistance to external stresses. Lignin plays a crucial role in increasing cell wall rigidity and stability, enabling the stem to withstand external mechanical stresses, such as wind, thereby maintaining the upright growth habit typical of high-yielding soybean cultivars. This is particularly important during the crop's maturity and harvest phases, when the seeds are heavier and require a strong stem to support them. When subjected to stress or nutritional imbalances, the stem weakens and loses its ability to resist external forces, causing all or part of the plant structure to tilt or even break. However, enhancing stem strength and improving its resistance to lodging by increasing lignin content is currently lacking comprehensive research. Summary of the Invention

[0004] The purpose of the present invention is to provide applications of soybean GmMYB6 protein and its encoding gene.

[0005] To achieve the purpose of the present invention, in a first aspect, the present invention provides any of the following applications of soybean GmMYB6 protein, its encoding gene, and biological materials containing the gene: (1) Used to regulate plant stem strength and lignin content; (2) Used to regulate plant oil content and single-plant yield; (3) Used for the cultivation of lodging-resistant plant varieties.

[0006] The soybean GmMYB6 protein is: (A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; (B) A protein derived from (A) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 1.

[0007] Furthermore, the regulation is negative regulation.

[0008] Furthermore, the plant includes but is not limited to soybean.

[0009] In a second aspect, the present invention provides a method for increasing soybean stalk strength, lignin content, oil content, and yield per plant, and improving soybean lodging resistance, the method comprising: weakening or knocking out a gene in soybean by genetic engineering means; GmMYB6 .

[0010] The gene GmMYB6 Encoding soybean GmMYB6 protein, the nucleotide sequence is: I) the nucleotide sequence shown in SEQ ID NO: 3; II) a nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence of SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; III) a nucleotide sequence that hybridizes to the sequence shown in SEQ ID NO: 3 under stringent conditions, wherein the hybridization is carried out in 0.1× SSPE containing 0.1% SDS or in 0.1× SSC containing 0.1% SDS at 65°C, and the membrane is washed with the solution; IV) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of I), II) or III) and expresses a protein with the same function.

[0011] Furthermore, the method comprises: GmMYB6 As the target, a crRNA sequence based on CRISPR-Cas12a was designed, and a DNA fragment containing the crRNA sequence encoding the crRNA sequence was connected to a vector carrying CRISPR-Cas12a to transform soybeans, thereby obtaining transgenic soybeans with the gene function missing.

[0012] Preferably, the nucleotide sequence of the crRNA action site is as shown in SEQ ID NO:4-8.

[0013] In a third aspect, the present invention provides the use of the transgenic soybean obtained according to the method in plant breeding.

[0014] The breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0015] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention provides a GmMYB6 protein and its encoding gene, which are closely related to plant stem strength. By knocking out the gene encoding the GmMYB6 protein in plants, plant traits such as stem strength and lignin content can be effectively regulated. The GmMYB6 protein and its encoding gene provided by the present invention can be used to cultivate lodging-resistant plant varieties, enrich soybean germplasm resources, and have important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Some soybeans provided in Example 1 of the present invention GmMYB6 The genomic and transcribed sequences of a gene; bold indicates exon sequences, italics indicate intron sequences, and ATG indicates the promoter.

[0017] Figure 2 Some soybeans provided in Example 1 of the present invention GmMYB6 The genomic and transcribed sequences of a gene; bold indicates exon sequences, italics indicate intron sequences, and TAG indicates a terminator.

[0018] Figure 3 Provided in Example 2 of the present invention GmMYB6 Knockout vector CPF1 - GmMYB6 Schematic diagram.

[0019] Figure 4 The expression provided in Example 2 of the present invention is GmMYB6 Diagram of gene editing types in gene knockout transgenic plants.

[0020] Figure 5 The wild type Williams 82 of Example 2 of the present invention and GmMYB6 CR1 , GmMYB6 CR2 Figure 2 shows the mutant phenotype and tissue section staining results.

[0021] Figure 6 The wild type Williams 82 of Example 2 of the present invention and GmMYB6 CR1 , GmMYB6 CR2 The results of the mutant stem strength test are shown in Figure 2. express P <0.0001.

[0022] Figure 7 This is a graph showing the results of measuring lignin content in wild-type and knockout transgenic materials provided in Example 2 of the present invention. express P <0.01.

[0023] Figure 8This is a graph showing the results of agronomic trait measurement of wild-type and knockout transgenic materials provided in Example 2 of the present invention. express P <0.01, express P <0.0001. DETAILED DESCRIPTION

[0024] The present invention aims to provide a GmMYB6 protein and application thereof in regulating stem strength.

[0025] The present invention adopts the following technical solutions: In a first aspect, the present invention provides a GmMYB6 protein, comprising: an amino acid sequence as shown in SEQ ID NO: 1.

[0026] Furthermore, the GmMYB6 protein is encoded by the nucleotide sequence (CDS sequence) described in SEQ ID NO: 2.

[0027] In a second aspect, the present invention provides a nucleic acid for encoding the GmMYB6 protein.

[0028] The nucleic acid includes genomic DNA, cDNA, recombinant DNA or mRNA, hnRNA encoding GmMYB6 protein; or a nucleic acid molecule that is reverse complementary to the above DNA, cDNA, recombinant DNA or mRNA.

[0029] The above nucleic acid molecules can be modified or optimized according to actual needs to make gene expression more efficient; for example, (1) the codons can be changed to conform to the preferences of the recipient plant while maintaining the amino acid sequence encoded by the nucleic acid of the present invention. (2) The gene sequence adjacent to the start methionine can be modified to enable efficient translation initiation; for example, the modification can be performed using a sequence known to be effective in plants. (3) It can be linked to various plant-expressed promoters to facilitate its expression in plants; the promoters can include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the temporal and spatial requirements of expression and also depends on the target species; (4) Enhancer sequences can be introduced, such as intron sequences (e.g., from Adhl and bronzel) and viral leader sequences (e.g., from TMV, MCMV and AMV).

[0030] Furthermore, the vector may be a plasmid, cosmid, phage or viral vector; and the transgenic cell does not have the ability to develop into a complete plant individual.

[0031] For those that do not contain GmMYB6Plants can be treated by chemical methods, shotgun methods, microinjection, electroporation and other methods. GmMYB6 Gene fragments can be introduced into plant cells, and can also be transferred through homologous recombination, zinc finger nuclease, TALEN, CRISPR and other methods. GmMYB6 The gene fragment is introduced into plant cells.

[0032] The present invention further provides a GmMYB6 Gene mutants.

[0033] The present invention further provides a biomaterial, which comprises the nucleic acid or the GmMYB6 Gene mutant; the biological material is an expression cassette, a vector or a transgenic cell.

[0034] In a third aspect, the present invention provides a kit comprising the GmMYB6 protein, or the nucleic acid, or the GmMYB6 Gene mutants, or one or more of the biological materials.

[0035] The present invention further provides the GmMYB6 protein, or the nucleic acid, or the GmMYB6 Application of the gene mutant, the biological material, or the kit in regulating plant stem strength.

[0036] The present invention further provides the GmMYB6 protein, or the nucleic acid, or the GmMYB6 Application of the gene mutant, or the biological material, or the kit in regulating the yield of a single plant.

[0037] The present invention further provides the GmMYB6 protein, or the nucleic acid, or the GmMYB6 Use of the gene mutant, or the biological material, or the kit in regulating the lignin content of plants.

[0038] Furthermore, the plant is soybean.

[0039] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0040] Example 1 GmMYB6 Gene cloning This embodiment provides a method for separating soybean GmMYB6 A method for identifying a gene and performing structural analysis thereof specifically includes the following steps: 1. GmMYB6 Gene isolation The present invention extracts total RNA from soybean variety Williams 82, uses the total RNA as a template, and uses Oligo(T)17 as a primer to synthesize the first strand of cDNA. PCR amplification is performed using the first strand of cDNA as a template using a forward primer (5'-ATGGGAAGATCCCCTTGT -3') and a reverse primer (5'- CTAAATGTTCATGGGTCTGTAA -3'). A 906 bp long cDNA fragment is obtained. GmMYB6 Gene cDNA fragment, the fragment was combined with pEasy - Blunt The carrier (Quanshi Gold Company) is connected and named Blunt - GmMYB6 .

[0041] Obtained GmMYB6 Gene, GmMYB6 The full length of the gene CDS is 906 bp, and the sequence is shown in SEQ ID NO: 2; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 1, which contains 301 amino acids.

[0042] 2. GmMYB6 Gene structure analysis DNA was extracted from young leaves of soybean variety Williams 82 and amplified using the genomic DNA as template. GmMYB6 Genome fragments, GmMYB6 The genome sequence is shown in SEQ ID NO: 3, with a total length of 2,650 bp, including 3 exons and 2 introns ( Figure 1 and Figure 2 ).

[0043] Example 2 GmMYB6 Gene function The present invention knocks out soybeans in soybeans GmMYB6 Gene, testing its application in soybean, the specific process is as follows: 1. Soybeans GmMYB6 Construction of gene knockout vector Build pFGC5941The backbone vector, which uses the GmU6 promoter to drive crRNA and the GmUbi3 promoter to drive the CRISPR / Cas12a protein, is a CRISPR / Cas12a vector. First, the target design is performed on the website https: / / cctop.cos.uni-heidelberg.de:8043 / . Since the result given by the website is 20bp in length, it is ultimately necessary to extend the 3' end by 2bp to make the crRNA length 22bp. Select a target with a suitable position and a high score, and further design the crRNA array. Subsequently, the DR sequence is added to the 5' and 3' ends of the selected crRNA for arrangement and synthesis, replacing the crRNAarray part in the original vector. After sequencing verification, the new CRISPR / Cas12a vector is finally obtained. The recombinant plasmid ( [[ID= The gene knockout vector was introduced into the wild-type soybean Williams 82 to knock out the target gene. ​ , build ​ The knockout vector of the gene was transformed into wild-type soybean Williams 82, and the knockout phenotype was observed to verify the candidate gene ( ​ ).

[0044] ​ The nucleotide sequence of the crRNA action site of the gene knockout vector is shown in SEQ ID NO: 4-8.

[0045] crRNA sequence shown in SEQ ID NO: 4: ATAGCTGCAAGGTTACCTGGAA crRNA sequence shown in SEQ ID NO:5: CCTGGAAGAACCGATAACGAAA crRNA sequence shown in SEQ ID NO:6: AATAATAGTGCTTATGCCAACA crRNA sequence shown in SEQ ID NO:7: CAGTTGGTGAATAATAGTGCTT crRNA sequence shown in SEQ ID NO: 8: ATAAACCTCCATAGCTTACTTG The above five gRNA sequences are driven by a promoter GmU6.

[0046] 2. Agrobacterium-mediated transformation of legumes In this embodiment, the soybean cotyledonary node was transformed by Agrobacterium-mediated method to obtain ​ Explants of wild-type soybean Williams 82 with knockout vector and ​For the explants of wild-type soybean Williams 82 overexpressing the vector, the specific process is as follows: (1) Obtaining soybean explants Mature, smooth, undamaged, spot-free, and crack-free wild-type soybean (Williams 82) seeds were sterilized with chlorine for 14 hours. The sterilized seeds were ventilated on a clean bench to completely evaporate the chlorine and then germinated on germination medium for 6 hours. Half of the hypocotyl was removed and the soybeans were cut longitudinally along the hypocotyl. The remaining hypocotyl served as the recipient material for Agrobacterium-mediated transformation.

[0047] (2) Soybean transformation Agrobacterium-mediated method uses secondary Agrobacterium infection to ​ Gene knockout vectors and ​ The gene overexpression vector was transformed into soybean. The plants were cultured in co-culture at 22°C in the dark for 3 days and in SI-I medium under strong light for 7 days. The large buds of the explants (wild-type soybean Williams 82) were removed and cultured in SI-II medium under strong light for 14 days. The cotyledons and hypocotyls of the explants were removed and subcultured every 14 days in SE medium. Approximately 3 cm-long buds were excised and placed in rooting medium for rooting. Plants with well-developed roots in RM rooting medium were transferred to soil for planting. Thirty resistant plants were screened for Bar resistance. After five months of greenhouse culture, pods began to mature, and the plants were harvested after six months.

[0048] (3) Genetically modified plants that can be inherited The results are as follows ​ As shown, the present invention planted the harvested T1 generation knockout transgenic seeds in a greenhouse and successfully obtained two transgenic plants (named ​ CR1 , ​ CR2 ).like ​ As shown, it can be observed that ​ The knockout vector was transformed into wild-type soybean Williams 82, and the stem strength of the transgenic plants was increased.

[0049] The present invention further studies the effects of wild-type soybean Williams 82 and ​ CR1 , ​ CR2 The mutants were tested for lignin content, and the results were as follows ​ As shown, compared with wild-type Williams 82, ​ CR1 , ​ CR2The lignin content of the mutant increased significantly.

[0050] The soybean wild type Williams 82 and ​ CR1 , ​ CR2 The agronomic traits of the mutants were statistically analyzed, and the results were as follows: ​ As shown, compared with wild-type Williams 82, ​ CR1 , ​ CR2 The oil content of the mutant increased significantly, and the yield per plant increased significantly.

[0051] In summary, the GmMYB6 protein and its encoding gene provided by the present invention can be effectively applied to the breeding of lodging-resistant and high-oil soybean varieties, play an important role in enriching soybean germplasm resources, and show significant application value.

[0052] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.

Claims

1. Any of the following applications of soybean GmMYB6 protein, its encoding gene, and biological materials containing said gene: (1) Used to regulate plant stem strength and lignin content; (2) Used to regulate plant oil content and single-plant yield; (3) Used for the cultivation of lodging-resistant plant varieties; The soybean GmMYB6 protein is: (A) a protein consisting of the amino acid sequence shown in SEQ ID NO: 1; or, (B) A protein derived from (A) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that The regulation is negative regulation.

3. The use according to claim 1 or 2, characterized in that The plant is soybean.

4. A method for increasing soybean stalk strength, lignin content, oil content, single plant yield, and lodging resistance, characterized in that: The method comprises: using genetic engineering means to weaken or knock out the gene in soybean GmMYB6 ; The gene GmMYB6 The nucleotide sequence is: I) the nucleotide sequence shown in SEQ ID NO: 3; II) a nucleotide sequence in which one or more nucleotides are substituted, deleted, and / or added to the nucleotide sequence of SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; III) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO: 3 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in 0.1× SSPE containing 0.1% SDS or 0.1× SSC containing 0.1% SDS at 65°C and the membrane is washed with the solution; or IV) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of I), II) or III) and expresses a protein with the same function.

5. The method according to claim 4, characterized in that The method comprises: GmMYB6 As the target, a crRNA sequence based on CRISPR-Cas12a was designed, and a DNA fragment containing the crRNA sequence encoding the crRNA sequence was connected to a vector carrying CRISPR-Cas12a to transform soybeans, thereby obtaining transgenic soybeans with the gene function missing.

6. The method according to claim 5, characterized in that The nucleotide sequence of the crRNA action site is shown in SEQ ID NO: 4-8.

7. Use of the transgenic soybean obtained according to the method according to any one of claims 4 to 6 in plant breeding.

8. The use according to claim 7, characterized in that Breeding methods include transgenics, hybridization, backcrossing, selfing or asexual reproduction.

Images