Application of GW5 gene promoter methylation in regulating rice grain length based on multi-omics gene mining technology

Abstract

The application provides a multi-omics gene mining technology-based method for detecting and regulating rice grain length GW5 The application relates to the technical field of biology, and relates to application of gene promoter methylation in regulation of rice grain length. The application is based on a pan-genome micro-core germplasm population, integrates multi-dimensional omics data such as genomes and epigenomes, constructs an epigenome atlas of rice, and uses stable methylation polymorphic markers in the atlas to combine with a rice grain width phenotype to perform multi-omics correlation analysis, successfully mines a new epiallele of a gene, discovers GW5 a new epiallele of a gene, and discovers GW5 that a high-methylation and low-methylation epigenetic state exists in an upstream promoter region of the gene in different rice germplasm backgrounds, and that after demethylation editing is performed on the region, a phenotype of significantly increased grain length is exhibited. Therefore, according to GW5 a methylation level of a promoter of the gene, detection of a rice grain length trait can be realized, and by regulating GW5 a methylation level of a promoter of the gene, regulation of a rice grain length trait can be realized.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a multi-omics gene mining technology. GW5 Application of gene promoter methylation in regulating rice grain length. Background Technology

[0002] Rice is the staple food for half the world's population and is also my country's most important food crop. Rice yield is mainly determined by thousand-grain weight, effective panicle number, and grain number per panicle. Grain shape, which affects thousand-grain weight, is also a crucial trait determining the appearance quality of rice. Rice appearance quality is mainly measured by indicators such as grain shape, chalkiness, and transparency, which influence consumer preference and determine the commercial value of rice. For a long time, the national standard for high-quality rice required a length-to-width ratio of 2.8 or higher for high-quality indica rice. Although the latest national standard for high-quality rice has removed this restriction, it has established specific grading standards for head rice rate and chalkiness. Both head rice rate and chalkiness are closely related to grain shape. Specifically, head rice rate shows a highly significant negative correlation with grain length and length-to-width ratio, and a significant positive correlation with grain width. Years of research have generally shown that chalkiness rate is positively correlated with grain width and negatively correlated with grain length. Therefore, in order to create high-quality rice germplasm, it is necessary to study the genes controlling grain shape.

[0003] In view of this, the present invention is hereby proposed. Summary of the Invention

[0004] The first objective of this invention is to provide GW5 The application of gene promoter methylation in regulating rice grain length traits aims to solve the aforementioned technical problems.

[0005] The second objective of this invention is to provide a method for regulating the grain length trait of rice.

[0006] A third objective of this invention is to provide the application of the above-described method in rice cultivation.

[0007] The fourth object of the present invention is to provide GW5 Application of gene promoter methylation level in detecting rice grain length trait.

[0008] To achieve the above objectives, the following technical solution is adopted:

[0009] In a first aspect, the present invention provides GW5 The application of gene promoter methylation in regulating rice grain length trait, the aforementioned GW5 The region where the gene promoter is methylated has a nucleotide sequence as shown in SEQ ID NO:3.

[0010] As a further technical solution, the aforementioned GW5 Gene promotersGW5 The nucleotide sequence of the gene is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0011] As a further technical solution, GW5 The promoter of the gene has a high methylation level, and the rice is short-grained;

[0012] GW5 The promoter of the gene has a low methylation level, and the rice is long-grained.

[0013] In a second aspect, the present application provides a method for regulating the long-grained trait of rice by regulating the methylation level of the promoter of the gene. GW5 The promoter of the gene has a low methylation level, and the rice is long-grained.

[0014] As a further technical solution, the promoter is demethylated by using a gene editing method, so that the length of the rice is increased.

[0015] As a further technical solution, the nucleic acid for gene editing comprises sgRNA.

[0016] The nucleotide sequence recognized by the sgRNA is shown as SEQ ID NO: 4.

[0017] In a third aspect, the present application provides application of the above method in the creation of rice.

[0018] In a fourth aspect, the present application provides GW5 The promoter of the gene has a low methylation level, and the rice is long-grained. GW5 The region of the promoter of the gene that is methylated has a nucleotide sequence shown as SEQ ID NO: 3.

[0019] As a further technical solution, the GW5 The promoter of the gene is demethylated to GW5 The nucleotide sequence of the gene is shown as SEQ ID NO: 1 or SEQ ID NO: 2.

[0020] As a further technical solution, GW5 The promoter of the gene has a high methylation level, and the rice is short-grained;

[0021] GW5 The promoter of the gene has a low methylation level, and the rice is long-grained.

[0022] Compared with the prior art, the present application has the following beneficial effects:

[0023] This invention, based on a pan-genome microcore germplasm population, integrates multi-omics data including genomics and epigenomics to construct a rice epigenome map. Utilizing stable single-methylation polymorphisms (SMP) markers within this map, combined with rice grain width phenotype, multi-omics association analysis was performed, successfully identifying... GW5 New epigenetic alleles of the gene were discovered. GW5 The upstream promoter region of the gene exhibits two epigenetic states: hypermethylation and hypomethylation, across different rice germplasm backgrounds. To verify the function of this epigenetic allele, this invention performed targeted DNA demethylation editing on this characteristic region in rice materials from two different genetic backgrounds. The edited materials all showed a phenotype with a significant increase in grain length. Therefore, based on... GW5 The level of promoter methylation of genes can be used to detect the grain length trait in rice, and can be regulated by... GW5 The level of promoter methylation of genes can regulate the grain length trait of rice, providing a new method for the creation of high-quality rice germplasm. Attached Figure Description

[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0025] Figure 1 yes GW5 Manhattan plot of EWAS results showing the relationship between gene CG methylation level and grain width phenotype;

[0026] Figure 2 This is a schematic diagram of a demethylation carrier;

[0027] Figure 3 They are from two different genetic backgrounds GW5 Demethylation status of genes in T3 generation transgene-free positive mutants;

[0028] Figure 4 They are from two different genetic backgrounds GW5 Granule length phenotype of the gene in T3 generation transgene-free positive mutants;

[0029] Figure 5 They are from two different genetic backgrounds GW5 The relative expression level of the gene in the T3 generation of transgene-free positive mutants. Detailed Implementation

[0030] The embodiments and examples of the present invention will be described in detail below. However, those skilled in the art will understand that the following embodiments and examples are for illustrative purposes only and should not be considered as limiting the scope of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention. Unless otherwise specified, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0031] DNA methylation is a form of DNA chemical modification that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent bonding of a methyl group to the 5th carbon position of the cytosine of a CpG dinucleotide in the genome, under the action of DNA methyltransferases. Numerous studies have shown that DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

[0032] In a first aspect, the present invention provides GW5 The application of gene promoter methylation in regulating rice grain length trait, the aforementioned GW5 The promoter methylation region of the gene has a nucleotide sequence as shown in SEQ ID NO:3:

[0033] CGTTGTAGACCTTAAGCTTACTGTTTCATCTTAAACAAAATTAACATCGGCGGTCATTGAGCAAATTGTCAACTATCTTGAATAAAAGGGACACTATTACAACTAGTGATCCCATAAATAAACTTCTGAAATTCTTCGATCTCTTTTCTTTGCTTGCCCAATTTCTTTCTTGCTTGTGCGATCCATGGCCAAAAGCCTTTCAGCCATCTCAATATCTAGCTTCGT (SEQ ID NO: 3).

[0034] The inventor discovered through research that GW5 High levels of promoter methylation in the gene result in short rice grains; GW5 Low promoter methylation levels in rice genes result in longer grains. Therefore, by regulating... GW5 The level of methylation of gene promoters can regulate the grain length trait in rice.

[0035] In some alternative implementations, the GW5 Gene promoters GW5The nucleotide sequence of the gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0036] In a second aspect, the present application provides a method for regulating the grain length trait of rice by regulating the methylation level of the promoter of the gene. GW5 The methylation level of the region of the nucleotide sequence shown in SEQ ID NO: 3 on the promoter of the gene changes the grain length trait of rice.

[0037] The method can effectively regulate the grain length trait of rice by regulating the methylation level of the promoter of the gene. GW5 The method can effectively regulate the grain length trait of rice by regulating the methylation level of the promoter of the gene.

[0038] In some optional embodiments, the promoter is de-methylated by using a gene editing method, so that the grain length of rice is increased.

[0039] The method for regulating the methylation level of the promoter is not specifically limited in the present application, and any method known to those skilled in the art can be used.

[0040] In some optional embodiments, the nucleic acid for gene editing comprises sgRNA.

[0041] The sequence recognized by the sgRNA is shown in SEQ ID NO: 4:

[0042] AATCGACTCCCAGAAATCGG (SEQ ID NO: 4).

[0043] In some optional embodiments, the gene editing uses a SunTag-dCas9-TET1cd fusion system (reference: Shanjie Tang, Chao Yang, Dong Wang, et al. Targeted DNA demethylation produces heritable epialleles in rice. SCIENCE CHINA Life Sciences, 2022, 65(4): 753-756.).

[0044] In a third aspect, the present application provides the use of the above method in the creation of rice.

[0045] The method provided by the present application can regulate the grain length trait of rice, and is further used for the creation of high-quality rice germplasm.

[0046] In a fourth aspect, the present application provides the use of the methylation level of the promoter of the gene in the detection of the grain length trait of rice. GW5 The methylation level of the promoter of the gene is used in the detection of the grain length trait of rice. GW5The region of the promoter methylation of the gene has a nucleotide sequence as shown in SEQ ID NO: 3.

[0047] The inventors found through research that, GW5 The promoter methylation level of the gene is high, and the rice grain is short; GW5 The promoter methylation level of the gene is low, and the rice grain is long. Therefore, GW5 The promoter methylation level of the gene can be used as a marker for the rice grain length trait, and the rice grain length trait can be detected by detecting GW5 The promoter methylation level of the gene can be used as a marker for the rice grain length trait, and the rice grain length trait can be detected by detecting

[0048] In some optional embodiments, the promoter of the gene is GW5 The promoter of the gene is GW5 The nucleotide sequence of the gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0049] The present application will be further described below through specific examples, but it should be understood that these examples are only for more detailed description and should not be understood as limiting the present application in any form.

[0050] Example 1

[0051] (1) Whole genome sequencing (WGS) and whole genome bisulfite sequencing (WGBS) were performed on leaf DNA of rice population materials

[0052] The present application selects 202 micro-core germplasm of cultivated rice from 32 countries for research, including 143 indica rice and 59 japonica rice. The resource library is based on 208 germplasm materials used in the previous super pan-genomic study (reference: Lianguang Shang, Xiaoxia Li, Huiying He, Qiaoling Yuan, Yanni Song, Zhaoran Wei, Hai Lin, Min Hu, Fengli Zhao, et al. A super pan-genomic landscape of rice. Cell Research. 2022, 32:878-896.), with 11 indica rice and 2 japonica rice added. All germplasm materials were cultivated in a controlled environment greenhouse, with specific conditions being: 16 hours of 30℃ light period and 8 hours of 25℃ dark period per day, and Kimura B nutrient solution with a pH value of 5.6 was used for hydroponics. When the seedlings grew to 1 month old, mature leaves were collected for extraction of genomic DNA.

[0053] The extracted genomic DNA was subjected to the following two sequencing analyses: first, whole genome sequencing was performed, and after quality control of the WGS raw sequencing data of 202 rice materials by Trimmomatic software, the software BWA was used for alignment to the rice Nipponbare reference genome (MSUv7), and then the software SAMtools and BCFtools were used to extract SNP sites. Based on the homologous SNP variation filtering results of each germplasm material, the BCFtools tool was used to replace these variation sites to the corresponding sites of the reference genome, thereby constructing a pseudo-reference genome for each germplasm. The WGBS raw sequencing data was also subjected to quality control by Trimmomatic software, and after quality control, the high-quality WGBS data was aligned to the pseudo-reference genome of each material by Bowtie2, and only uniquely mapped sequences were retained. After removing duplicate alignment signals at the same genomic location, Bismark software was used for cytosine methylation site identification, and the methylation level of each methylation site was calculated.

[0054] (2) Identification of differentially methylated regions (DMRs) between populations

[0055] DMRs were identified using the metilene software, and the specific screening criteria were as follows: 1) each DMR contained at least 8 cytosine sites; 2) the maximum distance between adjacent cytosine sites was less than 300 base pairs; 3) covered more than half of the subpopulations. The intergroup comparison of DNA methylation level used Mann-Whitney U test, and the obtained p value was corrected for multiple testing by Benjamini-Hochberg method. DMRs with FDR < 0.01 were screened, and finally regions meeting the following methylation level difference threshold were retained: 1) CG and CHG types: absolute difference value ≥ 0.3; 2) CHH type: absolute difference value ≥ 0.2.

[0056] (3) Epigenome-wide association study (EWAS) and DMR co-localization analysis

[0057] EWAS software was used to perform association analysis of the methylation sites of the indica rice subpopulation and the grain width traits collected at multiple test sites. In the analysis, methylation sites with a deletion rate higher than 80% in the material population were excluded. The results showed that a total of 288 significant CG methylation epigenetic sites were identified, which were located on 63 genes. The present application further intersected these EWAS significant CG sites with the DMRs between the indica and japonica populations, and finally screened out 13 epialleles. Among them, the major gene GW5 ( GW5The promoter region of this gene contains a DMR (corresponding to the Chr5:5,363,033-5,363,256 region of the Nipponbare genome), and its specific sequence information can be found in SEQ ID NO:3.

[0058] (4) Figure 1 Gene demethylation editing

[0059] To determine whether DMR affects rice GW5 For gene expression, this invention selected two strains as the genetic background for epigenome editing: Jiangnongzao 1 B (NH214) (sequence characteristics conform to SEQ ID NO:1), which is a strain with a high level of DMR region methylation. GW5 Low expression levels and narrow grains in indica rice lines; and Nipponbare (NIP) (sequence characteristics conform to SEQ ID NO:2), which also has high methylation levels in the DMR region. GW5 The expression level is low and the particle width is relatively wide. This invention uses the SunTag-dCas9-TET1cd fusion system (Reference: Shanjie Tang, Chao Yang, Dong Wang, et al. Targeted DNA demethylation produces heritable epialleles in rice. SCIENCECHINA Life Sciences, 2022, 65 (4): 753-756.). GW5 DNA demethylation editing was performed. An sgRNA targeting this DMR region was designed using the TargetDesign website (http: / / skl.scau.edu.cn / targetdesign), with the recognition sequence 5'-AATCGACTCCCAGAAATCGG-3' (SEQ ID NO:4). Since there are no conserved targets within the DMR, this sequence is located in the 200 bp region flanking the DMR. Figure 2 The dCas9-TET1 complex is guided by sgRNA to the target site, where TET1 enzyme catalyzes the demethylation of cytosine. TET1 enzyme activity affects the region surrounding the sgRNA target site. WGBS sequencing confirmed that the T3-representing editing strain successfully achieved demethylation in this target region, covering the entire DMR (dCas9-TET1 complex). Figure 3 CY86 refers to the demethylated T3 generation of NH214; GN16-2-1 and GN16-2-2 are the demethylated T3 generation of NIP. Seeds from the vector-free T3 generation showed increased grain length in both genetic background epigenetic mutants. Figure 3 The expression level was 2-4 times higher than that of wild type.GW5 Figure 4 wherein CY80 and CY86 refer to the desmethyl T3 generation of NH214; GN16-2-1, GN16-2-2, GN5-2-2 and GN5-2-3 refer to the desmethyl T3 generation of NIP). These results confirm that Figure 5 GW5 The DMR in the promoter region of the locus has a negative regulatory effect on regulating grain length.

[0060] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.​

Claims

1. Use of sgRNA in modulating the promoter methylation level of a rice GW5 gene in modulating the grain length trait in rice, characterized in that, The GW5 The region of the promoter of the gene has a nucleotide sequence as shown in SEQ ID NO: 3; the nucleotide sequence recognized by the sgRNA is as shown in SEQ ID NO: 4; GW5 The level of promoter methylation of the gene is high, and the rice grain is short; GW5 Low promoter methylation level of the gene, rice grain length.

2. A method of modulating grain length trait in rice, characterized in that, By regulating the methylation level of the region of nucleotide sequence as shown in SEQ ID NO: 3 on the promoter of the rice GW5 OsSPL16 gene, the grain length trait of rice is changed; The method de-methylates the promoter by using a gene editing method, so that the grain length of the rice is lengthened; The nucleic acid used in the gene editing comprises an sgRNA; The nucleotide sequence recognized by the sgRNA is shown in SEQ ID NO:

4.

3. The method of claim 2 is applied in the creation of rice.

Images