Glycosyl transferase mutant and application thereof in synthesis of rebaudioside M

Abstract

The invention relates to the technical field of gene engineering, in particular to a glycosyl transferase mutant and application thereof in synthesis of rebaudioside M. Wild type glycosyl transferase is modified through a directed evolution theory to obtain the glycosyl transferase mutant, so that the efficiency of synthesizing rebaudioside D through reaction of rebaudioside A is effectively improved. Besides, recombinant bacteria capable of simultaneously expressing the glycosyl transferase mutant, a second glycosyl transferase gene and a sucrose synthase gene are constructed, a wet cell obtained by induced culture of the recombinant bacteria or a crude enzyme liquid extracted by crushing the wet cell is used as a catalyst, rebaudioside A is used as a substrate, sucrose is used as an auxiliary substrate, and the rebaudioside M is catalytically synthesized by a one-pot method. According to the present invention, the complete catalysis of 100 g / L of rebaudioside A to produce rebaudioside M only needs 24 h, the conversion rate reaches 97.5%, the yield of rebaudioside M reaches 130 g / L, the raw material conversion rate and the yield of rebaudioside M are effectively improved, and the synthesis time is shortened.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a glycosyltransferase mutant and application thereof in synthesizing rebaudioside M. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Steviol glycosides (also known as steviol glycosides) are sweeteners extracted from Stevia rebaudiana Bertoni. They have the advantages of high sweetness (e.g., 250 to 450 times sweeter than sucrose), low calories (e.g., only 1 / 300 of the calories of white sugar), economical use (only one-third of the price of sucrose), stability (heat-resistant, acid-resistant, alkali-resistant, and not easily decomposed), safety (no toxic side effects), and non-participation in lipid metabolism in the human body. They also have anti-hypertensive, anti-inflammatory, and anti-tumor effects. Therefore, they have a wide range of uses and high commercial value.

[0004] Steviosides share a common steviol unit. By adding varying numbers and types of glycosyl groups at the C-13 and C-19 positions of the steviol unit, a variety of steviol glycosides with varying tastes and physical and chemical properties are formed. Because stevioside and rebaudioside A have a bitter aftertaste, rebaudioside D and rebaudioside M are considered more ideal sweeteners. In terms of sweetness and taste, rebaudioside M is superior to rebaudioside D and rebaudioside A.

[0005] Because rebaudioside M is present in very low concentrations in plants, it cannot be extracted through plant-based methods. Furthermore, chemical synthesis methods are complex, energy-intensive, and environmentally harmful, hindering the large-scale production of rebaudioside M. Biotransformation of steviol glycosides is currently the most cost-effective method for industrial production of steviol glycosides. Methods for biotransformation of steviol glycosides include enzymatic synthesis. However, most published enzymatic synthesis methods use rebaudioside D as a substrate. However, the content of rebaudioside D in stevia leaves is very low, making the cost prohibitive. Rebaudioside A is the most abundant steviol glycoside in commercial stevia leaves. Therefore, enzymatic synthesis of rebaudioside M using rebaudioside A as a raw material could significantly reduce production costs. Furthermore, the enzymes currently used for enzymatic synthesis of steviol glycosides are primarily wild-type enzymes derived from plant cells. These wild-type enzymes often suffer from low activity and poor stability, leading to high costs for industrial-scale production of steviol glycosides. Therefore, it is necessary to improve glucosyltransferase to obtain modified enzymes with higher enzyme activity and better stability, so as to better serve industrial-scale production. Summary of the Invention

[0006] In order to overcome the above problems, the present invention provides a glycosyltransferase mutant and its application in the synthesis of rebaudioside M.

[0007] In order to achieve the above technical objectives, the present invention adopts the following technical solutions: In a first aspect of the present invention, a glycosyltransferase mutant is provided, which is obtained by mutating the aspartic acid at position 66 of the wild-type glycosyltransferase shown in the amino acid sequence of SEQ ID NO.2 to glutamic acid, the asparagine at position 134 to serine, the cysteine ​​at position 167 to isoleucine, the isoleucine at position 216 to valine, and the asparagine at position 316 to glycine.

[0008] The second aspect of the present invention provides a gene encoding the glycosyltransferase mutant described in the first aspect.

[0009] The third aspect of the present invention provides an expression cassette comprising the gene described in the second aspect.

[0010] The fourth aspect of the present invention provides a recombinant expression vector comprising the gene described in the second aspect.

[0011] The fifth aspect of the present invention provides a recombinant bacterium comprising the gene described in the second aspect.

[0012] The sixth aspect of the present invention provides a transgenic cell line comprising the gene described in the second aspect.

[0013] The seventh aspect of the present invention provides the use of the glycosyltransferase mutant described in the first aspect, the gene described in the second aspect, or the recombinant bacteria described in the fifth aspect in catalyzing the synthesis of rebaudioside D and rebaudioside M.

[0014] An eighth aspect of the present invention provides a method for catalytically synthesizing rebaudioside D, comprising the following steps: Rebaudioside D is synthesized by reacting the wet cells obtained by induced culture of the recombinant bacteria described in the fifth aspect or the crude enzyme solution extracted by crushing the wet cells as a catalyst and rebaudioside A and uridine diphosphate glucose (UDP-glucose) as substrates.

[0015] In one or more embodiments, the reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7-8, preferably a pH of 7.5; the reaction temperature is 35-45°C, preferably 40°C; and the reaction speed is 400-600 rpm, preferably 500 rpm.

[0016] In one or more embodiments, the amount of the catalyst used is 5-45 g / L based on the total weight of the wet cells; the final concentration of rebaudioside A is 80-120 g / L, and the final concentration of UDP-glucose is 50-70 g / L.

[0017] A ninth aspect of the present invention provides a method for catalytically synthesizing rebaudioside M, comprising the following steps: (1) A recombinant expression vector comprising the gene described in the second aspect, a recombinant expression vector comprising a second glycosyltransferase gene, and a recombinant expression vector comprising a sucrose synthase gene are co-transferred into an introduction host bacterium to obtain a recombinant bacterium; the amino acid sequence of the second glycosyltransferase gene is shown in SEQ ID NO. 8, and the amino acid sequence of the sucrose synthase gene is shown in SEQ ID NO. 10; (2) Rebaudioside M is synthesized by reaction using wet cells obtained by induced culture of the recombinant bacteria constructed in step (1) or crude enzyme solution extracted by crushing the wet cells as a catalyst, rebaudioside A as a substrate, and sucrose as a cosubstrate.

[0018] In one or more embodiments, the reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7-8, preferably a pH of 7.5; the reaction temperature is 35-45°C, preferably 40°C; and the reaction speed is 200-500 rpm, preferably 300 rpm.

[0019] In one or more embodiments, the amount of the catalyst used is 5-60 g / L based on the total weight of the wet cells; the final concentration of rebaudioside A is 50-120 g / L, and the final concentration of sucrose is 50-150 g / L.

[0020] The beneficial effects of the present invention are: (1) In the present invention, the wild-type glycosyltransferase was modified by directed evolution theory to obtain a glycosyltransferase mutant, which effectively improved the efficiency of synthesizing rebaudioside D in the reaction using rebaudioside A and UDP-glucose as substrates. Specifically, the catalytic efficiency of the glycosyltransferase mutant was increased by 18 times.

[0021] (2) In the present invention, a recombinant bacterium that simultaneously expresses a glycosyltransferase mutant, a second glycosyltransferase gene, and a sucrose synthase gene was constructed. The wet cells obtained by induction culture of the recombinant bacterium or the crude enzyme solution extracted by crushing the wet cells were used as catalysts, rebaudioside A was used as substrate, and sucrose was used as cosubstrate to catalyze the synthesis of rebaudioside M in a one-pot process. The glycosyltransferase mutant can catalyze rebaudioside A to obtain rebaudioside D, and the second glycosyltransferase gene can catalyze rebaudioside D to synthesize rebaudioside M. The sucrose synthase constructs a sucrose synthase-UDP glucose coenzyme cycle system, providing glucose glycosyl for the synthesis of rebaudioside D from rebaudioside A and for the synthesis of rebaudioside M from rebaudioside D. It only takes 24 hours to completely catalyze 100 g / L of rebaudioside A to produce rebaudioside M, with a conversion rate of 97.5% and a rebaudioside M yield of 130 g / L. This effectively improves the raw material conversion rate and rebaudioside M yield, while shortening the synthesis time. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0023] Picture 1 This is the reaction process diagram of the co-expression strain catalyzing rebaudioside RA to rebaudioside RM. DETAILED DESCRIPTION

[0024] It should be noted that the following detailed descriptions are exemplary and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0025] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.

[0026] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0027] The culture medium formulations and HPLC detection methods used in the following examples are as follows: LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, solvent is water, pH 7.4.

[0028] LB plate: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 18 g / L agar, solvent is water, pH 7.4.

[0029] The concentration of the product rebaudioside M was detected by high performance liquid chromatography (HPLC). The analysis method was as follows: chromatographic column model: QS-C18, 5 μm, 4.6×250 mm; mobile phase: A (water): B (acetonitrile) = 68:32; injection volume: 10 μL; detection wavelength: 210 nm; detection time: 18 min; flow rate: 0.5 mL / min; column temperature: 40°C.

[0030] Example 1 A glycosyltransferase from Solanum tuberosum (potato) was retrieved from the NCBI database. The NCBI accession number is NP_001274852.1, the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2. The whole gene synthesis was commissioned to Nanjing GenScript Biotechnology Co., Ltd.

[0031] Primers F1, R1, F2 and R2 were designed based on the nucleotide sequence shown in SEQ ID NO.1 and the pET-28a vector sequence; the F1 nucleotide sequence is shown in SEQ ID NO.3, the R1 nucleotide sequence is shown in SEQ ID NO.4, the F2 nucleotide sequence is shown in SEQ ID NO.5, and the R2 nucleotide sequence is shown in SEQ ID NO.6.

[0032] F1 (SEQ ID NO. 3): ctttaagaaggagatataccATGAATACACATAAAGCTCACTGTCTAATAC; R1 (SEQ ID NO. 4): tggtggtggtggtgctcgagTTACTTCGGAGAGATGGTGACCA; F2 (SEQ ID NO.5): CTCGAGCACCACCACCACC; R2 (SEQ ID NO.6): GGTATATCTCCTTCTTAAAGTTAAACAAAAT; The pET-28a plasmid was used as the expression vector to construct Escherichia coli E. coli BL21(DE3) / pET-28a-StUGT.

[0033] Construction of the expression plasmid: Under priming with primers F1 / R1 and F2 / R2, the nucleotide sequence shown in SEQ ID NO.1 was used as a template and high-fidelity Pfu DNA polymerase was used for amplification to obtain the glycosyltransferase gene sequence with homology arms. The pET-28a plasmid was used as a template and high-fidelity Pfu DNA polymerase was used for amplification to obtain the linearized vector sequence. The target gene and the linearized vector were homologously recombined using a homologous recombinase to construct the plasmid pET-28a-StUGT.

[0034] Preparation of competent cells: Obtain glycerol tubes stored in a -80 ℃ freezer. E. coli BL21(DE3) strain was streaked on an antibiotic-free LB plate and cultured at 37°C for 10 h to obtain a single colony; a single colony on the LB plate was picked and inoculated into a test tube containing 5 mL of LB liquid medium and cultured at 37°C and 180 rpm for 9 h; 200 μL of bacterial solution was taken from the test tube and inoculated into 50 mL of LB liquid medium and cultured at 37°C and 180 rpm to obtain an OD 600 to 0.4-0.6; pre-cool the bacterial solution on ice, transfer the bacterial solution to a sterile centrifuge tube, place on ice for 10 min, and centrifuge at 5000 rpm at 4°C for 10 min; pour off the supernatant, taking care to prevent contamination, resuspend the pelleted cells with pre-cooled 0.1 mol / L CaCl2 aqueous solution, and place on ice for 30 min; centrifuge at 5000 rpm at 4°C for 10 min, discard the supernatant, resuspend the pelleted cells with pre-cooled 0.1 mol / L CaCl2 aqueous solution containing 15% (volume fraction) glycerol, and aliquot 100 μL of the resuspended cells into a sterile 1.5 mL centrifuge tube. Store in a -80°C refrigerator and remove when needed.

[0035] Construction of recombinant Escherichia coli: First, the Escherichia coli BL21 (DE3) competent cells stored at -80 °C were placed in an ice bath at 0 °C for 10 min. Then, 5 μL of the ligation product was added in a clean bench, ice bathed at 0 °C for 30 min, heat-shocked in a 42 °C water bath for 90 s, and ice bathed at 0 °C for 2 min. 600 μL of LB medium was added and cultured at 37 °C and 200 rpm for 1 h. The cells were spread on LB plates containing 50 μg / mL kanamycin resistance and cultured at 37 °C for 8-12 h. Clones were randomly picked to extract plasmids for sequencing and identification, and recombinant Escherichia coli containing the recombinant plasmid were screened. E. coli BL21(DE3) / pET-28a-StUGT.

[0036] Example 2 Inducible expression of glycosyltransferases The recombinant Escherichia coli obtained in Example 1 was E. coli BL21(DE3) / pET-28a-StUGT was inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 200 rpm for 12 h. Then, 1% (v / v) inoculum was inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance and cultured at 37°C and 200 rpm until the bacterial OD 600 When the pH value reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added at a final concentration of 0.1 mM, and the culture was induced at 25 °C for 16 h. The culture was centrifuged at 4 °C and 8000 rpm for 20 min, the supernatant was discarded, and the precipitate was collected to obtain the recombinant strains containing glycosyltransferase and sucrose synthase, respectively. E. coli Wet cells of BL21(DE3) / pET-28a-StUGT were resuspended in 100 mM phosphate buffer (pH 7.5) and disrupted by sonication over ice-water for 5 minutes at 200 W for 1 second and a 2-second pause to obtain a crude enzyme solution.

[0037] Example 3: Establishment of a glycosyltransferase gene mutation library (1) Site-directed mutagenesis: constructed according to Example 1 E. coli BL21(DE3) / pET-28a-StUGT was used as the starting strain and modified by directed evolution theory. The R33G / F44V / D66E / D67G / F82L / N134S / C167I / I205C / I216V / H242E / I268K / N316G / T324K / I371G / S454E sites were selected for site-directed mutagenesis. The primers were designed as shown in Tables 1 and 2.

[0038] The mutant PCR system (100 μL) is as follows: 2x Phanta Max buffer 25 μL, dNTPs 1 μL, mutant upper and lower primers 1 μL each, template (starting strain) 1 μL, Pfu DNA polymerase 0.5 μL, and ddH2O to 50 μL. The PCR conditions are as follows: 95 °C pre-denaturation for 3 min, 30 cycles of 95 °C for 15 s, 60 °C for 15 s, 72 °C for 7 min 20 s, and finally 72 °C for 10 min. The PCR results are verified by DNA agarose gel electrophoresis, and the PCR product is subjected to DpnI enzyme digestion of the template at 37 °C for 1 h, 200 rpm, 65 °C for 1 min inactivation, heat shock transformation, and E. coli E. coli The BL21 (DE3) is activated and placed at 37 °C, 200 rpm, and cultured for 1 h, then spread on an LB plate containing 50 μg / mL kanamycin resistance and incubated at 37 °C overnight.

[0039] Table 1 Design of glycosyltransferase site-directed mutation primers

[0040] Table 2 Design of glycosyltransferase site-directed mutation primers

[0041] Example 4 Screening of glycosyltransferase gene mutation library The single colonies are picked from the plate obtained in Example 3, inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance, and cultured at 37 °C, 200 rpm for 12 h. The preserved strain is sequenced and verified by a sequencing company. After verification, the preserved strain is inoculated into LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 0.2% (v / v), cultured at 37 °C, 200 rpm for 12 h, then inoculated into fresh LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 1% (v / v), and cultured at 37 °C, 200 rpm until the OD 600 The wet bacteria of the glycosyltransferase gene mutation library are obtained by centrifugation at 4 °C, 8000 rpm for 20 min, and the supernatant is discarded. The wet bacteria are resuspended in phosphate buffer with a pH of 7.5 and a concentration of 100 mM, and are ultrasonically broken for 5 min on an ice-water mixture. The ultrasonic breaking conditions are as follows: power of 200 W, breaking for 1 s, and pausing for 2 s. The StUGT crude enzyme solution is obtained.

[0042] (1) StUGT initial screening: Prepare the reaction solution (200 μL): the final concentration of substrate rebaudioside A is 50 g / L, the final concentration of UDP-glucose is 30 g / L, the catalyst amount is 10 g / L based on the total weight of wet cells before crushing, and the reaction medium is phosphate buffer at pH 7.5. Reaction conditions: After the reaction is carried out in a reactor at 40°C and 500 rpm for 3 h, 20 μL of the reaction sample is taken after the reaction is completed, diluted 10 times, and the reaction is terminated by adding 16 μL of 2 M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution. The sample is filtered through a 0.22 μm filter membrane and detected by HPLC. The test results are shown in Table 3.

[0043] Table 3 Preliminary screening reaction results

[0044] (2) StUGT rescreening: The strains obtained in the initial screening were rescreened, and the rescreened combined mutants were sent to the sequencing company for sequencing verification. After the sequencing verification was correct, the activity verification was performed. The rescreening reaction solution (5 mL) was prepared as follows: the final concentration of substrate rebaudioside A was 100 g / L, the final concentration of UDP-glucose was 60 g / L, the amount of catalyst was 10 g / L based on the total weight of the wet bacteria before crushing, and the reaction medium was phosphate buffer at pH 7.5. Reaction conditions: After reacting in a reactor at 40 °C and 500 rpm for 2 hours, 20 μL of the reaction sample was taken after the reaction was completed, diluted 20 times, and 16 μL of 2M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution were added to terminate the reaction. The sample was filtered through a 0.22 μm filter membrane and tested by HPLC. The test results are shown in Table 4. The strain with the highest activity was obtained. E. coli BL21(DE3) / Pet-28a-StUGT-D66E-N134S-C167I-I216V-N316G.

[0045] Table 4 Rescreening reaction results

[0046] Example 5: Construction of co-expression strain - one-pot catalytic synthesis of rebaudioside M A co-expression strain was constructed, and rebaudioside A was used as a substrate. Under the action of the co-expression strain, rebaudioside M was catalyzed and synthesized in one pot.

[0047] (1) Construction of expression vector and engineered bacteria: Gene acquisition: Through gene library mining, a second glycosyltransferase (abbreviated as SrUGT, ​​catalyzing rebaudioside D to rebaudioside M) from Stevia rebaudiana was screened, with accession number ACM47734.1. Directed evolution was used to obtain a high-activity strain SrUGT-L85G-S136K-R140P-L175D-A239V-Y422E. The nucleotide sequence of the SrUGT mutant is shown in SEQ ID NO.7, and the amino acid sequence is shown in SEQ ID NO.8. A sucrose synthase from Methylocaldum szegediense was mined, with NCBI accession number WP_317963626.1. Directed evolution was used to obtain a high-activity strain MsSUS-G61D-V112A-T225R-F324R-Q459K-T549P-T733C. The nucleotide sequence of the MsSUS mutant is shown in SEQ ID NO. The amino acid sequence is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10.

[0048] Plasmid construction: To achieve the highest catalytic efficiency of the co-expression strains, various co-expression strains were constructed. The specific plasmid combinations are shown in Table 5. All expression plasmids were constructed using homologous recombination. The primers are shown in Table 6.

[0049] Plasmid construction for combination 1: Primers 11 and 12 were used to amplify the target gene MsSUS mutant as a template using high-fidelity Pfu DNA polymerase to obtain the NmXI target gene sequence with homology arms to the first multiple cloning site (NcoI-NotI) of PACduet. Simultaneously, primers 13 and 14 were used to amplify the plasmid vector PACduet as a template using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence of the first multiple cloning site of PACduet. The target gene and the linearized vector were then homologously recombined using a homologous recombinase to construct the recombinant plasmid PACduet-MsSUS mutant, which was then verified by sequencing.

[0050] The MsSUS mutant target gene sequence with the second multiple cloning site (NdeI-XhoI) homologous arm of PACduet was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 15 and 16 using the MsSUS mutant target gene as the template, the linearized vector sequence of the second multiple cloning site of PACduet was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 17 and 18 using the plasmid vector PACduet-MsSUS mutant as the template, and the target gene was homologously recombined with the linearized vector using a homologous recombination enzyme to construct the recombinant plasmid PACduet-MsSUS mutant-MsSUS mutant, which was sequenced and verified.

[0051] The StUGT mutant target gene sequence with the first multiple cloning site (NcoI-NotI) homologous arm of pETduet was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 19 and 20 using the StUGT mutant target gene as the template, the linearized vector sequence of the first cloning site of pETduet was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 21 and 22 using the plasmid vector pETduet as the template, and the target gene was homologously recombined with the linearized vector using a homologous recombination enzyme to construct the recombinant plasmid pETduet-StUGT mutant, which was sequenced and verified. The SrUGT mutant target gene sequence with the second multiple cloning site (NdeI-XhoI) homologous arm of pETduet was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 23 and 24 using the target gene as the template, the linearized vector sequence of the second multiple cloning site of pETduet with the SrUGT mutant was obtained by amplification with high-fidelity Pfu DNA polymerase under the priming of primers 25 and 26 using the plasmid vector pETduet-StUGT mutant as the template, and the target gene was homologously recombined with the linearized vector using a homologous recombination enzyme to construct the recombinant plasmid pETduet-StUGT mutant-SrUGT mutant, which was sequenced and verified.

[0052] Plasmid construction combination 2-3: refer to the construction method of plasmid 1, and the primers are shown in Table 6.

[0053] Table 5: recombinant plasmid construction combination table

[0054] Table 6: primer design

[0055] Construction of recombinant co-expression strains: First, the E. coli BL21 (DE3) competent cells stored at -80 ℃ were thawed at 37 ℃ for 1 h, then 5 μL of the recombinant plasmid was added in an ultra-clean bench at 0 ℃ for 10 min, then 0 ℃ for 30 min, 42 ℃ water bath for 90 s, 0 ℃ for 2 min, 600 μL of LB liquid medium was added, and the mixture was cultured at 37 ℃ and 200 rpm for 1 h; then it was spread on LB plates containing the corresponding resistance (Table 7), and incubated at 37 ℃ for 8-12 h. Randomly selected clones were extracted for plasmid sequencing and identification, and three recombinant E. coli BL21 (DE3) strains containing the expression recombinant plasmid were obtained. E. coli BL21 (DE3) competent cells were incubated at 0 ℃ for 10 min, then 5 μL of the recombinant plasmid was added in an ultra-clean bench at 0 ℃ for 30 min, then 42 ℃ water bath for 90 s, 0 ℃ for 2 min, 600 μL of LB liquid medium was added, and the mixture was cultured at 37 ℃ and 200 rpm for 1 h; then it was spread on LB plates containing the corresponding resistance (Table 7), and incubated at 37 ℃ for 8-12 h. Randomly selected clones were extracted for plasmid sequencing and identification, and three recombinant E. coli BL21 (DE3) strains containing the expression recombinant plasmid were obtained.

[0056] Table 7 Resistance of different co-expression strains

[0057] Screening of co-expression strains: The three co-expression strains were used to catalyze the reaction with a catalyst dosage of 50 g / L based on the total weight of the wet bacterial cells before high-pressure homogenization, a substrate rebaudioside A concentration of 100 g / L, and a sucrose concentration of 160 g / L, and the reaction medium was a phosphate buffer at pH 7.5 with a total reaction volume of 10 mL. The reaction conditions were 40 ℃, 500 rpm for 12 h. After the reaction was completed, 20 μL of the reaction sample was taken, diluted 20 times, and 16 μL of 2M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution were added to terminate the reaction. After filtration through a 0.22 μm filter membrane, HPLC detection was performed to detect rebaudioside M. The results are shown in Table 8. Considering the results comprehensively, the No. 2 co-expression strain was finally selected.

[0058] Table 8 Catalytic results of different co-expression strains

[0059] Example 6 Application of co-expression strains in catalytic synthesis of rebaudioside M The co-expression strain E. coli BL21 (DE3) obtained in Example 5 was inoculated into a medium containing 25 μg / mL ampicillin and 25 μg / mL ampicillin. The cells were cultured in LB liquid medium containing 1 μg / mL chloramphenicol at 37°C for 9 hours. This was used as a seed culture and inoculated at a 3.5% volume concentration into a 5-L fermentor containing 3 L of fermentation medium. The culture was continued at 37°C and 500 rpm for approximately 3-4 hours until the bacterial density reached the required OD value of 6-8. The fermentor temperature was lowered to 25°C and lactose was added as an inducer at a final concentration of 5 g / L. The culture was then continued at 25°C and 500 rpm for an additional 12 hours. The fermentation broth was centrifuged at 8000 rpm for 10 minutes to obtain wet cells containing the mutant co-expressing strain. The resulting wet cells were then disrupted using a high-pressure homogenizer.

[0060] The fermentation tank culture medium consists of: 45 g tryptone, 36 g yeast extract, 30 g sodium chloride, 4.08 g potassium dihydrogen phosphate, 45 g glycerol, 6.84 g dipotassium hydrogen phosphate trihydrate, 15 g ammonium sulfate, 1.125 g magnesium sulfate, and 4 g defoamer, and distilled water is added to make the volume to 3 L for dissolution.

[0061] Catalyst dosage: The total weight of wet cells before high-pressure homogenization was 50 g / L, the final concentration of substrate rebaudioside RA was 100 g / L, the final concentration of sucrose was 150 g / L, and the total volume of the reaction solution was 1 L using pH 7.5 phosphate buffer as the reaction medium; reaction conditions: 40°C, 500 rpm, reaction for 24 h; after the reaction, 20 μL of the reaction sample was taken, diluted 20 times, and the reaction was terminated by adding 16 μL of 2M H2SO4 solution and 160 μL of 60% (volume fraction) methanol solution. The sample was filtered through a 0.22 μm filter membrane and detected by HPLC. The reaction progress curve is shown in Figure 2. Picture 1 As shown in the figure, after the reaction, the concentration of rebaudioside RM reached 130 g / L and the conversion rate reached 97.5%.

[0062] Comparative Example: original co-expression strain E. coli BL21 (DE3) / pACduet-MsSUS-MsSUS-pETduet-SrUGT-StUGT (where MsSUS, SrUGT and StUGT are all wild enzymes and have not been mutated), catalyst dosage: total weight of wet bacteria before high-pressure homogenization: 50 g / L, final concentration of substrate rebaudioside RA: 150 g / L, final concentration of sucrose: 100 g / L, pH 7.5 phosphate buffer as reaction medium: total volume of reaction solution: 1 L; reaction conditions: 40 ° C, 500 rpm, reaction for 24 h; after the reaction, 20 μL of the reaction sample was taken, diluted 20 times, and the reaction was terminated by adding 16 μL 2M H2SO4 solution and 160 μL 60% (volume fraction) methanol solution. The sample was filtered through a 0.22 μm filter membrane and detected by HPLC. After the reaction, the concentration of rebaudioside RM reached 15.2 g / L, and the conversion rate reached 11.4%.

[0063] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A glycosyltransferase mutant, characterized in that The amino acid sequence of the wild-type glycosyltransferase is shown in SEQ ID NO. 2, wherein the aspartic acid at position 66 is mutated to glutamic acid, the asparagine at position 134 is mutated to serine, the cysteine ​​at position 167 is mutated to isoleucine, the isoleucine at position 216 is mutated to valine, and the asparagine at position 316 is mutated to glycine.

2. A gene encoding the glycosyltransferase mutant according to claim 1.

3. An expression cassette, characterized in that Comprising the gene according to claim 2.

4. A recombinant expression vector, characterized in that: Comprising the gene according to claim 2.

5. A recombinant bacterium, characterized in that Comprising the gene according to claim 2.

6. A transgenic cell line, characterized in that Comprising the gene according to claim 2.

7. Use of the glycosyltransferase mutant according to claim 1, the gene according to claim 2, or the recombinant bacterium according to claim 5 in catalyzing the synthesis of rebaudioside D and rebaudioside M.

8. A method for catalytic synthesis of rebaudioside D, characterized in that: The steps include: Rebaudioside D is synthesized by reacting wet cells obtained by induced culture of the recombinant bacteria according to claim 5 or crude enzyme solution extracted by crushing the wet cells as a catalyst and rebaudioside A and UDP-glucose as substrates; The reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7 to 8; the reaction temperature is 35 to 45°C; the reaction speed is 400 to 600 rpm; The dosage of the catalyst is 5-45 g / L based on the total weight of the wet cells; the final concentration of rebaudioside A is 80-120 g / L, and the final concentration of UDP-glucose is 50-70 g / L.

9. A method for catalytic synthesis of rebaudioside M, characterized in that: The steps include: (1) A recombinant expression vector comprising the gene of claim 2, a recombinant expression vector comprising a second glycosyltransferase gene, and a recombinant expression vector comprising a sucrose synthase gene are co-transferred into a host bacterium to obtain a recombinant bacterium; the amino acid sequence of the second glycosyltransferase gene is shown in SEQ ID NO. 7, and the amino acid sequence of the sucrose synthase gene is shown in SEQ ID NO. 8; (2) Rebaudioside M is synthesized by reaction using wet cells obtained by induction culture of the recombinant bacteria constructed in step (1) or crude enzyme solution extracted by crushing the wet cells as a catalyst, rebaudioside A as a substrate, and sucrose as a cosubstrate.

10. The method according to claim 9, wherein The reaction conditions include: the reaction solution is a phosphate buffer solution with a pH of 7 to 8; the reaction temperature is 35 to 45°C; the reaction speed is 200 to 500 rpm; In one or more embodiments, the amount of the catalyst used is 5-60 g / L based on the total weight of the wet cells; the final concentration of rebaudioside A is 50-120 g / L, and the final concentration of sucrose is 50-150 g / L.

Images