Construction method and application of gobiocypris rarus gnaq knockout strain

Abstract

The application belongs to the technical field of biology, and particularly relates to a construction method of a gnaq knockout strain of rare gobiorynchus and application thereof. The application adopts CRISPR / Cas9 gene editing technology, designs double-target sgRNA (target point 1 induces 8 bp deletion, and target point 2 mediates 32 bp insertion) aiming at gnaq gene of the rare gobiorynchus. The sgRNA sequence is optimized by ZiFiT target point design software, and NCBI BLAST comparison is performed to ensure the targeting specificity. The in-vitro transcribed sgRNA and Cas9 mRNA are microinjected into the fertilized eggs of the rare gobiorynchus to obtain F0 chimeras. After the F1 heterozygotes are self-crossed, the homozygous mutants gnaq-8 and gnaq+32 which conform to Mendelian genetic law are successfully screened in the F2 generation. The gnaq knockout is realized in the rare gobiorynchus for the first time, which fills the gap of the research on G protein signaling pathway of the rare gobiorynchus, and provides an important model for the subsequent research on the functions of related genes of fish (such as antiviral immunity and tumor mechanism).

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of biotechnology, and particularly relates to a construction method of a gnaq knockout strain of Gobiocypris rarus and application thereof. BACKGROUND

[0002] The gnaq (guanine nucleotide binding protein q polypeptide) gene encodes the G protein alpha q subunit and is a member of the G protein alpha subunit multigene family. As an important signal transduction protein, gnaq plays a key role in antiviral immune response. It plays an important role in signal transduction, tumor development, and heavy metal tolerance. Studies have found that the expression of gnaq in virus-infected cells is down-regulated. The lack of gnaq can increase the resistance of the host to viral infection, which indicates that gnaq plays a negative role in the host's resistance to viral infection. In addition, the expression of type I interferon (IFN-I) is significantly enhanced in gnaq-deficient cells, which indicates that gnaq negatively regulates the production of IFN-I.

[0003] The study of gnaq gene mutations in uveal melanoma (UM) is currently a research focus. About 85% of UMs have mutually exclusive mutations in gnaq or gna11. These mutations mainly occur in specific codons, such as R183 and Q209, leading to the continuous activation of G proteins and promoting tumor development. Drug development targeting gnaq mutations is also underway. For example, MEK inhibitors reduce the growth of hemangiomas and coagulopathy in mouse models with overactive gnaq mutations. The knockout of the gnaq gene has been applied to mice, zebrafish, and parasites.

[0004] Gobiocypris rarus belongs to the Cyprinidae family and is commonly known as gold white naiad or black line fish. It is a small Cyprinidae fish endemic to China, with a short life cycle, superior reproductive performance, and higher sensitivity to environmental pollutants such as heavy metals and higher susceptibility to grass carp hemorrhagic disease virus than zebrafish. Therefore, Gobiocypris rarus is a good experimental material for genetic, ichthyology, physiology, biological monitoring, and toxicity testing research.

[0005] Since 1990, the Institute of Hydrobiology, Chinese Academy of Sciences, has conducted systematic research on the morphology and taxonomic status, distribution and living habits, reproduction, embryonic development, feeding methods, breeding techniques, anesthesia methods, and inbred line cultivation of Gobiocypris rarus. In 1994, Wang et al. conducted a study on GCRV (Grass Carp Reovirus) infection in Gobiocypris rarus. Pathological observations were conducted on experimental fish infected with GCRV. It was proven that Gobiocypris rarus is sensitive to GCRV and can be used as a model for studying GCRV. A large number of researchers use Gobiocypris rarus as a model experimental fish to study the infection mechanism of grass carp reovirus (GCRV). Researchers have explored the differences in host response after infection with GCRV type II virulent and attenuated strains through quantitative proteomic analysis.

[0006] Tong et al. determined that the average DNA content of Gobiocypris rarus somatic cells is (2.660±0.007) pg, suggesting that the genome size is approximately 1.3 G. Gobiocypris rarus exhibits significant differences in sensitivity to different pollutants. According to Jiang's research data, although Gobiocypris rarus is more tolerant to chromium ions than Danio rerio and Xiphophorus hellerii, its sensitivity to pentachlorophenol is significantly higher. Notably, in terms of response to estrogenic substances, Gobiocypris rarus is more sensitive to ethinyl estradiol than Oryzias latipes and exhibits a response intensity similar to that of Danio rerio. These experimental results confirm that Gobiocypris rarus is highly feasible and valuable for short-term reproductive toxicity assessment. Compared to Danio rerio, Gobiocypris rarus is particularly sensitive to metals, and juveniles and adults are more sensitive than their larvae and embryos. It has the potential to become a model animal for pollution monitoring. Zhong's research found that Gobiocypris rarus is an ideal live experimental model for evaluating the toxic effects of estrogenic substances. Southwest University, Tongji University, Wuhan University, and Huazhong Agricultural University have researched the effects of Gobiocypris rarus on molecular genes, physiological and biochemical processes, and individual and population effects under exposure to exogenous compounds. After the efforts of several generations of Chinese researchers, we have developed mature artificial breeding techniques, artificial gynogenesis techniques, strain identification techniques, chromosome manipulation techniques, and gene transfer techniques for Gobiocypris rarus. We have laid a foundation for embryonic development and cytogenetics research on Gobiocypris rarus.

[0007] As a unique small fish in China, Gobiocypris rarus has characteristics such as a short reproductive cycle, strong tolerance, and sensitivity to pollutants. It has been artificially bred and studied as a new experimental animal since the end of the last century. Gobiocypris rarus is highly sensitive to toxic substances in water, making it a model organism for aquatic animal toxicology research in China.

[0008] The application first uses CRISPR-Cas9 gene editing technology to specifically knock out the gnaq gene of rare gobiocypris rarus. It aims to use CRISPR-Cas9 gene editing technology to construct a gnaq gene knockout strain of rare gobiocypris rarus, to explore the mechanism of gnaq gene in fish growth and development, physiological metabolism and disease occurrence, and to provide theoretical basis and technical support for further understanding of fish gene function and development of related gene therapy methods. This research has important theoretical value and application prospect, which helps to further understand the evolutionary conservation and species specificity of G protein signaling pathway in vertebrates, and provides an innovative research tool for fish genetic breeding and environmental toxicology research. SUMMARY

[0009] The application first provides a construction method of a gnaq knockout strain of rare gobiocypris rarus, which comprises the following steps:

[0010] (1) Design of sgRNA target site;

[0011] (2) Design of sgRNA target site sgDNA amplification primers gnaq-sgRNA-F1, gnaq-sgRNA-F2 and gnaq-sgRNA-R required for synthesis, and mutation type identification primers gnaq-identify-F and gnaq-identify-R;

[0012] (3) DNA extraction;

[0013] (4) Synthesis of sgRNA;

[0014] (5) gnaq gene knockout to obtain F0 generation;

[0015] (6) Target site effectiveness detection;

[0016] (7) After the F0 generation of rare gobiocypris rarus matures, it is crossed with wild type individuals to obtain F1 generation, and the F1 generation is sequenced to obtain the sequenced F1 generation individuals;

[0017] (8) Select the sequenced F1 generation individuals, and after they develop to sexual maturity, screen out gnaq mutant heterozygotes by genotyping, select F1 generation male and female individuals with the same mutation type for artificial reproduction, and cultivate the offspring F2 generation.

[0018] In some embodiments, the target site is as shown in SEQ ID NO: 1 and SEQ ID NO: 2, corresponding to the positions 21-40bp and 39-57bp of the CDS sequence.

[0019] In some embodiments, the sequences of the gnaq-sgRNA-F1, gnaq-sgRNA-F2, gnaq-sgRNA-R, gnaq-identify-F and gnaq-identify-R are shown in SEQ ID NO: 3-SEQ ID NO: 7.

[0020] In some embodiments, the synthetic sgRNA is obtained by in vitro amplification using gnaq-sgRNA-F1, gnaq-sgRNA-F2 and gnaq-sgRNA-R, and then purified to obtain a purified sgDNA carrying T7 promoter and gnaq gene target site sequence 1 and sequence 2; the purified sgDNA is used as a template for in vitro transcription and synthesis of sgRNA using the Thermo TranscriptAid T7High Yield Transcription Kit.

[0021] In some embodiments, the gnaq gene knockout uses CRISPR-Cas9 technology.

[0022] In some embodiments, the target site effectiveness detection uses PCR and sequencing verification using gnaq-identify-F and gnaq-identify-R.

[0023] In some embodiments, the sequencing is Sanger sequencing.

[0024] In some embodiments, the F1 generation includes a deletion mutation of 8 base pairs at one target site and an insertion mutation of 32 base pairs at another target site.

[0025] In some embodiments, the F2 generation includes a gnaq -8 population and a gnaq +32 population.

[0026] The present application also provides an application of the method for constructing the gnaq knockout strain of the rare gobi-Przewalskia's minnow described above, and the application is one or more of a) to c);

[0027] a) for constructing a gnaq knockout strain of the rare gobi-Przewalskia's minnow;

[0028] b) to study the mechanism of antiviral immunity of the gobi-Przewalskia's minnow;

[0029] c) to study the mechanism of antiviral immunity of gnaq.

[0030] Compared with the prior art, the present application has at least the following beneficial effects:

[0031] The application adopts CRISPR / Cas9 gene editing technology, designs double-target sgRNA (target point 1 induces-8 bp deletion, target point 2 mediates +32 bp insertion) aiming at gnaq gene of rare gobiocypris rarus. The sgRNA sequence is optimized by ZiFiT target design software, and the targeting specificity is ensured by NCBI BLAST comparison. The in vitro transcribed sgRNA is microinjected into the gnaq mRNA of rare gobiocypris rarus, and the F0 generation chimeras are obtained. After self-crossing of the F1 generation heterozygotes, the homozygous mutant gnaq -8 and gnaq +32 The application realizes gnaq knockout in rare gobiocypris rarus for the first time, fills the gap of G protein signal pathway research in rare gobiocypris rarus, and provides an important model for subsequent fish function research (such as antiviral immunity and tumor mechanism). BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 , agarose gel electrophoresis of sgRNA for gnaq gene knockout; M: DNA Marker; S1: sgRNA1; S2: sgRNA2.

[0033] Figure 2 , genotype identification of F0 generation rare gobiocypris rarus of gnaq gene knockout by microinjection, non-denaturing PAGE electrophoresis map; WT: wild type rare gobiocypris rarus; sgRNA1-2: mutant F0 generation caused by different sgRNA; the band pointed by the arrow is a 200 bp specific electrophoretic band produced by amplification of wild type gnaq. Compared with the wild type, two bands appear in the F0 generation mutant.

[0034] Figure 3 , F0 generation knockout target site sequencing map; the highlighted part indicates that a double peak appears, and the knockout site is successful.

[0035] Figure 4 , F1 Sanger sequencing peak map, the highlighted part in the figure indicates that a double peak appears at the knockout site; WT: wild type; gnaq-8: 8 base deletion; gnaq+32: 32 base insertion.

[0036] Figure 5 , gnaq gene knockout detailed mode and F2 Sanger sequencing peak map; the figure shows part of the base sequence of gnaq gene of rare gobiocypris rarus. The red highlighted part is the knockout site of gnaq gene.

[0037] Figure 6 , gnaq knockout F2 phenotype comparison chart. DETAILED DESCRIPTION

[0038] To make the technical problems, technical solutions and advantages to be solved by the present application clearer, specific embodiments will be described in detail below with reference to the drawings.

[0039] Test animals

[0040] The gobiocypris rarus was selected as a model organism in the present application. The experimental fish was purchased from the Institute of Hydrobiology, Chinese Academy of Sciences. The experimental fish was raised in a circulating water culture system according to the standard method described in the literature. The specific conditions are as follows: the water temperature was maintained at 28±1°C, the light cycle was controlled at 14 hours light / 10 hours dark, and the culture container volume was 3 liters or 10 liters. During the experiment, the daily management strictly followed the Guide for the Care and Use of Laboratory Animals. In the juvenile development stage (5-15 days old), Paramecium was fed, and after the fry grew to 15 days old, the system culture rack was changed to feed Artemia nauplii.

[0041] The main experimental reagents used in the experiment are shown in Table 1.

[0042] Table 1, main experimental reagents

[0043] Reagent name Manufacturer 2x TransStart® FastPfu Fly PCR SuperMix (-dye) TransGen Biotech EP11-Aidred (GelRed) nucleic acid dye (1000x) Beijing Aidley Biotech Co., Ltd. 10x Loading buffer Bao Bioengineering (Dalian) Co., Ltd. D2000 DNA Marker Coolabos Technology Co., Ltd. HiPure Gel Pure DNA Mini Kit Magen Primer synthesis Beijing Qikong Biotech Co., Ltd. Gene sequencing Beijing Qikong Biotech Co., Ltd. TranscriptAid T7 High Yield Transcription Kit thermoscientific

[0044] The main instruments used in the experiment are shown in Table 2.

[0045] Table 2, main experimental instruments

[0046] Apparatus name Manufacturer Ice maker Grant, USA Pipette, refrigerated centrifuge, spectrophotometer Eppendorf China Co., Ltd. Clean bench Suzhou Purification Equipment Co., Ltd. PCR instrument Applied Biosystems (ABI) Co., Ltd. Electrophoresis apparatus Beijing 61 Instrument Factory Gel Doc™ XR+ gel imaging analysis system Bole Life Medical Products (Shanghai) Co., Ltd. Constant temperature water bath Shanghai Jinghong Experimental Equipment Co., Ltd. Electronic balance Sartorius (Shanghai) Trading Co., Ltd. Example 1

[0047] sgRNA target site design

[0048] The gnaq gene of gobiocypris rarus was searched for sequence in the National Center for Biotechnology Information (NCBI) database (search link: https: / / www.ncbi.nlm.nih.gov / homologene / ?term=gnaq). At the same time, the transcript information and exon-intron structure characteristics of the gnaq gene were obtained from the genomic data of gobiocypris rarus. ZiFiT Targeter 4.2 software (http: / / zifit.partners.org / ZiFiT / ) was used for target site screening, and the following standards were followed in the design:

[0049] (1) The length of the target sequence is controlled at 19-23 bases, and the number of bases is not a multiple of 3;

[0050] (2) Avoid selecting sequences containing 3 or more consecutive identical bases, especially T or A-rich repeat sequences;

[0051] (3) Preferentially select the exon region downstream of the start codon ATG;

[0052] (4) Ensure the GC content is maintained in the appropriate range of 40-60%;

[0053] (5) The 5' end of the target sequence should start with GG, and the 3' end should contain the NGG structure.

[0054] After completing the preliminary design, the candidate target sequence is subjected to whole genome alignment analysis using the BLAST tool of NCBI. If homologous matches of the target sequence are found in other regions of the genome, it needs to be redesigned to ensure editing specificity. Through this verification process, non-specific target points can be effectively excluded to ensure the accuracy of gene editing. In order to minimize the risk of off-target effects, the specificity of the 12 nucleotide sequence upstream of the PAM (Protospacer Adjacent Motif) region should be ensured first, so as to accurately identify the editing site of the target gene.

[0055] Example 2

[0056] Target site determination of gnaq gene

[0057] According to the information of Grgnaq gene of Gobiocypris rarus, it is known that Grgnaq gene of Gobiocypris rarus contains 7 exons, 6 introns, and encodes 359 amino acids. In order to obtain the best gene knockout effect, two target sites are designed for knockout. According to the knockout principle, the two target sites for knockout are determined as: GGCGTGTTGCCTCAGCGAGG (SEQ ID NO: 1) and GGAGGCGAAAGAAGCGCGG (SEQ ID NO: 2), corresponding to CDS sequence 21-40bp (target site 1) and 39-57bp (target site 2) positions.

[0058] According to the target site of gnaq gene, the sgDNA amplification primers gnaq-sgRNA-F1, gnaq-sgRNA-F2 and gnaq-sgRNA-R (universal primer) required for sgRNA synthesis, and the mutation type identification primers gnaq-identify-F and gnaq-identify-R (specific sequences are shown in Table 3) are designed by Primer3 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ) online tool at the upstream and downstream of the target site.

[0059] Table 3 gnaq Primer for gene knockout target site and identification

[0060] Primer Sequence -sgRNA-F1 TAATACGACTCACTATAGGCGTGTTGCCTCAGCGAGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 3) -sgRNA-F2 TAATACGACTCACTATAGGAGGCGAAAGAAGCGCGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO: 4) -sgRNA-R AAAAAAAGCACCGACTCGGTGCCAC (SEQ ID NO: 5) -identify -F TCTCTTGCCTTATCTGGACGTT (SEQ ID NO: 6) -identify -R CGAGCGTCTTTCTTGTCACG (SEQ ID NO: 7)

[0061] DNA extraction:

[0062] First, select individual larger, sexually mature Gobiocypris rarus into a transparent fish box. In addition, 6 clean transparent fish boxes, each box with 3 transparent partitions to divide the transparent fish box into 4 intervals, a total of 24 intervals. Prepare forceps, scissors, small nets, paper towels and other tools. First, wet the paper towel with water, use the net to catch 1 Gobiocypris rarus and place it on the paper towel, then use the scissors to cut the tail fin of the Gobiocypris rarus, and use the forceps to pick it up and put it into the PCR tube. The Gobiocypris rarus with the tail fin cut off is placed in the small interval of the transparent fish box in order. After cutting the tail fin of 24 Gobiocypris rarus, use a signature pen to write the order 1-24 on the PCR tube cover. Each interval of the transparent fish box is also labeled 1-24 with double-sided tape on the side of the fish box. Finally, add 0.05M NaOH to each tube in the water bath at 95°C for 10min to complete the extraction of DNA.

[0063] Synthesis of sgRNA:

[0064] sgRNA-F as the forward primer, and the reverse primer is the laboratory gene knockout universal reverse primer sgRNA-R. The PCR program is set as follows: 95°C pre-denaturation for 5min; 95°C denaturation for 30s, 55°C annealing for 15s, 72°C extension for 15s, 35 cycles; 72°C final extension for 5min for PCR in vitro amplification (reaction system see Table 4).

[0065] Table 4 Amplification reaction system

[0066] Component Volume Taq x 2 25ul Primer F 1.5ul Primer R 1.5ul sterile H2O 20ul pMD19-gRNA scaffold 2ul

[0067] The product is the DNA template of sgRNA carrying the T7 promoter gnaq gene target site sequence 1 and sequence 2. Configure agarose gel and perform electrophoresis on the sample, and use StarPrep DNA gel recovery kit to recover and purify sgDNA.

[0068] Using the purified sgDNA as a template, use the Thermo TranscriptAid T7 High Yield Transcription Kit to synthesize sgRNA by in vitro transcription (see Table 5 for specific reaction system).

[0069] Table 5 sgRNA transcription reaction system

[0070] Component Volume 5x Reaction Buffer 4ul ATP / CTP / GTP / UTP 2ul each TranscriptAid EnzymeMix 2ul DNA 1 ng DEPC water Make up to 20ul

[0071] To verify the effect of in vitro transcription, agarose gel electrophoresis needs to be carried out, and whether the transcription is successful is judged by the clarity and brightness of the band. If the band is clear and bright, it proves that the transcription is effective. The transcription product is purified and recovered by using sodium acetate buffer. The sgRNA1 (SEQ ID NO: 8: GGCGTGTTGCCTCAGCGAGG) and sgRNA2 (SEQ ID NO: 9: GGAGGCGAAAGAAGCGCGG) of the gnaq gene target site are obtained and stored in a -80°C refrigerator.

[0072] Purification specific steps:

[0073] Add 1 / 10 volume of 3 mol / L sodium acetate buffer to make the final concentration 0.3 mol / L. After mixing the sample upside down, add 2 volumes (2.5 volumes for RNA) of pre-cooled anhydrous ethanol, mix again, and then transfer to -20°C or -80°C environment overnight. 4°C 12000 rpm / min, centrifuge for 15 min, discard the supernatant (do not touch the precipitate during the process). Add 1000ul of pre-cooled 70% ethanol. Mix and rinse to remove residual salt. 4°C 12000 rpm / min, centrifuge for 2 min, discard the supernatant, and place the tube cap at room temperature for 10-15 min, or vacuum for 2 min to evaporate the ethanol. Add DEPC water to dissolve the RNA, and store it at -80°C.

[0074] Results: After agarose gel electrophoresis separation, refer to the DNA Marker standard band, accurately cut the target fragment of about 100 bp, and purify according to the StarPrep DNA gel recovery kit instructions. The purified product is used as a transcription template to successfully synthesize sgRNA1 and sgRNA2 by T7 in vitro transcription system, corresponding to target site 1 and target site 2 respectively. Finally, the transcription product is treated by sodium acetate buffer purification system, and the agarose gel electrophoresis analysis result (Figure Figure 1 ), S1 and S2 100bp appear bright bands to prove that sgRNA preparation is successful.

[0075] Example 3

[0076] To promote natural mating of G. aequus, fish were raised in a hybrid tank at a ratio of 1:1 for females and males one week before the experiment, and were fed three times a day. Whether the phenomenon of overtaking occurred was observed at about 17:00-20:00 every day, and when spawning was found, artificial dry fertilization was immediately performed, and the embryos were collected and placed in a culture dish. The cas9 protein and sgRNA1 and sgRNA2 were divided into 200 μL PCR tubes in advance, 1 μL of liquid per reaction tube. The cas9 protein (1 μL) was mixed with sgRNA1 (1000 ng / μL) and sgRNA2 (1000 ng / μL) at a ratio of 1:1 and placed on ice for injection. Two batches of G. aequus eggs were injected for each target site, 200 eggs per batch. The prepared CRISPR-Cas9 complex was taken with a micropipette and injected accurately into the yolk area of G. aequus fertilized eggs at the one-cell stage. The fertilized eggs that had completed microinjection were transferred to a culture dish and incubated with an appropriate amount of culture water. In addition, an experimental control was set up, and part of the normal fish eggs of the same batch were cultured synchronously without treatment, and both groups were placed in a 28.5°C constant temperature incubator for unified management. The selection and removal of dead eggs were completed on the same day of the experiment, and an appropriate amount of methylene blue solution was added. During the subsequent culture process, clean tap water treated by aeration was needed to be replaced regularly to maintain the culture environment.

[0077] After microinjection, we obtained F0 generation chimeras containing gnaq gene knockout.

[0078] Target site effectiveness detection: First, DNA extraction was performed. Then, the mutation type target fragment was amplified, and the primers were gnaq-identify-F and gnaq-identify-R in Table 3; the reaction system was: 25.0 μL Rapid Taq MasterMix, 1.5 μL upstream primer, 1.5 μL downstream primer and 2.0 μL template, and sterile water was added to make up to 50.0 μL. The mixed reaction solution was placed in a polymerase chain reaction (PCR) thermal cycler (American Applied Biosystems (ABI) Company), and the regular PCR program was set according to the Rapid Taq Master Mix: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 58°C annealing for 15 s, 72°C extension for 15 s, 35 cycles; 72°C final extension for 5 min. After the reaction was completed, the reaction product was analyzed by agarose gel electrophoresis and imaging.

[0079] The presence of mutations was confirmed by non-denaturing PAGE electrophoresis ( Figure 2 ) and Sanger sequencing ( Figure 3 ).

[0080] Example 4, screening of stably heritable mutants

[0081] Since the F0 generation individuals are gene editing chimeras, individuals that can stably transmit mutations need to be obtained through genetic screening. After the F0 generation Gobiocypris rarus matures, it is mated with wild type individuals, and F1 generation individuals are successfully obtained. The resulting fertilized eggs are collected for genotype analysis. Genomic DNA extraction and identification analysis of F1 generation embryos show that the mutation sites of the F0 generation can be stably inherited to the offspring. The smaller DNA fragments obtained by electrophoresis separation are gel recovered, and a professional sequencing agency is commissioned for sequence analysis (the sequencing results are shown in detail in Table 2). Figure 4 Through sequence peak chart comparison analysis, it is identified that the mutant has editing events at both target sites: 8 base pair deletion mutations are detected at the first target site, and 32 base pair insertion mutations exist at the other target site. The remaining F1 generation embryos are raised to 2-month-old juvenile fish, and each tail is cut for genotype identification to obtain F1 generation Gobiocypris rarus that can be stably inherited.

[0082] To establish a stable Gobiocypris rarus gnaq gene knockout mutant strain, the F1 generation individuals confirmed by sequencing are selected, and after they develop to sexual maturity, gnaq mutant heterozygotes are screened out by genotype identification. F1 generation individuals of the same mutation type are selected for artificial breeding, and their offspring, i.e., F2 generation, are bred, and finally a gnaq -8 population and a gnaq +32 population are obtained.

[0083] According to Mendelian inheritance law, F2 generation individuals should include wild type, heterozygous mutant type and homozygous mutant type. DNA sequencing analysis of the two populations shows that among the 24 F2 generation individuals with -8 bp mutations, 5 are homozygous mutants (gnaq− / −), 11 are heterozygous mutants (gnaq+ / −), and 8 are wild type (gnaq+ / +). Among the 24 F2 generation individuals with +32 bp mutations, 5 are homozygous mutants (gnaq− / −), 12 are heterozygous mutants (gnaq+ / −), and 7 are wild type (gnaq+ / +) (Figure 5). The results are consistent with the expected genetic proportion (Table 6), confirming that the gnaq gene knockout strain is successfully constructed.

[0084] Table 6, proportion table of F2 wild type, heterozygote and knockout homozygote

[0085] Wild type + / + Heterozygote + / - Knockout homozygote - / - -8 bp 8 / 24 11 / 24 5 / 24 +32 bp 7 / 24 12 / 24 5 / 24

[0086] Example 5

[0087] The gnaq mutant homozygote of rare gobi-Przewalskia's goby is a gnaq gene expression deletion rare gobi-Przewalskia's goby. In order to observe the difference between it and the wild type rare gobi-Przewalskia's goby, we observed its appearance. The results show that there is no obvious difference in appearance between the 2-month-old gnaq knockout rare gobi-Przewalskia's goby and the wild type Figure 6 ).

[0088] In summary, the present application adopts CRISPR / Cas9 gene editing technology, designs double target sgRNA (target 1 induces-8 bp deletion, target 2 mediates+32 bp insertion) for gnaq gene of rare gobi-Przewalskia's goby. The sgRNA sequence is optimized by ZiFiT target design software, and the targeting specificity is ensured by NCBI BLAST comparison. The in vitro transcribed sgRNA and Cas9 mRNA are microinjected into the fertilized eggs of rare gobi-Przewalskia's goby, and F0 chimeras are obtained. After self-crossing of F1 heterozygotes, homozygous mutants gnaq -8 and gnaq +32 are successfully screened in F2 generation, which conforms to Mendelian genetic law. The present application realizes gnaq knockout in rare gobi-Przewalskia's goby for the first time, fills the gap of G protein signal pathway research in rare gobi-Przewalskia's goby, and provides an important model for subsequent fish function research (such as antiviral immunity and tumor mechanism).

[0089] The above is the preferred embodiment of the present application, it should be pointed out that, for the ordinary skilled in the art, without departing from the principles of the present application, can make a number of improvements and refinements, these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A method for constructing a rare gudgeon / carp GNAQ knockout strain, characterized in that, The construction method includes the following steps: (1) sgRNA target site design; (2) Design primers for sgDNA amplification required for target site sgRNA synthesis: gnaq-sgRNA-F1, gnaq-sgRNA-F2 and gnaq-sgRNA-R, as well as primers for mutation type identification: gnaq-identify-F and gnaq-identify-R; (3) DNA extraction; (4) Synthesize sgRNA; (5) Knock out the gnaq gene to obtain the F0 generation; (6) Target site effectiveness detection; (7) After the F0 generation of rare gudgeon matures, they are mated with wild-type individuals to obtain the F1 generation. The F1 generation is then confirmed by sequencing. (8) Select F1 generation individuals confirmed by sequencing, and after they develop to sexual maturity, screen out gnaq mutant heterozygotes by genotype identification. Select F1 generation male and female individuals with the same mutation type for artificial breeding to cultivate their offspring, namely F2 generation. The target sites are shown in SEQ ID NO:1 and SEQ ID NO:2; The sequences of gnaq-sgRNA-F1, gnaq-sgRNA-F2, gnaq-sgRNA-R, gnaq-identify-F, and gnaq-identify-R are shown in SEQ ID NO:3-SEQ ID NO:7; The gnaq gene knockout was performed using CRISPR-Cas9 technology.

2. The construction method according to claim 1, characterized in that, The synthesis of sgRNA involved first using gnaq-sgRNA-F1, gnaq-sgRNA-F2, and gnaq-sgRNA-R to obtain DNA templates for sgRNA carrying the gnaq gene target site sequence of the T7 promoter through in vitro PCR amplification, followed by purification to obtain purified sgDNA. Using the purified sgDNA as a template, sgRNA was synthesized in vitro using the Thermo Fisher Scientific TranscriptAid T7 High Yield Transcription Kit.

3. The construction method according to claim 1, characterized in that, The effectiveness of the target sites was verified by PCR and sequencing using gnaq-identify-F and gnaq-identify-R.

4. The construction method according to claim 3, characterized in that, The sequencing was Sanger sequencing.

5. The application of a method for constructing a rare gudgeon / carp GNAQ knockout strain according to any one of claims 1-4, characterized in that, The application is one or more of a) to c); a) Used to construct rare gnaq knockout strains of crucian carp; b) To study the mechanism of antiviral immunity in rare gudgeon; c) Investigate the mechanism of GNAQ antiviral immunity.

Images