SNP (Single Nucleotide Polymorphism) molecular marker for identifying resistance of cucumber to corynespora leaf spot and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker for identifying resistance of cucumber to corynespora leaf spot and application of the SNP molecular marker. According to the SNP molecular marker for identifying the resistance of the cucumber to the corynespora leaf spot disease, the sites of the SNP marker are 6th, 577th and 701bp of the physical position of a chromosome 5 of the cucumber, the basic group of the sites is C or G, the cucumber material with the basic group of the sites being C is a corynespora leaf spot disease resistant cucumber material, and the cucumber material with the basic group of the sites being G is a corynespora leaf spot disease sensitive cucumber material. According to the marker and the application thereof provided by the invention, the corynespora leaf spot resistance screening can be performed on cucumber candidate materials in the seedling stage, the marker has the advantages of high efficiency, less limitation and accuracy, the breeding efficiency of the cucumber corynespora leaf spot resistance variety is improved, and the breeding period is shortened.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology-assisted breeding, in particular to a SNP molecular marker for identifying cucumber resistance to Corynespora leaf spot and an application thereof. Background Art

[0002] Cucumber (Cucumissativus L.) is one of the world's major vegetables and an important greenhouse vegetable in my country, boasting high yields and high profitability. Diseases are a major factor affecting cucumber yield and quality. Target leafspot (TLS) is a disease of cucumber caused by the multi-strain fungus Corynespora cassiicola (Berk & Curt) Wei (Yang Shuangjuan et al., 2012). In recent years, widespread occurrence of TLS in my country has led to reduced production in the cucumber industry, severely restricting its development (Liu Dong, 2017). Chemical fungicides are the primary method of controlling TLS in my country, which can easily lead to drug resistance and pesticide residues in cucumbers. Breeding resistant varieties is a cost-effective approach to addressing this issue. Identifying and screening TLS-resistant cucumber germplasm, clarifying the genetic patterns of resistance, developing relevant molecular markers, and identifying disease-resistant genes are essential for disease-resistant breeding research.

[0003] Currently, research on the mapping and molecular markers of resistance genes for Corynespora leaf spot in cucumber is limited, and the foundation is relatively weak. Genome-wide association study (GWAS) is a statistical method for analyzing quantitative trait loci based on genome-wide single nucleotide polymorphism (SNP) markers. This method detects the association between millions of SNP sites and target traits, combining the principle of linkage disequilibrium (LD) to locate key genetic variants. It has become a standardized strategy for studying genotype-phenotype associations and has been widely used in genetic studies of multiple species. In recent years, GWAS has achieved a series of breakthroughs in the discovery of disease-resistance genes in cucumber (LIU et al., 2020; LIU et al., 2021; HAN et al., 2023; ZHANG et al., 2024). These studies not only demonstrate the high efficiency of GWAS technology but also provide important theoretical support for analyzing the molecular mechanisms of plant disease resistance and accelerating the breeding of disease-resistant varieties. Summary of the Invention

[0004] The purpose of the present invention is to address the above problems and provide a SNP molecular marker for identifying cucumber resistance to Corynespora leaf spot and its application.

[0005] In order to achieve its purpose, the present invention adopts the following technical solutions:

[0006] The first aspect of the present invention provides a SNP molecular marker for identifying the resistance of cucumber to Corynespora leaf spot disease. The site of the SNP marker is the physical position 6,577,701bp of cucumber chromosome 5. The base of this site is C or G. The cucumber material with the base C at this site is a cucumber material resistant to Corynespora leaf spot disease, and the cucumber material with the base G at this site is a cucumber material susceptible to Corynespora leaf spot disease.

[0007] The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 153rd base is C or G.

[0008] The second aspect of the present invention provides a specific primer pair for detecting the above-mentioned SNP molecular marker, including primers TLS-SNP1-F and TLS-SNP1-R, and the nucleic acid sequences of the primers are as follows:

[0009] TLS-SNP1-F: 5'-TTCCTTCAATGTCGATGCGG-3',

[0010] TLS-SNP1-R: 5'-TGGTCCAACGCAAATCATCA-3'.

[0011] The third aspect of the present invention provides a kit for detecting the above-mentioned SNP molecular marker, comprising the above-mentioned specific primer pair.

[0012] Preferably, the kit further comprises cucumber genomic DNA extraction reagent, PCR amplification reaction reagent, and PCR amplification product sequencing reagent.

[0013] The fourth aspect of the present invention provides the use of the SNP molecular marker in any of the following (1)-(3):

[0014] (1) Identify or assist in identifying materials resistant / susceptible to Corynespora leaf spot disease in cucumber;

[0015] (2) Screening or assisting in screening cucumber varieties resistant to Corynespora leaf spot;

[0016] (3) Cultivate or assist in the cultivation of cucumber varieties resistant to Corynespora leaf spot.

[0017] The application comprises the following steps: extracting genomic DNA of a sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker, sequencing the PCR amplification products, and judging whether the sample to be tested is resistant or susceptible to Corynespora leaf spot disease according to the sequencing results.

[0018] The amplification primers for the SNP molecular markers are as follows:

[0019] TLS-SNP1-F: 5'-TTCCTTCAATGTCGATGCGG-3',

[0020] TLS-SNP1-R: 5'-TGGTCCAACGCAAATCATCA-3';

[0021] A 182 bp fragment was obtained by PCR amplification. The cucumber material whose 153rd base of the PCR amplified fragment was C was a cucumber material resistant to Corynespora leaf spot disease, and the cucumber material whose 153rd base of the PCR amplified fragment was G was a cucumber material susceptible to Corynespora leaf spot disease.

[0022] The PCR amplification reaction system includes DNA template, amplification primers, 2x PhantaMax Master Mix, and double-distilled water.

[0023] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 30 seconds, for 35 cycles; and insulation at 72°C for 5 minutes.

[0024] The present invention has the beneficial effects of providing an application of the developed SNP marker to assist in screening new cucumber varieties for the CsTLS gene for resistance to Corynespora leaf spot. The SNP marker-specific primer pair TLS-SNP1-F / TLS-SNP1-R is used to amplify the genomic DNA of the test material, and the amplified product is then sequenced and identified. The marker provided by the present invention and its application allow candidate cucumber materials to be screened for resistance to Corynespora leaf spot at the seedling stage. This approach offers the advantages of high efficiency, few restrictions, and high accuracy, thereby improving the efficiency of breeding cucumber varieties resistant to Corynespora leaf spot and shortening the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The Manhattan plot (A) and QQ plot (B) of the GWAS analysis of resistance to Corynespora leaf spot based on BLUP values. The red horizontal line represents the significance threshold of 5.1 (-log 10 (p)>5.1). DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the embodiments, but the present invention is not limited thereto.

[0027] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0028] Materials and Methods

[0029] 130 core cucumber germplasm accessions: SNP markers associated with resistance to Corynespora leaf spot in cucumber were obtained through the study of 130 core cucumber germplasm accessions. These 130 core cucumber germplasm accessions are representative materials selected from 3,342 cucumber germplasms worldwide and have been used in genome-wide association studies (GWAS) of multiple traits in cucumber (LIU et al., 2020; LIU et al., 2021; HAN et al., 2023; ZHANG et al., 2024).

[0030] 42 3259RILs population materials: The 3259RILs population material is a RIL recombinant inbred line population constructed by the Cucumber Research Group of the Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, by using the Corynespora leaf spot disease-resistant material 'CG104' as the female parent and the Corynespora leaf spot disease-susceptible material 'CG37' as the male parent, and using their hybrid progeny through many years of self-pollination and single-seed transmission methods.

[0031] CG104(P1): Strong growth potential, medium branching, long internode length, large leaves, thick stems, the first female flower node is the 4th node, the female flower node rate is about 30%, the fruit color is dark green, not shiny, the fruit powder is light, the spines are white and sparse, the tubercles are large, slightly ridged, and there are few lines. It is resistant to Corynespora leaf spot.

[0032] CG37(P2): medium growth potential, medium branching, medium internode length, small leaves, medium stem thickness, more than 10 nodes at the first female flower node, female flower node rate of about 17%, dark green fruit color, heavy fruit powder, black and dense spines, no tumors, no ridges, no lines, and is susceptible to Coryneformis leaf spot.

[0033] The above materials are kept in this laboratory and are guaranteed to be released to the public for verification experiments within twenty years from the date of application.

[0034] TLS-SNP marker primers were designed in our laboratory using Primer 5.0 software based on the resequencing genome information and synthesized at Beijing Bioengineering Co., Ltd. Details of the resequencing genome are available in the 2013 paper "A genomic variation map provides insights into the genetic basis of cucumber domestication and diversity" by Qi et al., published in Nature Genetics.

[0035] Main reagents

[0036] PCR experiments used 2×PhantaMax Master Mix from Vazyme, and sequencing was performed at Beijing Bioengineering Co., Ltd.

[0037] Example 1. SNP marker SNP6577701 (C / G) linked to the cucumber coryneform leaf spot resistance gene

[0038] 1. Acquisition of SNP markers

[0039] The test population studied in this embodiment consists of 130 core cucumber germplasm materials. These cucumber materials were sown and planted in the fields of Shouguang, Shandong in the autumn of 2021, spring and autumn of 2023, respectively. The resistance of adult plants to cucumber coryneform leaf spot that were naturally susceptible to the disease (cucumber coryneform leaf spot) in the field was identified in October 2021, June 2023 and October 2023. All experiments adopted a randomized block design (RCBD) with 3 replicates and 5 plants per replicate. The symptoms of coryneform leaf spot began to appear about six weeks after sowing. Starting from 7 weeks after sowing, the disease resistance phenotype of the test materials was identified once a week for 3 consecutive weeks. In combination with the grading criteria outlined by Kan Lina et al. (2007), the severity of TLS lesions on each plant was divided into six grades: 0, 1, 3, 5, 7, and 9, based on the area of ​​TLS lesions (the average area of ​​lesions on all leaves from the top to the 10th to the 15th leaf on each plant). The grading criteria are as follows:

[0040] Level 0: TLS lesion area = 0%;

[0041] Level 1: TLS lesion area ≤ 5%;

[0042] Level 3: TLS lesion area 5-25%;

[0043] Level 5: TLS lesion area 25-50%;

[0044] Level 7: TLS lesion area 50-75%;

[0045] Level 9: TLS lesion area ≥ 75%.

[0046] The calculation formula of disease index (DI) is as follows:

[0047]

[0048] The average of three repeated disease indexes (DI) of each strain was taken as the DI of each season's data. The BLUP value of the average DI of three seasons' data of each strain was used for GWAS analysis. The results are as follows: Figure 1As shown, the cucumber C. lagenarium resistance site gTLS5.1 located on the 5th chromosome of cucumber was detected, the physical position was between 6,554,733-6,654,733 bp, the LOD value was 5.92, and three SNP sites closely related to the cucumber C. lagenarium resistance in the site region were found: SNP6577701 (C / G), SNP6578118 (C / G), and SNP6577840 (C / G).

[0049] Based on the obtained SNP marker SNP6577701 (C / G) of the cucumber C. lagenarium resistance, the DNA sequence of the above segment of the cucumber chr.5 chromosome reference genome (the reference genome sequence of the North China type cucumber line "9930", version number Cucumber (Chinese Long) V3 Genome) was downloaded from the cucumber genome database website (http: / / cucurbitgenomics.org / ), and the variation site was obtained by combining the resequencing data information of the research group.

[0050] The nucleotide sequence of the designed primer is as shown below:

[0051] TLS-SNP1-F (SEQ ID NO. 1): 5'-TTCCTTCAATGTCGATGCGG-3',

[0052] TLS-SNP1-R (SEQ ID NO. 2): 5'-TGGTCCAACGCAAATCATCA-3'.

[0053] The genomic DNA of the C. lagenarium resistance material CG104, the C. lagenarium susceptible material CG37, and the F1 generation thereof was extracted, and the primer pair TLS-SNP1-F / TLS-SNP1-R was used for PCR amplification, and the PCR reaction system was as follows: a total reaction system of 20 μL contained 2 μL of DNA (5.0 ng·μL -1 ), 1 μL of primer TLS-SNP1-F and TLS-SNP1-R (50 ng·μL -1 ) each, 10 μL of 2x PhantaMax Master Mix (a product of Vazyme Company), and 6 μL of double distilled water.

[0054] The PCR amplification program was as follows: 95°C pre-denaturation for 3 minutes; 95°C denaturation for 15 seconds, 56°C annealing for 15 seconds, 72°C extension for 30 seconds, 35 cycles; 72°C incubation for 5 minutes, and 4°C storage.

[0055] The amplified bands were sequenced at Beijing Biotech Co., Ltd. A 182 bp band was amplified from the Coryneformis leaf spot-resistant material CG104 (nucleotide sequence shown in SEQ ID NO. 3), with a C at base 153. A 182 bp band was also amplified from the Coryneformis leaf spot-susceptible material CG37 (nucleotide sequence shown in SEQ ID NO. 4), with a G at base 153. The sequence of the CG104 amplified band (SEQ ID NO. 3) is as follows:

[0056] TTCCTTCAATGTCGATGCGGCACCGACAATGACATTGATGCTTCTGAATTCTATAAAG

[0057] TTGGAATATGATCTTACTTGCCCTATATGCTTGGAATTTGATCTATATGCTTTGGATTGG

[0058] TGGACATCTCTTATGAAAATCATGTGTTTGTTTA C CTGCTTCAGTGATGATTTGCGTTGGACCA.

[0059] CG37 amplified band sequence (SEQ ID NO.4):

[0060] TTCCTTCAATGTCGATGCGGCACCGACAATGACATTGATGCTTCTGAATTCTATAAAG

[0061] TTGGAATATGATCTTACTTGCCCTATATGCTTGGAATTTGATCTATATGCTTTGGATTGG

[0062] TGGACATCTCTTATGAAAATCATGTGTTTGTTTA G CTGCTTCAGTGATGATTTGCGTTGGACCA.

[0063] The sequence obtained in F1 had two bases at this position, C and G, which coexisted and showed resistance to Corynespora leaf spot in the field.

[0064] 2. Verification of SNP marker SNP6577701(C / G)

[0065] Using 42 3259RILs population materials preserved in this study, the marker SNP6577701 (C / G) linked to CsTLS obtained in Example 1 was verified to determine the accuracy of the marker for molecular marker-assisted selection:

[0066] Genotype identification method: Genomic DNA was extracted from cucumber leaves, and PCR amplification was performed using the primer pair TLS-SNP1-F / TLS-SNP1-R according to the PCR reaction system and amplification procedure in Example 1. The amplified band was sequenced at Beijing Bioengineering Technology Co., Ltd. to detect whether the 153rd base of the amplified band sequence was C or G.

[0067] Field phenotypic assessment of disease resistance: 42 accessions were inoculated with Corynespora leaf spot at the two-leaf, one-core stage. Six to seven days after inoculation, the disease severity was graded according to the method described in Example 1. Disease severity was categorized into six levels (0, 1, 3, 5, 7, and 9), and the disease index was calculated. Plants with a disease index less than 46.67 were considered resistant to Corynespora leaf spot and are designated R in Table 1. Plants with a disease index greater than 46.67 were considered susceptible to Corynespora leaf spot and are designated S in Table 1.

[0068] The test results are shown in Table 1. By comparing the genotypes of the SNP marker SNP6577701 (C / G) of 42 materials with the disease resistance identification phenotypes of adult plants, it was found that the genotypes of 40 materials were consistent with the field phenotypes, and the accuracy rate of gene identification was 95.24%.

[0069] Table 1 Results of molecular identification and field phenotypic identification

[0070]

[0071] *Note: Field phenotype S represents susceptible, R represents resistant

[0072] Example 2. SNP marker SNP6578118 (C / G)

[0073] 1. Detection of SNP6578118 (C / G) in parental materials

[0074] This example further investigated and confirmed the potential SNP 6578118 (C / G) for resistance to Cucumber Corysporium leaf spot. SNP 6578118 (C / G) is located at nucleotide position 6,578,118 on chromosome 5 of the Cucumber '9930' reference genome, version V3, and the base at this position is either C or G. Based on the obtained SNP 6578118 (C / G) for resistance to Cucumber Corysporium leaf spot, the DNA sequence of the aforementioned region of chromosome 5 of the Cucumber '9930' reference genome, version V3, was downloaded from the Cucumber Genome Database website (http: / / cucurbitgenomics.org / ), and primers were designed using PrimerPremier 5.0.

[0075] The sequences of the designed primers are as follows:

[0076] TLS-SNP2-F (SEQ ID NO.5): 5'-ATCCAATTCCATTAGCCAA-3',

[0077] TLS-SNP2-R (SEQ ID NO. 6): 5'-CTTTTAGTAGTTGATAAGGGAAGC-3'.

[0078] The genomic DNA of the resistant and susceptible CG104 and CG37 were extracted, and the TLS-SNP2-F and TLS-SNP2-R primers were used for PCR amplification. The PCR reaction system was as follows: 20 μL of total reaction system, 2 μL of DNA (5.0 ng·μL -1 ), primers TLS-SNP2-F, TLS-SNP2-R (50 ng·μL -1 ), 1 μL each of 1 μL of 2x PhantaMax Master Mix (Vazyme), and 6 μL of double-distilled water.

[0079] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 30 seconds, for 35 cycles; incubation at 72°C for 5 minutes, and storage at 4°C.

[0080] The amplified bands were sequenced at Beijing Biotech Co., Ltd. A 315 bp band was amplified from the Coryneformis leaf spot-resistant material CG104 (nucleotide sequence shown in SEQ ID NO. 7), with a G at base 200. A 315 bp band was also amplified from the Coryneformis leaf spot-susceptible material CG37 (nucleotide sequence shown in SEQ ID NO. 8), with a C at base 200. The sequence of the CG104 amplified band (SEQ ID NO. 7) is as follows:

[0081] ATCCAATTCCATTAGCCAAGGGGATTGCAAAAGCTCCATATGTACAACTCATATTTTC

[0082] AACTTAAAGTTCTTTTAATTTACAAAGTTATGTACCTTACCATATTTCTTGAGAATCTT

[0083] TCTAATAACAATAACATTCATTGTAACATATTCAATCAACATTCGACCTTCTTGCATCA

[0084] ACATGATTTGATCTGTTTTAAAG GAATGACCCAATCGTGTCATGTATCTCTCAAAGCA

[0085] ACATGAAGATGAAGAAGATGTTTAACTCTCGTATTGAAACATCCTACAATATCCAAAGCTTCCCTTATCAACTACTAAAAG.

[0086] CG37 amplified band sequence (SEQ ID NO.8):

[0087] ATCCAATTCCATTAGCCAAGGGGATTGCAAAAGCTCCATATGTACAACTCATATTTTC

[0088] AACTTAAAGTTCTTTTAATTTACAAAGTTATGTACCTTACCATATTTCTTGAGAATCTT

[0089] TCTAATAACAATAACATTCATTGTAACATATTCAATCAACATTCGACCTTCTTGCATCA

[0090] ACATGATTTGATCTGTTTTAAAG C AATGACCCAATCGTGTCATGTATCTCTCAAAGCA

[0091] ACATGAAGATGAAGAAGATGTTTAACTCTCGTATTGAAACATCCTACAATATCCAAAGCTTCCCTTATCAACTACTAAAAG.

[0092] The sequence obtained in F1 had two bases at this position, C and G, which coexisted and showed resistance to Corynespora leaf spot in the field.

[0093] 2. Verification of SNP6578118(C / G) marker

[0094] The marker SNP6578118 (C / G) in Example 2 was validated using 42 3259 RILs population materials preserved in this study to determine the accuracy of the marker for marker-assisted selection:

[0095] Genotype identification method: Genomic DNA was extracted from cucumber material leaves, and PCR amplification was performed using the primer pair TLS-SNP2-F / TLS-SNP2-R according to the PCR reaction system and amplification procedure in Example 1. The amplified band was sequenced at Beijing Shenggong Technology Co., Ltd. to detect whether the 200th base of the amplified band sequence was C or G.

[0096] Field phenotypic identification of disease resistance: Same as Example 1.

[0097] The test results are shown in Table 2. By comparing the genotypes of the SNP marker SNP6578118 (C / G) of 42 materials with the disease resistance identification phenotypes in the adult stage, it was found that the genotypes of 30 materials were consistent with the field phenotypes, the accuracy rate of gene identification was only 71.43%, and the consistency rate of disease-resistant materials at this site was only 57.14%, indicating that the application effect of this marker is not as good as SNP6577701 (C / G).

[0098] Table 2 Results of molecular identification and field phenotypic identification

[0099]

[0100] Example 3. SNP marker SNP6577840 (C / G)

[0101] 1. Detection of SNP6577840 (C / G) in parental materials

[0102] This example further investigated and confirmed the potential SNP 6577840 (C / G) for resistance to Cucumber Corysporium leaf spot. SNP 6577840 (C / G) is located at nucleotide position 6,577,840 on chromosome 5 of the Cucumber '9930' reference genome, version V3, and the base at this position is either C or G. Based on the obtained SNP 6577840 (C / G) for resistance to Cucumber Corysporium leaf spot, the DNA sequence of the aforementioned region of chromosome 5 of the Cucumber '9930' reference genome, version V3, was downloaded from the Cucumber Genome Database website (http: / / cucurbitgenomics.org / ), and primers were designed using PrimerPremier 5.0.

[0103] The sequences of the designed primers are as follows:

[0104] TLS-SNP3-F (SEQ ID NO.9): 5'-AACGCAAATCATCACTGAA-3',

[0105] TLS-SNP3-R (SEQ ID NO. 10): 5'-GCTAATGGAATTGGATGTTTT-3'.

[0106] The genomic DNA of the anti-cucumis leaf spot material CG104 and the susceptible cucumis leaf spot material CG37 was extracted, and PCR amplification was performed by using the primer pair TLS-SNP3-F / TLS-SNP3-R, and the PCR reaction system was as follows: 20 μL of total reaction system, containing 2 μL of DNA (5.0 ng·μL -1 ), 1 μL of primer TLS-SNP3-F and TLS-SNP3-R (50 ng·μL -1 ) respectively, 10 μL of 2x Phanta Max Master Mix (product of Vazyme Company), and 6 μL of double distilled water.

[0107] The PCR amplification program was as follows: 95 °C pre-denaturation for 3 minutes; 95 °C denaturation for 15 seconds, 56 °C annealing for 15 seconds, 72 °C extension for 30 seconds, 35 cycles; 72 °C incubation for 5 minutes, and 4 °C storage.

[0108] The amplified bands were sequenced in Beijing Shengwu Technology Co., Ltd., and the anti-cucumis leaf spot material CG104 amplified a band of 257 bp (nucleotide sequence as shown in SEQ ID NO. 11), and the base at the 163th position was C. The susceptible cucumis leaf spot material CG37 also amplified a band of 257 bp (nucleotide sequence as shown in SEQ ID NO. 12), and the base at the 163th position was C. There was no difference between the sequences of the two parents. Although the previous prediction showed that SNP6577840 (C / G) was closely related to the resistance of cucumber to cucumis leaf spot, the detection of the resistant and susceptible parent materials found that the bases at the site of the two parents were actually not different, indicating that the SNP6577840 (C / G) marker was not suitable for being used as a molecular marker for identifying the resistance of cucumber to cucumis leaf spot, and the difference at the site could not actually indicate the resistance of cucumber to cucumis leaf spot.

[0109] The sequence of the CG104 amplified band (SEQ ID NO. 11) is as follows:

[0110] AACGCAAATCATCACTGAAGCAGGTAAACAAACACATGATTTTCATAAGAGATGTCC

[0111] ACCAATCCAAAGCATATAGATCAAATTCCAAGCATATAGGGCAAGTAAGATCATATTC

[0112] CAACTTTATAGAATTCAGAAGCATCAATGTCATTGTCGGTGCCGCAT C GACATTGAA

[0113] GGAAAAGTGAGTGGAGAATTCTGAAGGATAGTTTCCATCCTTGAATCCTTTAAAATTCAAACAAAAAACATCCAATTCCATTAGC。

[0114] CG37扩增条带序列(SEQ ID NO.12):

[0115] AACGCAAATCATCACTGAAGCAGGTAAACAAACACATGATTTTCATAAGAGATGTCC

[0116] ACCAATCCAAAGCATATAGATCAAATTCCAAGCATATAGGGCAAGTAAGATCATATTC

[0117] CAACTTTATAGAATTCAGAAGCATCAATGTCATTGTCGGTGCCGCAT C GACATTGAA

[0118] GGAAAAGTGAGTGGAGAATTCTGAAGGATAGTTTCCATCCTTGAATCCTTTAAAATTCAAACAAAAAACATCCAATTCCATTAGC。

Claims

1. A SNP molecular marker for identifying resistance to Corynespora leaf spot in cucumber, characterized in that: The site of the SNP marker is the physical position 6,577,701bp on cucumber chromosome 5. The base of this site is C or G. The cucumber material with the base C at this site is a cucumber material resistant to Corynespora leaf spot disease, and the cucumber material with the base G at this site is a cucumber material susceptible to Corynespora leaf spot disease.

2. The SNP molecular marker according to claim 1, characterized in that The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.3 or SEQ ID NO.4, wherein the 153rd base is C or G.

3. A specific primer pair for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The method comprises primers TLS-SNP1-F and TLS-SNP1-R, wherein the nucleic acid sequences of the primers are as follows: TLS-SNP1-F: 5'-TTCCTTCAATGTCGATGCGG-3', TLS-SNP1-R: 5'-TGGTCCAACGCAAATCATCA-3'.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: Comprising the specific primer pair according to claim 3.

5. The kit according to claim 4, wherein: It also includes cucumber genomic DNA extraction reagents, PCR amplification reaction reagents, and PCR amplification product sequencing reagents.

6. Use of the SNP molecular marker according to claim 1 or 2 in any of the following (1)-(3): (1) Identify or assist in identifying materials resistant / susceptible to Corynespora leaf spot disease in cucumber; (2) Screening or assisting in screening cucumber varieties resistant to Corynespora leaf spot; (3) Cultivate or assist in the cultivation of cucumber varieties resistant to Corynespora leaf spot.

7. The use according to claim 6, characterized in that The application comprises the following steps: extracting genomic DNA of a sample to be tested as a template, performing PCR amplification using the amplification primers of the SNP molecular marker according to claim 1 or 2, sequencing the PCR amplification products, and judging whether the sample to be tested is resistant / susceptible to Corynespora leaf spot disease based on the sequencing results.

8. The use according to claim 7, characterized in that: The amplification primers for the SNP molecular markers are as follows: TLS-SNP1-F: 5'-TTCCTTCAATGTCGATGCGG-3', TLS-SNP1-R: 5'-TGGTCCAACGCAAATCATCA-3'; A 182 bp fragment was obtained by PCR amplification. The cucumber material whose 153rd base of the PCR amplified fragment was C was a cucumber material resistant to Corynespora leaf spot disease, and the cucumber material whose 153rd base of the PCR amplified fragment was G was a cucumber material susceptible to Corynespora leaf spot disease.

9. The use according to claim 8, characterized in that: The PCR amplification reaction system includes DNA template, amplification primers, 2x Phanta Max Master Mix, and double-distilled water.

10. The use according to claim 9, characterized in that: The reaction procedure of the PCR amplification was as follows: pre-denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 56°C for 15 seconds, and extension at 72°C for 30 seconds, for 35 cycles; and insulation at 72°C for 5 minutes.

Images