Molecular marker primer combination for identifying large fragment deletion of Camellia tonkinensis CdS-RNase gene and application of molecular marker primer combination
By designing the CvS-Rnase-1 primer combination, the CdS-RNase gene deletion in Vietnamese Camellia oleifera was identified, the self-incompatibility problem was solved, the self-pollination fruit setting rate was improved, the detection method was optimized, and the efficiency of germplasm resource screening was improved.
Patent Information
- Application Number
- CN202511281595.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-09
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2045-09-09
AI Technical Summary
Vietnamese oil-tea tree has self-incompatibility, which leads to the problem of blooming without fruits and low fruit setting rate. Existing technology makes it difficult to effectively identify and improve self-compatibility.
A specific molecular marker primer combination, CvS-Rnase-1, was designed to identify a 508 bp deletion in the CdS-RNase gene of Camellia oleifera. Through PCR amplification, agarose gel detection, and sequencing verification, the CdSm2-RNase mutant was screened out, and the PCR system and amplification conditions were optimized to improve detection efficiency.
The rapid screening of CdSm2-RNase mutants was achieved, the self-pollination fruit setting rate of Vietnamese Camellia oleifera was improved, the matching of germplasm resources was guided, and the current low self-pollination fruit setting rate was improved.
Smart Images

Figure CN120758672A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular markers and relates to a molecular marker primer combination for identifying large-fragment deletion of a CdS-RNase gene in Camellia oleifera and an application thereof. Background Art
[0002] Vietnamese camellia has a strict self-incompatibility trait, which means that after the plant recognizes pollen of the same genotype through the pistil, the pollen cannot germinate normally and the pollen tube cannot pass through the stigma, or the pollen tube can pass through the stigma but cannot grow normally and enter the ovule for complete fertilization. This has led to the phenomenon of flowering without fruit, low fruit set rate, and low yield in camellia production. The S locus pistil determining factor that controls the self-incompatibility of Vietnamese camellia has now been identified. Cds-RNase Deletion mutations of the S gene can be categorized as amino acid translation errors caused by single-base deletions in the cDNA, single amino acid deletions, and large-segment deletions. These mutations can inactivate the S protein, leading to loss of S gene function. Abnormalities in the S gene can lead to a shift from self-incompatibility to self-compatibility. CdS-RNase Large gene deletions ( CdS m2 -RNase )yes Cds-RNase Important mutants of the gene are beneficial to improving the self-pollination fruit setting rate and out-pollination fruit setting rate of Vietnamese Camellia oleifera germplasm, and help to understand the mating affinity between Vietnamese Camellia oleifera individuals. Summary of the Invention
[0003] The present invention is to CdS-RNase Genetic Vietnamese Camellia oleifera and containing CdS m2 -RNase The nucleotide sequence of the Vietnamese Camellia oleifera was compared and a 508 bp deletion was obtained. CdS-RNase The nucleotide sequence of the mutant with the large deletion region is shown in SEQ ID NO. 1. Primers are designed based on the deleted nucleotide sequence. The present invention provides the following technical solutions: In one aspect, the present invention provides a molecular marker primer combination for identifying whether Camellia oleifera is self-compatible. The primer is named CvS-Rnase-1, and the nucleotide sequence of the primer is as follows: Forward primer (5′-3′): CAATGCCTAGCAGTTCTC; Reverse primer (5'-3'): ATAGTCGATGAATGATGGTT.
[0004] The second aspect of the present invention provides the use of the molecular marker primer combination in identifying whether Camellia oleifera is self-compatible.
[0005] Furthermore, the application approach is to identify Vietnamese Camellia oleifera CdS-RNase The nucleotide sequence of the deleted fragment is shown in SEQ ID NO.1. Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0006] A third aspect of the present invention provides a method for identifying whether Camellia oleifera is self-compatible, comprising the following steps: (1) Extracting cDNA from samples to be analyzed: Extract RNA from the style (pistil) of the Vietnamese Camellia oleifera to be tested and reverse transcribe it into cDNA; (2) PCR amplification reaction: PCR amplification reaction was performed on the cDNA extracted from (1) using the above primer combination; The reaction system for PCR amplification in step (2) is 20 μL: 10 μL of 2×Phanta Max MasterMix (high-fidelity enzyme), 0.5 μL of each forward and reverse primer at a concentration of 10 μM, 1 μL of cDNA template, and ddH2O is added to a total volume of 20 μL; the reaction procedure for PCR amplification in step (2) is pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 53°C for 15 s, extension at 72°C for 3 s, 35 cycles; and finally extension at 72°C for 5 min.
[0007] (3) The product of step (2) was subjected to agarose gel detection and recovered by gel excision using a PCR recovery kit, and the recovered product was ligated to a blunt-end sequencing vector; The agarose gel in step (3) refers to electrophoresis on a 0.8%-1.2% agarose gel (containing 8% Goldview nucleic acid dye) in 0.5×TBE buffer at a voltage of 120V for 30 minutes.
[0008] (4) The ligation product was introduced into the competent E. coli and spread on solid LB medium containing 50 μg / mL Kan antibiotics, and cultured in an inverted manner at 37°C overnight; (5) Pick 10 bacterial plaques and add them to 1 mL of liquid LB medium containing Kan antibiotics. Incubate at 37°C and 200 rpm for 2 h, and perform colony PCR verification. (6) Select positive clones for conventional Sanger sequencing; (7) Result determination: When the Vietnamese tea oil sample to be analyzed Cds-RNase The gene has a 508bp deletion fragment, and the sample has high self-pollination compatibility and high self-pollination fruit setting rate; Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the nucleotide sequence of the deleted fragment is shown in SEQ ID NO.1.
[0009] The fourth aspect of the present invention provides a CdS-RNase Experimental plan for verifying the fruit setting rate of self-pollination in Vietnamese Camellia oleifera with large gene fragment deletion: (1) Self-pollination: The self-pollination of Camellia oleifera was carried out on a sunny day. Ten plants with normal CdS-RNase Genes and CdS m2 -RNase For the genetically modified Vietnamese tea oil plants, 50 flower buds were selected from each Vietnamese tea oil plant and bagged. After they opened the next day, the bags were removed to allow the self-pollen to fall onto the self-stigma, and then the bags were re-bagged.
[0010] (2) Self-pollination fruit setting rate detection: One month after pollination, the bags were removed and the fruit setting rate was counted.
[0011] Beneficial effects of the present invention: The present invention is based on the newly discovered large fragment deletion containing 508 bp CdS m2 -RNase The primer pairs were rationally designed, and a rapid detection method for this mutation type was developed based on the optimization of the PCR system and amplification conditions. The method was also demonstrated in the detection of a 508 bp large fragment deletion in Camellia oleifera. CdS m2 -RNase The present invention can quickly screen the Vietnamese Camellia oleifera germplasm resources containing CdS m2 -RNase Mutants that improve the pistil-determining factor of self-incompatibility in Camellia oleifera CdS m2 -RNase The efficiency of mutant screening is beneficial for guiding the selection of different parents of Camellia oleifera in the field CdS-RNase It has positive significance for genotype matching and improving the current situation of low self-pollination fruit setting rate of Vietnamese Camellia oleifera. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] 图1 for CdS-RNase Genes and CdS m2 -RNase Agarose gel image of PCR amplification of the full-length CDS of the gene; 图2 for CdS-RNase Genes and CdS m2 -RNase Comparison results of the full-length PCR amplified sequences of the CDS of the gene; 图3 The results of partial sequence alignment of 20 Vietnamese Camellia oleifera strains amplified by primer CvS-Rnase-1 are shown. DETAILED DESCRIPTION
[0013] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0014] Description of SEQ ID NO.1 and SEQ ID NO.2: SEQ ID NO.1( CdS-RNase Gene 508bp deletion fragment): agtggccaggatcatactgtgacacaaggcaaagttgctgctatccaaagactggaaagcctgcagaagatttcggcattcatgggctttggcctaattataacgacggcacttacccatccagctg cgatagccgcaactcttttgatgactctgagatctcagacctcgccagtagattggaaaaagactggccaacactagcatgcccaagtggggatgggttgaagttctggggacatgaatggaataaa catgggacttgtgctgagtctgtctttgaccagcacagctacttccaaactgctcttgacctcaagagcaaagccaaccttcttcaagccctcaccactgcaggtattcgaccaaatgggaagtttt accacttagagagcatcaaagaagccattagagaaactgttggagtcaccccctacattgagtgcaatgtggatacatcaggcaaccaccagctctaccaggtttacatgtgcgtcgactcttctgg SEQ ID NO.2( CdS-RNase Gene CDS sequence): ATGATGCCAAACCCTTCAATCTTGATCAAGCTTTTGGTGGTGCAATGCCTAGCAGTTCTCTGTGTTGCTAAGGATTTTGATTTCTTTTACTTTGTTCAACAGTGGCCAGGATCATACTGTGACACAAGGCAAAGTTGCTGCTATCCAAAGACTGGAAAGCCTGCAGAAGATTTCGGCATTCATGGGCTTTGGCCTAATTATAACGACGGCACTTACCCATCCAGCTGCGATAGCCGCAACTCTTTTGATGACTCTGAGATCTCAGACCTCGCCAGTAGATTGGAAAAAGACTGGCCAACACTAGCATGCCCAAGTGGGGATGGGTTGAAGTTCTGGGGACATGAATGGAATAAACATGGGACTTGTGCTGAGTCTGTCTTTGACCAGCACAGCTACTTCCAAACTGCTCTTGACCTCAAGAGCAAAGCCAACCTTCTTCAAGCCCTCACCACTGCAGGTATTCGACCAAATGGGAAGTTTTACCACTTAGAGAGCATCAAAGAAGCCATTAGAGAAACTGTTGGAGTCACCCCCTACATTGAGTGCAATGTGGATACATCAGGCAACCACCAGCTCTACCAGGTTTACATGTGCGTCGACTCTTCTGGGTCCAACTTCATCAAATGCCCAGTTCTACCCCATAGTCACCCTTGCGGCTCTAAAATCGAATTCCCTTCCTTCTCAGATCACTCAAACTCGAAGAATGATGAACTCTGA Example 1 CdS-RNase Development of primers for amplification of the 508 bp deletion fragment of the gene Extraction of RNA from normal CdS-RNase Gene Vietnamese tea and from Vietnamese tea containing CdS m2 -RNase RNA from the pistil of Vietnamese tea containing the gene was reverse transcribed into cDNA and amplified using the previously identified primers for CvS-RNase-2 CdS-RNase Gene and CdS m2 -RNase The full-length CDS of the gene was detected using the following primer sequences: forward primer (SEQ ID NO. 3): 5'-TCCGAACACTGCGTTTGCTG-3'; reverse primer (SEQ ID NO. 4): 5'-ACAACTAAATCGCCCACGCATA-3'.
[0015] The reaction system for PCR amplification was 20 μL: 10 μL of 2× Phanta Max MasterMix (high-fidelity enzyme), 0.5 μL of each of 10 μM forward and reverse primers, and 1 μL of cDNA template. ddH2O was added to make the total volume 20 μL.
[0016] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 53°C for 15 s, and extension at 72°C for 3 s; and a final extension at 72°C for 5 min.
[0017] The PCR products were electrophoresed on 0.8%-1.2% agarose gel (containing 8% Goldview nucleic acid dye) in 0.5× TBE buffer at 120V for 30 min. The gel run results were photographed and recorded in a gel imaging system (see Appendix). 图1 ).
[0018] The PCR amplification product was detected by agarose gel and recovered by gel excision using a PCR recovery kit. It was introduced into competent E. coli and spread on solid LB medium containing 50 μg / mL Kan antibiotics, and cultured in an inverted manner at 37°C overnight.
[0019] Pick 10 bacterial plaques and add them to 1 mL of liquid LB medium containing Kan antibiotics. Incubate at 37°C with shaking at 200 rpm for 2 h, and perform colony PCR verification.
[0020] Select positive clones for Sanger first generation conventional sequencing (attached 图2 ).get CdS m2 -RNase The 508bp nucleotide sequence of the gene deletion was obtained; based on the nucleotide sequence of the large deletion fragment obtained above, a primer was designed and named CvS-Rnase-1. The primer sequence is: Forward primer (SEQ ID NO. 5): 5′-CAATGCCTAGCAGTTCTC-3′; Reverse primer (SEQ ID NO. 6): 5′-ATAGTCGATGAATGATGGTT-3′.
[0021] Example 2: CdS-RNase Detection of a 508bp deletion fragment in the gene Experimental steps: (1) The styles of 20 Vietnamese Camellia oleifera plants were selected as experimental materials; (2) Extraction and analysis of cDNA samples: The total RNA of the above experimental samples was extracted using the CTAB method and converted into cDNA using a reverse transcription kit; (3) PCR amplification reaction: The extracted cDNA of Camellia oleifera style was used as the amplification template, and CvS-Rnase-1 developed in Example 1 was used as the amplification primer to perform PCR amplification. The PCR reaction system was 20 μL: 10 μL of 2×Phanta Max MasterMix (high-fidelity enzyme), 0.5 μL of each of the forward and reverse primers at a concentration of 10 μM, 1 μL of the cDNA template, and ddH2O was added to a total volume of 20 μL. The PCR amplification reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 53°C for 15 s, and extension at 72°C for 3 s, for 35 cycles; and finally extension at 72°C for 5 min. (4) Detection of PCR amplification products: The PCR amplification products were detected by agarose gel and recovered by gel excision using a PCR recovery kit. The products were introduced into competent E. coli and spread on solid LB medium containing 50 μg / mL Kan antibiotics, and cultured in an inverted manner at 37°C overnight.
[0022] Pick 10 bacterial plaques and add them to 1 mL of liquid LB medium containing Kan antibiotics. Incubate at 37°C with shaking at 200 rpm for 2 h, and perform colony PCR verification.
[0023] Select positive clones for Sanger first generation conventional sequencing (attached 图3 ).
[0024] Example 3: CdS-RNase Association analysis between a 508 bp deletion fragment in the gene and self-incompatibility (1) Self-pollination: The self-pollination of Camellia oleifera was carried out on a sunny day. Ten plants with normal CdS-RNase Genes and CdS m2 -RNase For the genetically modified Vietnamese tea oil plants, 50 flower buds were selected from each Vietnamese tea oil plant and bagged. After they opened the next day, the bags were removed to allow the self-pollen to fall onto the self-stigma, and then the bags were re-bagged.
[0025] (2) Self-pollination fruit setting rate detection: One month after pollination, the bags were removed and the fruit setting rate was counted. The results are shown in Table 1.
[0026] Table 1 Self-pollination fruit setting rate
[0027] The primers of the present invention can quickly identify the CdS-RNase Genes and CdS m2 -RNase The self-pollination fruit setting rates of the genetically modified Vietnamese Camellia oleifera individuals were 1.4%±0.0164 and 10.2%±0.0147, respectively, indicating that the plant individuals identified by this invention can indirectly increase the self-pollination fruit setting rate of Camellia oleifera.
[0028] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. Pistil Determinants of Self-Incompatibility in Camellia oleifera Cds-RNase The 508bp deletion fragment of the gene is characterized in that The nucleotide sequence of the deletion fragment is shown in SEQ ID NO.1, Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
2. A molecular marker primer combination for identifying the self-compatibility of Camellia oleifera, characterized in that: The nucleotide sequences of the primers are as follows: Forward primer: 5′-CAATGCCTAGCAGTTCTC-3′; Reverse primer: 5′-ATAGTCGATGAATGATGGTT-3′.
3. Use of the molecular marker primer combination according to claim 2 in identifying whether Camellia oleifera is self-compatible.
4. The use according to claim 3, characterized in that The application is to identify Vietnamese Camellia oleifera CdS-RNase The nucleotide sequence of the deleted fragment is shown in SEQ ID NO.
1. Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.
2.
5. A method for identifying the self-compatibility of Camellia oleifera, characterized in that: The steps include: (1) Extraction of cDNA from the Vietnamese Camellia oleifera sample to be analyzed: RNA was extracted from the style of the Vietnamese Camellia oleifera to be tested and reverse transcribed into cDNA; (2) PCR amplification reaction: performing a PCR amplification reaction on the extracted cDNA using the molecular marker primer combination described in claim 2; (3) The product of step (2) was subjected to agarose gel detection and recovered by gel excision using a PCR recovery kit, and the recovered product was ligated to a blunt-end sequencing vector; (4) The ligation product was introduced into the competent E. coli and spread on solid LB medium containing 50 μg / mL Kan antibiotics, and cultured in an inverted manner at 37°C overnight; (5) Pick 10 bacterial plaques and add them to 1 mL of liquid LB medium containing Kan antibiotics. Incubate at 37°C and 200 rpm for 2 h, and perform colony PCR verification. (6) Select 5 positive clones for conventional Sanger sequencing; (7) Result determination: When the Vietnamese tea oil sample to be analyzed Cds-RNase The gene has a 508bp deletion fragment, and the sample has high self-pollination compatibility and high self-pollination fruit setting rate; Cds-RNase The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the nucleotide sequence of the deleted fragment is shown in SEQ ID NO.
1.
6. The method according to claim 5, characterized in that In step (2), the PCR amplification reaction system is 20 μL: 10 μL of 2×Phanta Max MasterMix, 0.5 μL of 10 μM forward and reverse primers, 0.5 μL of cDNA template, and ddH2O is added to a total volume of 20 μL; the PCR amplification reaction program is 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 3 s, 35 cycles; and finally 72°C extension for 5 min.
7. The method according to claim 5, characterized in that In step (3), the agarose gel electrophoresis is performed on a 0.8%-1.2% agarose gel containing 8% Goldview nucleic acid dye, and the electrophoresis is performed at a voltage of 120 V for 30 minutes in a 0.5×TBE buffer.
Citation Information
Patent Citations
Method for identifying self-incompatible female determinant S gene of camellia oleifera and matched kit
CN116144821A
Detection method for insertion mutation of self-incompatible pistil determinant CdS-RNase gene of Vietnam camellia oleifera
CN118652916A