B-cell lymphoma early diagnosis marker, cross-species screening method based on lamprey and application

Abstract

The invention discloses an early diagnosis marker for B-cell lymphoma, a cross-species screening method based on lamprey and application, and relates to the technical field of molecular diagnosis. In the prior art, tissue biopsy is strong in invasiveness, and a traditional marker is low in early detection rate; in order to solve the problems that a large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large-scale large- When the expression quantity of the gene in a sample is greater than or equal to 1.8 times of that of a normal B cell (HMY2. CIR), the lymphoma is judged to be positive, and the minimally invasive early diagnosis efficiency is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular diagnosis, and in particular relates to an early diagnostic marker for B-cell lymphoma and a method and application of the marker for cross-species screening based on lampreys. Background Art

[0002] Currently, the clinical diagnosis of B-cell lymphoma mainly relies on tissue biopsy and traditional immune marker detection represented by CD20. However, this strategy has significant limitations: first, tissue biopsy is an invasive procedure, which brings additional pain and risks to patients; second, the existing marker system has insufficient detection sensitivity in the early stages of the disease, which is difficult to meet the needs of early diagnosis (the early detection rate is usually less than 40%); more importantly, the lack of new molecular targets with high specificity limits the further improvement of diagnostic accuracy. Although the activation-induced cytidine deaminase (AID) gene is known to play an important role in the occurrence and development of B-cell lymphoma, its downstream key effector molecule lineage has not been systematically explored and verified in depth, which has become a key bottleneck restricting the development of better diagnostic methods based on the AID pathway. Summary of the Invention

[0003] To address the aforementioned technical problems, one objective of the present invention is to provide a diagnostic marker comprised of genes that are specifically and highly expressed for B-cell lymphoma. A second objective of the present invention is to creatively provide a method for screening early diagnostic markers for B-cell lymphoma using lamprey-human cross-species screening. A third objective of the present invention is to provide the use of early diagnostic markers for B-cell lymphoma in early disease screening, prognostic assessment, and therapeutic targeting.

[0004] To achieve the above-mentioned object of the invention, the first aspect of the present invention provides an early diagnostic marker for B-cell lymphoma, wherein the early diagnostic marker for B-cell lymphoma is selected from the group consisting of the ARHGAP23 gene with a DNA sequence as shown in SEQ ID NO.1, the ZBTB38 gene with a DNA sequence as shown in SEQ ID NO.2, the MIIP gene with a DNA sequence as shown in SEQ ID NO.3, the API5 gene with a DNA sequence as shown in SEQ ID NO.4, the LIGO1 gene with a DNA sequence as shown in SEQ ID NO.5, the SLC39A9 gene with a DNA sequence as shown in SEQ ID NO.6, and the CBX5 gene with a DNA sequence as shown in SEQ ID NO.7, or a combination of two or more thereof.

[0005] Furthermore, the early diagnostic markers for B-cell lymphoma include expression products encoded by ARHGAP23 gene, ZBTB38 gene, MIIP gene, API5 gene, LIGO1 gene, SLC39A9 gene and CBX5 gene.

[0006] Furthermore, the expression product includes mRNA or protein.

[0007] Furthermore, the B cell lymphoma includes B cell lymphoma cells SU-DHL-4 or B cell lymphoma cells SU-DHL-6.

[0008] Furthermore, the SU-DHL-4 early diagnostic markers for B-cell lymphoma cells include the API5 gene, the SLC39A9 gene, and the CBX5 gene; and the SU-DHL-6 early diagnostic markers for B-cell lymphoma cells include the ARHGAP23 gene, the ZBTB38 gene, the MIIP gene, the API5 gene, the LIGO1 gene, and the SLC39A9 gene.

[0009] A primer for amplifying the above-mentioned early diagnostic marker for B-cell lymphoma, comprising:

[0010] The primers for amplifying the ARHGAP23 gene are as follows:

[0011] ARHGAP23-F: CCTTAATCGTGGCTGCATGC

[0012] ARHGAP23-R:TCCTGCAGGTTGATGTCACC

[0013] The primers for amplifying the ZBTB38 gene are as follows:

[0014] ZBTB38-F: AATGTACACTCGTGGCGGAG

[0015] ZBTB38-R:TTCATGCTTCGTGCGGTACT

[0016] The primers for amplifying the MIIP gene are as follows:

[0017] MIIP-F:AGAGCTTTGACGCCTCTGAC

[0018] MIIP-R: GGAGACAGAGGACCAGAGGT

[0019] The primers for amplifying the API5 gene are as follows:

[0020] API5-F:TGCCTCAATTTGCCACTGGA

[0021] API5-R:TTTGGCTGAACAACCCACCT

[0022] The primers for amplifying the LIGO1 gene are as follows:

[0023] LIGO1-F:CATGACACCCAACTGCCTCT

[0024] LIGO1-R: CTCAATGGTGCTGATGGGGT

[0025] The primers for amplifying the SLC39A9 gene are as follows:

[0026] SLC39A9-F:TTGTCATCCTGCTCAACGCT

[0027] SLC39A9-R:CAAAGGCCAGACCCAGGTAG

[0028] The primers for amplifying the CBX5 gene are as follows:

[0029] CBX5-F:GATATCGCTCGGGGCTTTGA

[0030] CBX5-R:TGCAAGAACCAGGTCAGCTT

[0031] The second aspect of the present invention provides the use of an early diagnostic marker for B-cell lymphoma in preparing a diagnostic kit for B-cell lymphoma.

[0032] A B-cell lymphoma diagnostic kit comprises the above-mentioned B-cell lymphoma early diagnosis marker.

[0033] A B-cell lymphoma diagnostic kit comprises primers for amplifying the above-mentioned early diagnostic markers for B-cell lymphoma.

[0034] The third aspect of the present invention provides a method for cross-species screening of early diagnostic markers for B-cell lymphoma based on lamprey. The establishment of this method is based on the following breakthrough method: first, using anti-lamprey CDA1 / CDA2 antibodies, chromatin immunoprecipitation sequencing (ChIP-seq) is performed on lamprey gill tissue treated with lipopolysaccharide (LPS) and phytohemagglutinin (PHA) to capture genomic interaction regions closely related to B cell malignant transformation; then, the top 30 chromatin open peaks with the highest enrichment are selected as candidate targets; further, through cross-species homologous gene mapping technology, the conserved regulatory elements of lamprey are accurately located to the orthologous genes in the human genome; finally, the abnormally high expression characteristics of the above genes are verified by quantitative PCR (qPCR) in malignant B cell lines, thereby establishing 7 new molecular targets with diagnostic value.

[0035] Specifically, the steps include:

[0036] 1) ChIP-seq screening and analysis of lamprey tissues treated with PHA and LPS using anti-lamprey CDA1 / CDA2 antibodies;

[0037] 2) Using the MACS2 algorithm, q < 0.01, we screened for genes associated with enriched peaks;

[0038] 3) Mapping the genes screened in step 2) to human orthologous genes, screening genes with homology similarity ≥ 70% and functional annotations containing the "B cell proliferation / differentiation" pathway.

[0039] The beneficial effects of the present invention are:

[0040] 1. This invention creatively constructs a ChIP-seq cross-species screening model based on the lamprey immune system, and closely combines it with an in vitro functional validation system for malignant B cells to successfully screen and identify seven new molecular markers highly correlated with the development of B-cell lymphoma. Experimental validation data show that the use of these new markers can significantly improve the sensitivity of early diagnosis of B-cell lymphoma (statistically significant level p < 0.05), providing a breakthrough solution to the core problems faced by existing diagnostic technologies, such as high invasiveness, low early detection rate, and insufficient target specificity.

[0041] 2. The early diagnostic markers for B-cell lymphoma provided by the present invention have identified for the first time a diagnostic marker consisting of seven B-cell lymphoma-specific highly expressed genes (ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9, and CBX5). Clinical sample verification shows that when the expression levels of the above seven genes in the tested sample reach 1.8 times or more of the normal B cell (HMY2.CIR) benchmark value, it can be determined to be positive for B-cell lymphoma. This diagnostic threshold system significantly improves the detection specificity and early detection sensitivity, solving the clinical pain point of insufficient discrimination ability of traditional single markers (such as CD20).

[0042] In summary, the B-cell lymphoma diagnostic markers (ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9, and CBX5) identified by lamprey-human cross-species screening in the present invention are specifically and highly expressed for B-cell lymphoma and are of great significance in early disease screening, prognosis assessment, and therapeutic targets. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is a cross-species screening flow chart of the present invention.

[0044] Figure 2The bar graph of qPCR validation in Example 3 is shown. Error bars (±SEM, n=6) are added above the bars, and significant differences are marked with asterisks (*p<0.05, **p≤0.001, ***p≤0.0001, two-tailed t-test). DETAILED DESCRIPTION

[0045] Example 1 A method for screening early diagnostic markers for B cell lymphoma based on lamprey cross-species

[0046] 1. Biological samples and main reagents

[0047] 1. Biological Samples: This example uses gill tissue from juvenile lampreys (Lethenteron reissneri) (10-15 cm in length). The lampreys were collected from the Shuifeng Reservoir on the Yalu River in Dandong, Liaoning Province, China.

[0048] 2. Anti-lamprey CDA1 / CDA2 polyclonal antibodies: CDA1 and CDA2 recombinant proteins were used as antigens to periodically immunize adult rabbits (Oryctolagus cuniculus) for six times. 2+ Rabbit serum was collected after antibody purification using pre-packed NTA gravity columns (Sangon Biotechnology). The coupling solution was equilibrated with binding buffer (containing 0.5 M sodium chloride, 100 mM Tris-HCl, and 0.1 M sodium acetate). Antibody titers were determined using enzyme-linked immunosorbent assay and Western blot analysis.

[0049] Polyclonal antibodies against lamprey CDA1 / CDA2 were successfully obtained at titers of 1:320,000 and 1:80,000, respectively. Western blot analysis of the purified rabbit polyclonal antibodies demonstrated strong specificity, meeting the requirements of subsequent functional experiments.

[0050] 3. ChIP-seq kit: Millipore, #17-10086

[0051] 4. RNA extraction reagent: Thermo Fisher, #15596026

[0052] 5. SYBR Green I Master Mix (Roche, #04887352001)

[0053] 2. The method includes the following steps

[0054] 1. ChIP-seq screening of lamprey tissue using anti-lamprey CDA1 / CDA2 polyclonal antibodies

[0055] The operation was performed according to the ChIP-seq kit instructions.

[0056] 1.1) Intraperitoneal injection

[0057] A control group (n=3) received intraperitoneal injections of 1× PBS (phosphate-buffered saline). Experimental group 1 received intraperitoneal injections of 100 μg / mL phytohemagglutinin (PHA), and experimental group 2 received intraperitoneal injections of 100 μg / mL lipopolysaccharide (LPS). Three biological replicates were performed in each group. All individuals were euthanized 96 hours after injection. Gill tissue was collected and quickly placed in pre-chilled RNase-free centrifuge tubes. 1 mL of RNA stabilizer (RNAlater) was added, followed by quick freezing in liquid nitrogen and transfer to a -80°C ultra-low temperature freezer for long-term storage.

[0058] 1.2) Tissue processing

[0059] 200 mg of gill tissue was taken from each of the two experimental groups and the control group, and cross-linked with PBS solution containing 1% formaldehyde for 15 minutes, and the reaction was terminated by glycine.

[0060] 1.2) Chromatin fragmentation

[0061] The DNA fragments were processed by ultrasonication (Covaris S220) until they were 200 bp-500 bp (parameters: peak power 140 W, duty cycle 5%, 200 cycles).

[0062] 1.3) Immunoprecipitation

[0063] Resuspend the chromatin in lysis buffer, add 10 μg of anti-lamprey CDA1 / CDA2 polyclonal antibody, and incubate with rotation overnight at 4°C. Add 50 μL of Protein A / G magnetic beads and allow to bind at 4°C for 2 h.

[0064] 1.4) DNA purification

[0065] Magnetic bead washing (low salt → high salt → LiCl → TE buffer), cross-linking was reversed at 65°C for 6 h, proteinase K digestion was performed, and DNA was extracted using the phenol chloride method.

[0066] 2. Screening of genes associated with enriched peaks using the MACS2 algorithm (q<0.01)

[0067] Illumina NovaSeq 6000 platform (150bp paired-end sequencing), Peak calling: MACS2 algorithm (q < 0.01), screening for genes associated with enriched peaks.

[0068] Using the MACS2 algorithm (q<0.01), a total of 100 significantly enriched peaks (q<0.01) were identified in the LPS stimulation group and the PHA stimulation group, and the TOP30 were selected for human orthologous gene mapping.

[0069] 3. Human homologous gene mapping

[0070] Using the DAVID 2021 tool (https: / / david.ncifcrf.gov), the top 30 lamprey peak-associated genes identified in step 2 were mapped to human orthologous genes for gene screening. The screening criteria were genes with a homology similarity of ≥70% and a gene function annotation containing a pathway related to "B cell proliferation / differentiation."

[0071] 3. Results

[0072] By mapping to human orthologous genes, a total of 12 genes were screened. Furthermore, by closely integrating with an in vitro functional validation system for malignant B cells, seven genes were successfully screened and identified as highly correlated with B-cell lymphomagenesis and specifically expressed in B-cell lymphoma. The seven genes are as follows: ARHGAP23 (chromosome 7), ZBTB38 (chromosome 3), MIIP (chromosome 1), API5 (chromosome 11), LIGO1 (chromosome 12), SLC39A9 (chromosome 14), and CBX5 (chromosome 19).

[0073] Clinical sample validation revealed that the expression levels of these seven genes in the tested samples reached 1.8 times or higher of the baseline value for normal B cells (HMY2.CIR). Therefore, genes such as ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9, and CBX5 were confirmed as early diagnostic markers for B-cell lymphoma.

[0074] The DNA sequence of the ARHGAP23 gene is shown in SEQ ID NO.1.

[0075] The DNA sequence of the ZBTB38 gene is shown in SEQ ID NO.2.

[0076] The DNA sequence of the MIIP gene is shown in SEQ ID NO.3.

[0077] The DNA sequence of the API5 gene is shown in SEQ ID NO.4.

[0078] The DNA sequence of the LIGO1 gene is shown in SEQ ID NO.5.

[0079] The DNA sequence of the SLC39A9 gene is shown in SEQ ID NO.6.

[0080] The DNA sequence of the CBX5 gene is shown as SEQ ID NO. 7.

[0081] Example 2 A primer for amplifying a B-cell lymphoma early diagnosis marker

[0082] The ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9 and CBX5 genes screened according to Example 1 as B-cell lymphoma early diagnosis markers were used to design primers using the Premier Premier 5 software, and the primer sequences are shown in Table 1.

[0083] Table 1

[0084] Gene Forward primer F (5'-3') Reverse primer R (5'-3') ARHGAP23 CCTTAATCGTGGCTGCATGC TCCTGCAGGTTGATGTCACC ZBTB38 AATGTACACTCGTGGCGGAG TTCATGCTTCGTGCGGTACT MIIP AGAGCTTTGACGCCTCTGAC GGAGACAGAGGACCAGAGGT API5 TGCCTCAATTTGCCACTGGA TTTGGCTGAACAACCCACCT LIGO1 CATGACACCCAACTGCCTCT CTCAATGGTGCTGATGGGGT SLC39A9 TTGTCATCCTGCTCAACGCT CAAAGGCCAGACCCAGGTAG CBX5 GATATCGCTCGGGGCTTTGA TGCAAGAACCAGGTCAGCTT

[0085] Example 3 Verification of B-cell lymphoma early diagnosis markers in malignant B-cell lymphoma (SU-DHL-6)

[0086] This example uses a standardized molecular diagnostic process to analyze marker expression.

[0087] The method includes the following steps:

[0088] 1. Biological samples and reagents

[0089] 1.1) Human B-cell lines

[0090] Malignant group: Diffuse large B-cell lymphoma cell SU-DHL-6 (ATCC® CRL-2959) CRL-2959 TM )

[0091] Normal group: EBV-transformed B-lymphocyte HMY2.CIR (ECACC 85120805)

[0092] 1.2) RNA extraction reagent: Thermo Fisher, #15596026

[0093] 1.3) SYBR Green I Master Mix (Roche, #04887352001)

[0094] 2. Cell line total RNA extraction process

[0095] Total RNA was extracted by the TRIzol method (see the instructions for the detailed operation process).

[0096] 2.1) Cell culture

[0097] Culture of SU-DHL-6 cells: RPMI-1640 medium with 10% fetal bovine serum was used.

[0098] HMY2.CIR cells were cultured in IMDM medium supplemented with 15% fetal bovine serum.

[0099] All cells were cultured at 37°C and 5% CO until the logarithmic growth phase.

[0100] 2.2) Cell collection

[0101] Take the target cells (SU-DHL-6 or HMY2.CIR) in the logarithmic growth phase, discard the culture medium, gently wash twice with pre-cooled PBS (4°C, 1500 rpm × 5 min), and then add 1 mL reagent / 10 cells and let it stand at room temperature for 5 minutes.

[0102] 2.3) Phase separation

[0103] Chloroform (20% of the volume of TRIzol) was added, shaken vigorously for 15 seconds, and allowed to stand at room temperature for 3 minutes. Centrifugation was then performed at 4°C (12,000 g for 15 minutes), and the upper colorless aqueous phase (containing RNA) was aspirated into a new tube.

[0104] 2.4) RNA precipitation

[0105] An equal volume of isopropanol was added, and the mixture was gently inverted to mix. The mixture was allowed to stand at -20°C for 30 min, and then centrifuged at 4°C (12,000 g × 10 min). The supernatant was discarded, and the white precipitate at the bottom of the tube was retained.

[0106] 2.5) RNA Cleaning

[0107] 1 mL of 75% ethanol (prepared with DEPC water) was added and vortexed, followed by centrifugation at 4°C (7,500 g × 5 min), and then repeated washing twice.

[0108] 2.6) Dissolution and quality control: Dry the pellet at room temperature for 5 min (avoid over-drying), then add 20-50 μL of DEPC water to dissolve the RNA.

[0109] 2.7) Detection: Concentration: NanoDrop TM Assay (OD260 / 280 = 1.8-2.0); Integrity: Agilent 2100 Bioanalyzer (RIN ≥ 7.0)

[0110] 3. The washed RNA template is then converted into complementary DNA (cDNA) using M-MLV reverse transcriptase in the presence of dNTPs and oligonucleotide primers.

[0111] 4. SYBR Green I qPCR Detection Process

[0112] 4.1) Real-time quantitative PCR analysis

[0113] ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9, and CBX5 genes were amplified as candidate markers using the forward and reverse primers listed in Table 1, respectively, and detected using the 7500Fast Real-Time Fluorescence Quantitative PCR System (ABI).

[0114] Reaction program: pre-denaturation at 95°C for 30 seconds (DNA polymerase activation); 40 cycles including 95°C for 5 seconds (denaturation), 60°C for 30 seconds (annealing), and 72°C for 30 seconds (extension).

[0115] Reaction system (20 μL): 2 μL of 50 ng / μL cDNA template, 0.4 μL each of forward and reverse primers, 10 μL of 2× ChamQ Universal SYBR qPCR Master Mix (Aikerui, China), and ddH2O to 20 μL.

[0116] All samples were set up with 3 technical replicates, and relative quantitative analysis was performed using the 2-ΔΔCt method.

[0117] ΔΔCt=(C t,target -C t,GAPDH ) sample -(C t,target -C t,GAPDH ) calibrator ; relative expression level = 2 -ΔΔCt

[0118] Indicators, requirements and exception handling are shown in Table 2.

[0119] Table 2

[0120] index Require Exception handling Ct value of internal reference gene 15-25 cycles (HMY2.CIR cells) Re-test cDNA quality if out of range Ct difference of duplicate wells ≤0.5 cycles If the difference is ≥ 1 cycle, the well data will be eliminated Melting curve peak Single peak and Tm value consistent within ±1℃ If there are impurity peaks, the primers need to be optimized. NTC (no template control) Ct value ≥ 35 or no amplification If NTC amplifies, check for contamination

[0121] 4.2) qPCR validation data

[0122] To visually present the expression differences of seven candidate markers in malignant B cells (SU-DHL-6) and normal controls (HMY2.CIR), this example presents the quantitative results of qPCR using bar graphs. Specifically, the relative expression of each gene was calculated based on the ΔΔCt algorithm (GAPDH was used as the internal reference and the expression level of normal B cells was set as the reference value 1), and group comparison bar graphs were constructed using GraphPadPrism 10.1.2. The results are shown in Tables 3 and Figure 2 .

[0123] Table 3. qPCR validation results (SU-DHL-6 vs HMY2.CIR)

[0124] Gene Expression fold p-value ARHGAP23 1.8× 0.0008 ZBTB38 8.2× 0.0001 MIIP 2.7× 0.0001 API5 3.8× 0.0001 LIGO1 1.8× 0.0009 SLC39A9 2.9× 0.0001 CBX5 1× 0.9999

[0125] Depend on Figure 2 As shown in Table 3, the key diagnostic threshold line is indicated by a red dashed line running through the chart. This visualization model clearly reveals that six genes, including ARHGAP23, ZBTB38, MIIP, API5, LIGO1, and SLC39A9, are significantly upregulated in malignant B cells (SU-DHL-6). ZBTB38 expression is upregulated by 8.2 times, API5 by 3.8 times, SLC39A9 by 2.9 times, MIIP by 2.7 times, ARHGAP23 by 1.8 times, and LIGO1 by 1.8 times. In contrast, CBX5 expression is only upregulated by 1.0 times. The significant upregulation of these six genes (p < 0.01) provides intuitive interpretation for the clinical application of these markers. When the expression level of a gene in a test sample reaches 1.8 times or higher of the baseline value for normal B cells (HMY2.CIR), it is considered a lymphoma-positive target. Therefore, ARHGAP23, ZBTB38, MIIP, API5, LIGO1, and SLC39A9 were selected as early diagnostic markers for B cell lymphoma SU-DHL-6 cells.

[0126] Example 4 Validation of B-cell lymphoma early diagnosis markers in malignant B-cell lymphoma (SU-DHL-4)

[0127] This example uses a standardized molecular diagnostic process to perform marker expression analysis.

[0128] The method comprises the following steps:

[0129] 1. Biological samples and reagents

[0130] 1.1) Human B cell lines

[0131] Malignant group: diffuse large B-cell lymphoma cells SU-DHL-4 ( CRL-2957 TM )

[0132] Normal group: EBV-transformed B lymphocytes HMY2.CIR (ECACC 85120805)

[0133] 1.2) RNA extraction reagent: Thermo Fisher, #15596026

[0134] 1.3)SYBR Green I Master Mix(Roche,#04887352001)

[0135] 2. Cell Line Total RNA Extraction Process

[0136] Total RNA was extracted using the TRIzol method (see the instruction manual for detailed operation procedures).

[0137] 2.1) Cell culture

[0138] SU-DHL-4 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum.

[0139] HMY2.CIR cells were cultured in IMDM medium supplemented with 15% fetal bovine serum.

[0140] All cells were cultured at 37°C and 5% CO until the logarithmic growth phase.

[0141] 2.2) Cell collection

[0142] Take the target cells (SU-DHL-4 or HMY2.CIR) in the logarithmic growth phase, discard the culture medium, gently wash twice with pre-cooled PBS (4°C, 1500 rpm × 5 min), and then add 1 mL reagent / 10 cells and let it stand at room temperature for 5 minutes.

[0143] 2.3) Phase separation

[0144] Chloroform (20% of the volume of TRIzol) was added, shaken vigorously for 15 seconds, and allowed to stand at room temperature for 3 minutes. Centrifugation was then performed at 4°C (12,000 g for 15 minutes), and the upper colorless aqueous phase (containing RNA) was aspirated into a new tube.

[0145] 2.4) RNA precipitation

[0146] An equal volume of isopropanol was added, and the mixture was gently inverted to mix. The mixture was allowed to stand at -20°C for 30 min, and then centrifuged at 4°C (12,000 g × 10 min). The supernatant was discarded, and the white precipitate at the bottom of the tube was retained.

[0147] 2.5) RNA Cleaning

[0148] 1 mL of 75% ethanol (prepared with DEPC water) was added and vortexed, followed by centrifugation at 4°C (7,500 g × 5 min), and then repeated washing twice.

[0149] 2.6) Dissolution and quality control: Dry the pellet at room temperature for 5 min (avoid over-drying), then add 20-50 μL of DEPC water to dissolve the RNA.

[0150] 2.7) Detection: Concentration: NanoDrop TM Assay (OD260 / 280 = 1.8-2.0); integrity: Agilent 2100 Bioanalyzer (RIN ≥ 7.0)

[0151] 3. The washed RNA template is then converted into complementary DNA (cDNA) using M-MLV reverse transcriptase in the presence of dNTPs and oligonucleotide primers.

[0152] 4. SYBR Green I qPCR Detection Process

[0153] 4.1) Real-time quantitative PCR analysis

[0154] ARHGAP23, ZBTB38, MIIP, API5, LIGO1, SLC39A9, and CBX5 genes were amplified as candidate markers using the forward and reverse primers listed in Table 1, respectively, and detected using the 7500Fast Real-Time Fluorescence Quantitative PCR System (ABI).

[0155] Reaction program: pre-denaturation at 95°C for 30 seconds (DNA polymerase activation); 40 cycles including 95°C for 5 seconds (denaturation), 60°C for 30 seconds (annealing), and 72°C for 30 seconds (extension).

[0156] Reaction system (20 μL): 2 μL of 50 ng / μL cDNA template, 0.4 μL each of forward and reverse primers, 10 μL of 2× ChamQ Universal SYBR qPCR Master Mix (Aikerui, China), and ddH2O to 20 μL.

[0157] All samples were set up with 3 technical replicates, and relative quantitative analysis was performed using the 2-ΔΔCt method.

[0158] ΔΔCt=(C t,target -C t,GAPDH ) sample -(C t,target -C t,GAPDH ) calibrator ; relative expression level = 2 -ΔΔCt

[0159] Indicators, requirements and exception handling are shown in Table 2.

[0160] 4.2) qPCR validation data

[0161] To visually demonstrate the differential expression of seven candidate markers in malignant B cells (SU-DHL-4) and normal controls (HMY2.CIR), this example presents qPCR quantitative results. Specifically, the relative expression of each gene was calculated using the ΔΔCt algorithm (using GAPDH as the internal reference and normal B cell expression as a baseline value of 1). The results are shown in Table 4.

[0162] Table 4. qPCR validation results (SU-DHL-4 vs HMY2.CIR)

[0163]

[0164]

[0165] From Table 4, it is clear that 3 genes, API5, SLC39A9 and CBX5, are significantly up-regulated in malignant B cells (SU-DHL-4): gene API5 is expressed by 4.3 times, gene SLC39A9 is expressed by 3.8 times, and gene CBX5 is expressed by 2.2 times. However, gene ARHGAP23 is expressed by only 0.52 times, gene ZBTB38 is expressed by only 0.65 times, gene MIIP is expressed by only 0.03 times, and gene LIGO1 is expressed by only 0.57 times. The significant up-regulation of the 3 genes (p<0.01) provides a direct interpretation basis for the clinical application of the markers. When the expression amount of the gene in the sample to be tested reaches 1.8 times or more of the normal B cell (HMY2.CIR) reference value, it can be determined as a positive target of lymphoma. The early diagnosis markers for B cell lymphoma cells SU-DHL-4 include API5, SLC39A9 and CBX5.

Claims

1. An early diagnostic marker for B-cell lymphoma, characterized in that: The early diagnostic marker for B cell lymphoma is selected from one or a combination of two or more of the ARHGAP23 gene whose DNA sequence is shown in SEQ ID NO.1, the ZBTB38 gene whose DNA sequence is shown in SEQ ID NO.2, the MIIP gene whose DNA sequence is shown in SEQ ID NO.3, the API5 gene whose DNA sequence is shown in SEQ ID NO.4, the LIGO1 gene whose DNA sequence is shown in SEQ ID NO.5, the SLC39A9 gene whose DNA sequence is shown in SEQ ID NO.6, and the CBX5 gene whose DNA sequence is shown in SEQ ID NO.

7.

2. The early diagnostic marker for B-cell lymphoma according to claim 1, characterized in that The early diagnostic markers for B cell lymphoma include expression products encoded by ARHGAP23 gene, ZBTB38 gene, MIIP gene, API5 gene, LIGO1 gene, SLC39A9 gene and CBX5 gene.

3. The early diagnostic marker for B-cell lymphoma according to claim 2, characterized in that The expression products include mRNA or protein.

4. The early diagnostic marker for B-cell lymphoma according to claim 1, 2 or 3, characterized in that: The B cell lymphoma includes B cell lymphoma cells SU-DHL-4 or B cell lymphoma cells SU-DHL-6.

5. The early diagnostic marker for B-cell lymphoma according to claim 4, characterized in that The SU-DHL-4 early diagnostic markers for B-cell lymphoma cells include the API5 gene, SLC39A9 gene, and CBX5 gene; the SU-DHL-6 early diagnostic markers for B-cell lymphoma cells include the ARHGAP23 gene, ZBTB38 gene, MIIP gene, API5 gene, LIGO1 gene, and SLC39A9 gene.

6. A primer for amplifying the early diagnostic marker for B-cell lymphoma according to any one of claims 1 to 5, characterized in that: The primers for amplifying the ARHGAP23 gene are as follows: ARHGAP23-F: CCTTAATCGTGGCTGCATGC ARHGAP23-R:TCCTGCAGGTTGATGTCACC The primers for amplifying the ZBTB38 gene are as follows: ZBTB38-F: AATGTACACTCGTGGCGGAG ZBTB38-R:TTCATGCTTCGTGCGGTACT The primers for amplifying the MIIP gene are as follows: MIIP-F:AGAGCTTTGACGCCTCTGAC MIIP-R: GGAGACAGAGGACCAGAGGT The primers for amplifying the API5 gene are as follows: API5-F:TGCCTCAATTTGCCACTGGA API5-R:TTTGGCTGAACAACCCACCT The primers for amplifying the LIGO1 gene are as follows: LIGO1-F:CATGACACCCAACTGCCTCT LIGO1-R:CTCAATGGTGCTGATGGGGT The primers for amplifying the SLC39A9 gene are as follows: SLC39A9-F:TTGTCATCCTGCTCAACGCT SLC39A9-R:CAAAGGCCAGACCCAGGTAG The primers for amplifying the CBX5 gene are as follows: CBX5-F:GATATCGCTCGGGGCTTTGA CBX5-R:TGCAAGAACCAGGTCAGCTT.

7. Use of the early diagnostic marker for B-cell lymphoma according to any one of claims 1 to 5 in the preparation of a diagnostic kit for B-cell lymphoma.

8. A B-cell lymphoma diagnostic kit, characterized in that: The B-cell lymphoma diagnostic kit comprises the B-cell lymphoma early diagnosis marker according to any one of claims 1 to 5.

9. A B-cell lymphoma diagnostic kit, characterized in that: The B-cell lymphoma diagnostic kit comprises the primers for amplifying early diagnostic markers for B-cell lymphoma according to claim 6.

10. A method for screening early diagnostic markers for B-cell lymphoma based on lamprey cross-species, characterized in that: The method for screening early diagnostic markers for B-cell lymphoma according to any one of claims 1 to 5, comprising the steps of: 1) ChIP-seq screening and analysis of lamprey tissues treated with PHA and LPS using anti-lamprey CDA1 / CDA2 antibodies; 2) Using the MACS2 algorithm, q < 0.01, we screened for genes associated with enriched peaks; 3) Mapping the genes screened in step 2) to human orthologous genes, screening for genes with homology similarity ≥ 70% and functional annotations containing the "B cell proliferation / differentiation" pathway.

Images