Method for establishing a genetic transformation system of ophiocordyceps sinensis
By using lyase treatment and PEG-CaCl2-mediated genetic transformation, combined with hygromycin B screening, a genetic transformation system for Xuefeng Cordyceps was successfully established, solving the problem of difficult transformation of Xuefeng Cordyceps and achieving stable expression and functional verification of the gene in Xuefeng Cordyceps.
Patent Information
- Application Number
- CN202510992184.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2045-07-18
AI Technical Summary
Existing technologies make it difficult to successfully establish a genetic transformation system for Cordyceps sinensis, mainly because Cordyceps sinensis is difficult to produce spores on artificial culture media, making Agrobacterium-mediated spore transformation difficult, and the PEG-mediated protoplast transformation method has failed in Cordyceps sinensis.
The preparation method of snow worm grassland protoplasts was carried out by treating the protoplasts with lysin solution, combined with the PEG-CaCl2 mediated genetic transformation system, and hygromycin B was used as an resistance marker for screening. The specific steps included culture, enzymatic digestion, washing, centrifugation and buffer treatment, and finally resuscitation culture in hygromycin B screening medium.
A genetic transformation system for Cordyceps sinensis was successfully constructed, enabling the transformation and screening of the hph gene of hygromycin B in Cordyceps sinensis, thus ensuring the genetic stability and functionality of the transformants.
Smart Images

Figure CN120775892B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial genetic transformation technology, and more specifically to a method for establishing a Xuefeng Cordyceps genetic transformation system. Background Technology
[0002] *Ophiocordyceps xuefengensis*, a new medicinal Cordyceps species discovered during the fourth national survey of Chinese medicinal resources in Hunan Province, my country, is a novel fungal species with antioxidant and antitumor activities. It is currently considered one of the most promising Cordyceps resources and has extremely high research value. *Ophiocordyceps xuefengensis* is harvested for its fruiting bodies, and the formation and development of these bodies directly determine its yield and quality. Currently, *Ophiocordyceps xuefengensis* is cultivated artificially, but faces bottlenecks such as low yield and long cultivation cycle. Molecular modification is an effective way to selectively breed high-yielding and high-quality *Ophiocordyceps xuefengensis* varieties. In recent years, the rapid development of gene editing technology has provided strong technical support for research on the gene function of Cordyceps fungi and efficient targeted genetic breeding.
[0003] Molecular breeding of Cordyceps usually relies on establishing a stable and efficient genetic transformation system. However, since its discovery, research on Cordyceps xuefengensis has primarily focused on its active ingredients, with slow progress in molecular research. Insufficient understanding of the regulatory mechanisms governing the development of Cordyceps xuefengensis fruiting bodies has limited the progress of molecular genetic breeding for fruiting body yield. Currently, mechanistic studies mainly involve observing functional genes through editing, with the most common methods being Agrobacterium-mediated transformation and protoplast-mediated transformation. However, Cordyceps xuefengensis has difficulty producing spores on artificial culture media, making Agrobacterium-mediated spore transformation challenging. PEG-mediated protoplast transformation, due to its ease of operation, has become a major method for microbial genetic transformation. Patent CN114958898B discloses a method for preparing and genetically transforming protoplasts of Cordyceps xuefengensis, but the inventors found that this method failed to successfully produce transformants during early genetic transformation of Cordyceps xuefengensis. This was partly because Cordyceps xuefengensis struggles to produce spores on plates, and liquid culture results in large mycelial spheres, making protoplast preparation difficult; and partly because antibiotic screening during later transformation processes failed to yield transformants. As a result, researchers in this field have been unable to successfully establish a genetic transformation method for Xuefeng Cordyceps.
[0004] In summary, how to provide a method for establishing a genetic transformation system for Xuefeng Cordyceps is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides a method for establishing a genetic transformation system of Xuefeng Cordyceps.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] A method for establishing a genetic transformation system for Xuefeng Cordyceps militaris includes the following steps:
[0008] (1) Preparation of protoplasts: After activation and culture, Cordyceps sinensis is treated with lysin solution, then rinsed, filtered and centrifuged.
[0009] The culture medium used for the culture is PDP liquid culture medium and PY liquid culture medium;
[0010] The lysing enzyme solution includes a cell wall lysing enzyme and a snail enzyme;
[0011] (2) Protoplast transformation: Transformation was carried out using a PEG-CaCl2-mediated genetic transformation system.
[0012] Furthermore, the specific operation of step (1) is as follows:
[0013] (11) After activating Xuefeng Cordyceps, inoculate it into PDP liquid culture or PY liquid culture medium and culture at 20-30℃ and 100-150rpm for 3-7 days.
[0014] (12) Mix Cordyceps sinensis with lysin solution at a mass-to-volume ratio of (450-550): (4-6) mg / mL, and then enzymatically hydrolyze at 32-35℃ for 3-5 h.
[0015] (13) After enzymatic digestion, rinse with S1 buffer, then filter and centrifuge.
[0016] Furthermore,
[0017] The PDP liquid culture medium consists of: 200 g / L potato, 20 g / L glucose, 3 g / L peptone and 1 g / L KH2PO4;
[0018] The PY liquid culture medium consists of: 15 g / L glucose, 5 g / L peptone, 2 g / L yeast extract, 1 g / L KH2PO4 and 0.5 g / L MgSO4·7H2O.
[0019] Furthermore, the lysing enzyme solution comprises lysin, snail enzyme, and S1 buffer, with a mass-to-volume ratio of 0.1g:0.1g:10mL.
[0020] The S1 buffer solution comprises 145.72 g / L of mannitol.
[0021] Furthermore, the specific operation of step (2) is as follows:
[0022] (21) Dilute the protoplasts of the snow worm to obtain a protoplast suspension;
[0023] (22) Add the hygromycin expression cassette to the protoplast suspension and place it on ice for 5 min to obtain the first transformation solution;
[0024] (23) Slowly add S3 buffer dropwise, mix well and place on ice for 30 min to obtain the second conversion solution;
[0025] (24) Continue to add S3 buffer, let stand at room temperature for 5 min, continue to add S2 buffer, mix well, and obtain the third conversion solution;
[0026] (25) Add TB3 liquid medium to the third conversion solution and revive overnight. Centrifuge and resuspend to obtain the revival conversion solution.
[0027] (26) The resuscitation and transformation solution was screened and cultured, and the content of hygromycin B in the screening medium was 150 μg / mL.
[0028] Furthermore,
[0029] In step (21), the snow worm herbaceous protoplast is diluted to 10. 7 cells / mL;
[0030] In step (22), the volume ratio of the snow humidor plastocyte suspension to the hygromycin expression cassette is 20:1.
[0031] The volume ratio of the snow worm herbaceous protoplast suspension, the S3 buffer from step (25), and the TB3 liquid culture medium from step (26) was 1:5:25.
[0032] In step (26), the volume ratio of the resuscitation and transformation solution to the screening medium is (1-2):30.
[0033] Furthermore, each 50 mL S3 buffer contains:
[0034] PEG 4000 12.5g, 1M Tirs-HCl (pH 7.5) 0.5mL and 1M CaCl2 1.25mL.
[0035] Furthermore, each 100 mL of S2 buffer includes:
[0036] Mannitol 10.93g, 1M Tirs-HCl (pH 7.5) 1mL and 1M CaCl2 2.5mL.
[0037] Furthermore, the TB3 liquid culture medium comprises: mannitol 109.3 g / L, yeast extract 3 g / L, acid-hydrolyzed casein 3 g / L, and sucrose 20 g / L.
[0038] As can be seen from the above technical solution, compared with the prior art, the beneficial effects achieved by the present invention are as follows:
[0039] This invention provides a method for preparing Cordyceps sinensis protoplasts and constructing a PEG-CaCl2-mediated genetic transformation system, as well as a screening system using hygromycin B as a resistance marker. The hph gene of hygromycin B was successfully transformed into Cordyceps sinensis using PEG-mediated transformation. After four generations of transformation, the target gene was still detectable in the transformants, indicating the successful construction of the genetic transformation system. Through genetic transformation, gene knockout or overexpression experiments can be used to explore the specific functions of specific genes in the development of Cordyceps sinensis fruiting bodies and the developmental mechanism of the fruiting bodies. Attached Figure Description
[0040] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0041] Figure 1 This is a description of the growth of Cordyceps sinensis in PDP liquid culture medium in Example 1 of the present invention.
[0042] Figure 2 This describes the preparation of the snow swarm bioplast in Example 1 of the present invention;
[0043] Figure 3 This is a description of the growth of Cordyceps sinensis in PY liquid culture medium in Example 2 of the present invention.
[0044] Figure 4 This describes the preparation of the snow worm herbaceous bioplast in Example 2 of the present invention;
[0045] Figure 5 This is a description of the growth of *Cordyceps militaris* transformants in Example 3 of the present invention.
[0046] Figure 6 This shows the growth of *Cordyceps militaris* transformants in Example 4 of the present invention.
[0047] Figure 7 This is an electrophoresis result of the hph gene of hygromycin B detected by PCR in the Xuefeng Cordyceps transformant in Example 5 of the present invention, where 1 represents the hph positive control, 2-7 represent the transformant, and 8 represents the Xuefeng Cordyceps negative control.
[0048] Figure 8The wild-type strain (1) and the transformed strains (2, 5) that were continuously cultured in the dark for four generations after the hph gene fragment was transformed into Cordyceps sinensis in Example 5 of the present invention were grown on a selection medium containing 150 μg / mL hygromycin B.
[0049] Figure 9 The growth of Cordyceps sinensis in PDA liquid culture medium (A) and the preparation of protoplasts (B) in Comparative Example 1 of this invention are shown.
[0050] Figure 10 The growth state of Cordyceps militaris mycelium in Comparative Example 2 of this invention is shown in Figure 2. A represents the result of changing the components of PDP liquid culture medium, and B represents the result of changing the components of PY liquid culture medium.
[0051] Figure 11 The above describes the preparation of the snow worm bioplast in Comparative Example 3 of this invention, where A represents the result of changing the amount of enzyme, B represents the result of not adding lysing enzyme, and C represents the result of adding lysing enzyme.
[0052] Figure 12 This is the preparation of the snow worm grassland bioplast in Comparative Example 4 of the present invention, where A represents the result of omitting the rinsing step and B represents the result of changing the centrifugation parameters;
[0053] Figure 13 The results of the failed transformation of Cordyceps sinensis in Comparative Example 5 of this invention are shown. A represents the result of changing the dosage, B represents the result of omitting the step of adding 50 μL S3 buffer, C represents the result of changing the operating temperature, and D represents the result of omitting the resuscitation culture step.
[0054] Figure 14 This is the result of the failed transformation of Cordyceps militaris in Comparative Example 6 of this invention;
[0055] Figure 15 This is the result of the failed transformation of Cordyceps sinensis in Comparative Example 7 of this invention;
[0056] Figure 16 The image shows the transformation failure results of Cordyceps militaris in Comparative Example 8 of this invention. In the image, A represents the plate screening result, B represents the electrophoresis result of PCR detection of the hph gene of hygromycin B, 1 represents the hph positive control, 2-11 represent the transformed strains, and 12 represents the Cordyceps militaris negative control. Detailed Implementation
[0057] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0058] The reagents required for this invention are conventional experimental reagents, purchased from commercially available channels; the experimental methods not mentioned are conventional experimental methods, and will not be described in detail here.
[0059] The Xuefeng Cordyceps used in the following examples is named X-1, and its classification name is Ophiocordyceps xuefengensis. It was deposited on August 10, 2015, at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 11107, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0060] PDA solid culture medium components: 200g potato, 20g glucose, 15g agar powder, diluted with distilled water to 1000mL, and autoclaved at 121℃.
[0061] PDA liquid culture medium components: 200g potato, 20g glucose, distilled water to a final volume of 1000mL, autoclaved at 121℃.
[0062] PDP liquid culture medium components: 200g potato, 20g glucose, 3g peptone, 1g KH2PO4, diluted with distilled water to 1000mL, and autoclaved at 121℃.
[0063] PY liquid culture medium components: 15g glucose, 5g peptone, 2g yeast extract, 1g KH2PO4, 0.5g MgSO4·7H2O, diluted with distilled water to 1000mL, and autoclaved at 121℃.
[0064] S1 buffer composition: 36.43g mannitol, diluted to 250mL with distilled water, pH adjusted to 4.5, and autoclaved at 121℃.
[0065] S2 buffer composition: 10.93g mannitol, 1mL 1M Tirs-HCl, 2.5mL 1M CaCl2, diluted to 100mL with distilled water, pH adjusted to 7.5, and autoclaved at 121℃.
[0066] S3 buffer composition: PEG 4000 12.5g, 1M Tirs-HCl 0.5mL, 1M CaCl2 1.25mL, distilled water to a final volume of 50mL, pH adjusted to 7.5, and autoclaved at 121℃.
[0067] TB3 solid culture medium components: mannitol 109.3g, yeast powder 3g, acid-hydrolyzed casein 3g, sucrose 20g, agarose 8g, distilled water to a final volume of 1000mL, and autoclaved at 121℃.
[0068] TB3 liquid culture medium components: mannitol 109.3g, yeast powder 3g, acid-hydrolyzed casein 3g, sucrose 20g, distilled water to a final volume of 1000mL, and autoclaved at 121℃.
[0069] Example 1
[0070] Preparation of Snowflake Insect Plastogeny
[0071] (1) Preparation of Cordyceps sinensis mycelium: Cordyceps sinensis was inoculated onto PDA solid medium and cultured in the dark at 28℃ for 14 days; wild-type Cordyceps sinensis mycelium blocks (0.5cm×0.5cm) with good growth on PDA solid medium were inoculated into shake flasks containing PDP liquid medium and cultured in the dark at 25℃ and 130rpm for 5 days to form mycelial balls of similar size.
[0072] (2) Preparation of lysing enzyme solution: Weigh 0.1g each of wall-lysing enzyme and snail enzyme, add them to 10mL of S1 buffer, and let them dissolve completely. Filter the solution through a 0.22μm microporous aqueous filter membrane for sterilization and set aside.
[0073] (3) Filter the Xuefeng Cordyceps militaris balls in step (1) using a sterile Buchner funnel. Weigh 500 mg of Xuefeng Cordyceps militaris balls into a 10 mL sterile centrifuge tube, add 5 mL of filtered and sterilized lysing enzyme solution, and enzymatically hydrolyze in a 34℃ constant temperature water bath for 4 h to allow the fungal balls to reach a state of most lysis.
[0074] (4) Take a new 50mL sterile centrifuge tube, add a small amount of S1 buffer, and use a 5mL pipette to thoroughly rinse the lysed bacterial balls in step (3) in S1 buffer to disperse all the bacterial balls as much as possible. After rinsing, mix by blowing with a pipette, then filter through a sterile funnel wrapped with 4 layers of lens paper (on ice), centrifuge at 4000rpm for 10min, discard the supernatant, and obtain the snow worm grassland bioplast.
[0075] (5) Resuspend in pre-cooled S2 buffer, centrifuge at 4000 rpm for 10 min, discard the supernatant, and count using a hemocytometer.
[0076] The growth of Cordyceps sinensis in PDP liquid medium is as follows: Figure 1 As shown, the results showed that Cordyceps militaris grew well in PDP liquid medium and did not form large mycelial balls.
[0077] The protoplasts were counted using a hemocytometer, and the preparation of the protoplasts was observed. Figure 2 As shown, the mycelia of Cordyceps sinensis prepared under PDP liquid culture medium can be used to successfully prepare Cordyceps sinensis bioplasts.
[0078] Example 2
[0079] Preparation of Snowflake Insect Plastogeny
[0080] In step (1), the PDP liquid culture medium is replaced with PY liquid culture medium, and the rest of the operation is the same as in Example 1.
[0081] The growth of Cordyceps sinensis in PY liquid culture medium is as follows: Figure 3 As shown, the results showed that Cordyceps militaris grew better under PY liquid culture medium, forming small, regularly shaped mycelia and some mycelia, rather than large mycelia.
[0082] The protoplasts were counted using a hemocytometer, and the preparation of the protoplasts was observed. Figure 4 As shown, the mycelia of Cordyceps sinensis prepared under PY liquid medium can be used to successfully prepare protoplasts of Cordyceps sinensis. Moreover, the number of protoplasts prepared from Cordyceps sinensis cultured under PY liquid medium is greater than that in Example 1. This is mainly because mycelia are more likely to form than large mycelial balls under PY liquid medium, which is more conducive to the release of protoplasts under the same enzymatic hydrolysis conditions.
[0083] Example 3
[0084] Snowflake Insect Plast Transformation
[0085] (1) Preparation of hygromycin expression cassette: The hygromycin expression cassette used was obtained by amplification of the k-hph-P15A plasmid. The construction of the k-hph-P15A plasmid is described in Efficient production and evaluation of lignocellulolytic enzymes using a constitutive protein expression system in Penicillium oxalicum.
[0086] (2) Dilute the snow worm grassland bioplasts prepared in Example 1 to 10 using S2 buffer. 7 Protoplasts were obtained at a concentration of 1 per mL.
[0087] (3) Dispense 200 μL of protoplast suspension into 50 mL sterile centrifuge tubes, slowly add 10 μL of hygromycin expression cassette (concentration >150 ng / μL), mix gently, place on ice for 5 min to obtain the first transformation solution.
[0088] (4) Slowly add 50 μL of S3 buffer dropwise, mix gently, and place on ice for 30 min to obtain the second conversion solution.
[0089] (5) Continue adding 1 mL of S3 buffer along the tube wall and let it stand at room temperature for 5 min. Continue adding 2 mL of S2 buffer, mix well, and obtain the third conversion solution.
[0090] (6) Add 5 mL of TB3 liquid culture medium to the third conversion solution, incubate overnight at 28°C, centrifuge, and resuspend in 1-2 mL of TB3 liquid culture medium to obtain the resuscitation conversion solution.
[0091] (7) Add the above resuscitation and transformation solution to 30 mL of TB3 solid culture medium (containing 150 μg / mL hygromycin B) that has been preheated to about 50 °C. Shake gently to mix well, blow air for 2 hours, seal the plate with sealing film, and place it in a constant temperature incubator at 28 °C for 6 to 7 days in the dark to observe the growth of transformants.
[0092] like Figure 5 As shown, when the concentration of hygromycin B was 150 μg / mL, the Xuefeng Cordyceps transformant was successfully obtained.
[0093] Example 4
[0094] Snowflake Insect Plast Transformation
[0095] In step (2), the protoplasts are the protoplasts prepared in Example 2, and the remaining operations are the same as in Example 3.
[0096] like Figure 6 As shown, the Xuefeng Cordyceps transformant was successfully obtained.
[0097] Example 5
[0098] PCR detection of Cordyceps sinensis transformants and genetic stability analysis of transformed strains
[0099] (1) The Xuefeng Cordyceps transformants obtained in Example 4 were used to collect single colonies with an inoculation spatula and placed on TB3 solid medium plates containing hygromycin resistance (150 μg / mL hygromycin B) for further screening. They were cultured at 28°C for 7 days until possible positive transformants grew.
[0100] (2) PCR amplification of the target gene (hph gene of hygromycin B): Using the total genomic DNA of the transformant strain in step (1) and the wild-type Cordyceps sinensis strain, the above genome was amplified by PCR using primer pairs (Hph-YZ-PF:CGACGTTAACTGATATTGAAGGAGC, SEQ ID No.1; Hph-YZ-PR:CAACCCAGGGGCTGGTGACGGAATTTTCAT, SEQ ID No.2). The amplified fragment length was 2kb. The PCR amplification system is shown in Table 1.
[0101] Table 1 PCR amplification system
[0102]
[0103] (3) The PCR amplification reaction program is as follows: preheating at 94℃ for 3 min; denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 2 min (extension rate is 1 kb / min), 32 cycles; and complete extension at 72℃ for 5 min.
[0104] (4) 1% agarose gel electrophoresis revealed the presence of the hph gene in all transformant strains, indicating that the hph gene had been successfully transferred into *Cordyceps militaris*, demonstrating the successful construction of the genetic transformation system. Figure 7 ).
[0105] (5) Take 1cm×1cm bacterial blocks from transformants No. 2 and No. 5, which showed significant bands in the electrophoresis results of step (4), rinse them with 0.9% physiological saline, and spread them evenly on the selection medium containing 150μg / mL hygromycin B. Incubate at 25℃ for 7 to 15 days, and subculture in the dark 4 times to detect the genetic stability of the transformants.
[0106] like Figure 8 As shown, regenerated colonies were still observed in the transformed strains after four generations of culture. Figure 8 In samples numbered 2 and 5, after the insertion of the hph gene, the morphology of the hyphae did not change, while no fresh colonies grew on the control plates (wild Xuefeng Cordyceps strain blocks). Figure 8 (Middle No. 1).
[0107] Comparative Example 1
[0108] In step (1), the PDP liquid culture medium is replaced with the PDA liquid culture medium, and the rest of the operation is the same as in Example 1.
[0109] like Figure 9 As shown, using PDA liquid culture medium, *Cordyceps militaris* formed large mycelial balls. Figure 9 A), only a very small number of protoplasts were visible in the microscope field of view. Figure 9 B) This is because the bacterial pellets are difficult to lyse, resulting in poor efficiency in preparing protoplasts.
[0110] Comparative Example 2
[0111] For the preparation of Cordyceps sinensis mycelium, glucose was not added to the PDP liquid culture medium in step (1), and KH2PO4 was replaced with 0.5g. The rest of the operation was the same as in Example 1.
[0112] For the preparation of Cordyceps sinensis mycelium, the glucose in the PY liquid culture medium in step (1) was replaced with 10g, KH2PO4 with 0.5g, and MgSO4·7H2O with 0.3g, and the rest of the operation was the same as in Example 2.
[0113] like Figure 10As shown, the bacteria hardly grow under both conditions, making it impossible to obtain Xuefeng Cordyceps bacteria, thus preventing the preparation of Xuefeng Cordyceps bioplasts.
[0114] Comparative Example 3
[0115] Replace the amount of lysozyme and snail enzyme in step (2) with 0.05g each, and perform the remaining operations as in Example 2.
[0116] In step (2), no lysing enzyme is added, only 0.1g of snail enzyme is added, and the rest of the operation is the same as in Example 2.
[0117] Replace the enzyme in step (2) with Sigma-Aldrich lyase (product number L4025) to make its final concentration 25U, and perform the remaining operations as in Example 2.
[0118] like Figure 11 As shown, under the above conditions, most of the cells still appear as bacterial cells under the microscope, and the cell walls are not lysed, making it almost impossible to prepare protoplasts, which cannot be used for subsequent transformation.
[0119] Comparative Example 4
[0120] Remove the step of rinsing the mycelium with S1 buffer in step (4), directly wipe with lens paper for filtration, centrifuge and discard the supernatant, and the rest of the operation is the same as in Example 2.
[0121] Change the centrifugation conditions in steps (4) and (5) to 2500 rpm for 5 min, and the rest of the operation is the same as in Example 2.
[0122] like Figure 12 As shown, only a very small number of protoplasts can be obtained, which cannot be used for subsequent transformations.
[0123] Comparative Example 5
[0124] Replace the amount of protoplast suspension solution in step (3) with 100 μL and the concentration of hygromycin expression cassette with 100 ng / μL, and the rest of the operation is the same as in Example 4.
[0125] Remove the step of adding 50 μL S3 buffer in step (4), and directly incubate on ice for 30 min. The rest of the operation is the same as in Example 4.
[0126] Replace the 5-minute room temperature in step (5) with a 5-minute ice bath, and perform the remaining operations as in Example 4.
[0127] The step of adding TB3 liquid culture medium in step (6) and reviving and culturing overnight at 28°C is omitted. The rest of the operation is the same as in Example 4.
[0128] like Figure 13 As shown, no Xuefeng Cordyceps transformants were obtained.
[0129] Comparative Example 6
[0130] In step (7), the concentration of hygromycin B is changed to 600 μg / mL, and the rest of the operation is the same as in Example 4.
[0131] like Figure 14 As shown, after 7 days of culture, no transformants were observed on the regeneration plate. The culture time was extended to 14 days, but no transformants were observed. We speculate that at a concentration of 600 μg / mL hygromycin B, although the protoplasts were revived in the regeneration medium overnight, they were still in a fragile state and could not tolerate the high antibiotic concentration.
[0132] Comparative Example 7
[0133] In step (7), the concentration of hygromycin B is changed to 400 μg / mL, and the rest of the operation is the same as in Example 4.
[0134] like Figure 15 As shown, there is still no transformation growth.
[0135] Comparative Example 8
[0136] In step (7), the concentration of hygromycin B was changed to 100 μg / mL, and the rest of the operation was the same as in Example 4, to obtain the Xuefeng Cordyceps transformant.
[0137] The PCR detection procedure for Cordyceps sinensis transformants is the same as in Example 5.
[0138] The results are as follows Figure 16 Unlike Comparative Examples 6 and 7, this comparative example showed a higher number of transformants growing. Figure 16 A). However, when the above transformants were selected for PCR verification, the electrophoresis results did not detect the presence of the hph gene. Figure 16 The hph gene was not successfully transferred into Cordyceps militaris (B, 2-11), indicating that a large number of false positive transformants were obtained at a screening concentration of 100 μg / mL hygromycin B.
[0139] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.
[0140] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for establishing a genetic transformation system of Xuefeng Cordyceps, characterized in that, Includes the following steps: (1) Preparation of protoplasts: (11) After activating the Xuefeng Cordyceps, inoculate it into PDP liquid medium or PY liquid medium and culture it at 20~30℃ and 100~150 rpm for 3~7 days; The PDP liquid culture medium consists of: 200 g / L potato, 20 g / L glucose, 3 g / L peptone and 1 g / L KH2PO4; The PY liquid culture medium consists of: 15 g / L glucose, 5 g / L peptone, 2 g / L yeast extract, 1 g / L KH2PO4 and 0.5 g / L MgSO4·7H2O; (12) Mix Cordyceps militaris with lysin solution at a mass-to-volume ratio of (450~550): (4~6) mg / mL, and then enzymatically hydrolyze at 32~35℃ for 3~5 h; The lysing enzyme solution comprises lysin, snail enzyme, and S1 buffer, with a mass-to-volume ratio of 0.1 g:0.1 g:10 mL. The S1 buffer solution comprises 145.72 g / L mannitol; (13) After enzymatic digestion, rinse with S1 buffer, then filter and centrifuge. The centrifugation parameters were 4000 rpm for 10 min; (2) Protoplast transformation: (21) Dilute the protoplasts of the snow humidor to obtain a protoplast suspension; Dilute the snow worm grassland bioplast to 10 7 cells / mL; (22) Add the hygromycin expression cassette to the protoplast suspension and place it on ice for 5 min to obtain the first transformation solution; The volume ratio of the snow worm protoplast suspension to the hygromycin expression cassette was 20:
1. (23) Slowly add S3 buffer dropwise, mix well and place on ice for 30 min to obtain the second conversion solution; The S3 buffer comprises the following components at the following mass concentrations: 25% PEG4000, 10 mM Tirs-HCl and 25 mM CaCl2, pH adjusted to 7.5; (24) Continue to add S3 buffer, let stand at room temperature for 5 min, continue to add S2 buffer, mix well, and obtain the third conversion solution; The S2 buffer comprises the following components at the following mass concentrations: 0.6 M mannitol, 10 mM Tirs-HCl and 25 mM CaCl2, pH adjusted to 7.5; (25) Add TB3 liquid medium to the third conversion solution and revive overnight. Centrifuge and resuspend to obtain the revival conversion solution; The TB3 liquid culture medium consists of: mannitol 109.3 g / L, yeast extract 3 g / L, acid-hydrolyzed casein 3 g / L, and sucrose 20 g / L. (26) The resuscitation and transformation solution was subjected to screening culture, and the content of hygromycin B in the screening culture medium was 150 μg / mL; The volume ratio of the resuscitation and transformation solution to the screening medium was (1~2):30; The volume ratio of the snow worm prairie protoplast suspension, the S3 buffer from step (25), and the TB3 liquid culture medium from step (26) was 1:5:25.
Citation Information
Patent Citations
Establishment and application of PEG-mediated genetic transformation system for common bean husk coccidioidomycetes
CN114958898B