Application of ZmMIR319A gene in regulation and control of included angle of corn leaves

Abstract

The invention relates to the field of genetic engineering breeding and molecular breeding, and particularly discloses application of a ZmMIR319A gene in regulation and control of an included angle of corn leaves. The nucleotide sequence of the ZmMIR319A gene is as shown in SEQ ID NO. 1. According to the invention, ZmMIR319A in corn is knocked out at a fixed point by using a CRISPR / Cas9 gene editing technology, three different types of gene knockout mutants are created, and a ZmMIR319A overexpression material is created at the same time. Compared with a control group, the ZmMIR319A has the advantages that the leaf included angle of the spike leaves of the knockout mutant is reduced, and the leaf included angle of the spike leaves of the overexpression plant is increased, so that the ZmMIR319A can positively regulate and control the corn leaf included angle. The invention lays a theoretical foundation for researching a corn leaf included angle molecular mechanism, and provides a new molecular marker and a new gene resource for molecular design, breeding and cultivation of excellent new corn germplasm with small leaf included angle and close planting resistance.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering breeding and molecular breeding, and specifically relates to corn ZmMIR319A And its application in regulating the angle of corn leaves. Background Art

[0002] Corn is the world's largest grain crop. In recent years, the structural adjustment of China's crop production and the rapid development of essential industries such as animal husbandry and deep processing have led to a sharp increase in demand for corn, resulting in an increasingly prominent imbalance between corn supply and demand in my country. Corn breeding practices have shown that increasing planting density contributes far more to total yield growth than increasing yield per plant (Mansfield and Mumm, 2014). Improving cultivar tolerance to high density and planting density has become a key goal and trend in modern corn breeding and production. Reducing plant leaf angle and fostering a compact plant architecture are key to improving corn's high-density tolerance. The essence of high-density tolerance lies in the rational allocation of light and nutrients to corn plants under high-density conditions, ensuring good stress resistance. This results in good colony adaptability, high photosynthetic efficiency, and efficient and effective distribution of photosynthetic product sources, flows, and sinks, ultimately leading to higher colony yields. A compact plant architecture plays a key role in light interception, improving photosynthetic efficiency, and optimizing the distribution of assimilates. Leaf angle is a key component of high-density tolerance. An appropriate leaf angle, especially a compact plant with upright leaves above the ear, can reduce mutual shading between corn plants, improve the overall canopy structure in the field, enhance airflow and light transmission between plants, and better enable the functional leaves (the ear leaf, the first leaf above the ear, and the first leaf below the ear) to capture sunlight and photosynthesize, thereby increasing corn yield. Breeding practice has shown that converting compact corn varieties to flatter plant types is highly unfavorable for dense planting, with yield reductions of up to 13.79% under dense planting conditions. Conversely, converting flatter plant types to compact ones significantly improves density tolerance, increasing yields by up to 16.9% under dense planting conditions (Li Denghai et al., 1992). Studies of corn breeding history also show that modern corn hybrids have more upright, upward-shooting leaves compared to earlier varieties, significantly increasing their light-capturing capacity by 14% (Maddonni et al., 2012). Therefore, reducing leaf angle and increasing leaf uprightness are the key to improving corn density tolerance and yield. Discovering the key genes that regulate corn leaf angle and uprightness and analyzing their genetic networks have important theoretical and practical significance for breeding new varieties that are resistant to dense planting.

[0003] MicroRNAs (miRNAs) are a class of endogenous, small, noncoding RNA molecules (21-24 nt in length) that target mRNAs through complementary base pairing, triggering degradation or translational repression. They play a key role in plant responses to environmental stresses (Lagos-Quintana et al., 2001; Lau et al., 2001; Lee et al., 2001). MiRNA genes are transcribed by Pol II to form pri-miRNAs, which are cleaved into mature miRNAs by Dicer-like enzymes. These miRNAs then bind to AGO proteins to form the RNA-induced silencing complex (RISC) to carry out their functions (Park et al., 2002; Reinhart et al., 2002). To date, the miRBase database (http: / / www.mirbase.org / ) contains 38,589 mature miRNAs and 28,645 precursor sequences containing hairpin structures. These miRNAs are widely involved in processes such as hormone signaling, cell differentiation, and organ morphogenesis.

[0004] miR319 is a conserved microRNA in plants. It and its target gene TCP form the miR319-TCP module, which widely regulates plant growth and development and stress response. In Arabidopsis, miR319 targets TCP4 , affecting petal growth, leaf development, and leaf serration formation (Hay et al., 2004; Palatnik et al., 2003; Palatnik et al., 2007); miR319-TCP module is involved in regulating the initiation of epidermal hairs in poplar and the development of cotton fibers (Cao et al., 2020); overexpression in rice Os-miR319 Will reduce OsTCP5 and OsTCP8 The expression of miR319 can lead to leaf widening and increased leaf veins (Luo et al., 2006). In Arabidopsis, silencing miR319 or overexpressing TCP can delay leaf senescence, and the expression level of miR319 is correlated with flowering time (Schommer et al., 2008). miR319b Negative regulation TCP5 , enhancing ethylene synthesis to improve salt tolerance (Zhou et al., 2013); in rice, miR319 is involved in regulating stress tolerance under cold and heat stresses (Yang et al., 2013). However, there are currently no studies or reports on miRNA319 regulating leaf angle in maize.

[0005] This study used CRISPR / Cas9 (Clustered, Regularly Interspaced, Short Palindromic Repeats-associated Endonuclease 9) gene editing technology to create three different types of mutations. ZmMIR319A gene knockout mutants ZmMIR319A-KO#1、ZmMIR319A-KO#2 and ZmMIR319A-KO#3, Also created ZmMIR319A Overexpression materials ZmMIR319A-OE#1、ZmMIR319A-OE#2 and ZmMIR319A-OE#3。 Field experiments showed that compared with wild-type control plants, ZmMIR319A Knockout mutants ( ZmMIR319A-KO ) leaf angle was significantly reduced and the plant shape was more compact, while the overexpression plants ( ZmMIR319A-OE ) showed a phenotype of increased leaf angle and loose plant shape, indicating that ZmMIR319A Participates in regulating leaf angle and leaf uprightness of corn. This invention will enrich the regulatory network of corn leaf angle and leaf uprightness, further explore the key genes regulating corn leaf angle and analyze their genetic network for the theoretical and practical significance of breeding new varieties with ideal plant shapes that are resistant to dense planting. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to clearly ZmMIR319A The application of this technology in regulating corn leaf angle provides genetic resources and new germplasm for breeding new corn varieties with small leaf angles, compact plant shapes, and tolerance to dense planting. The specific technical solution is as follows: 1. Maize inbred line X249 ZmMIR319A Sequence analysis of ZmMIR319A The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the mature sequence of miR319 is shown in SEQ ID NO. 2. Suitable sites were selected for gene editing target design.

[0007] 2. Construction using CRISPR / Cas9 gene editing technology ZmMIR319A The gene-editing vector was introduced into callus tissue of the maize inbred line X249 using Agrobacterium-mediated transfection. The resulting T0-generation transgenic plants were then hybridized with wild-type X249 to produce F1-generation seeds. After self-pollination and genotyping, homozygous non-transgenic gene-edited plants were obtained. Changes in the leaf angles of the first, second, and third leaves on the ear were observed and statistically analyzed.

[0008] 3. Construct an overexpression vector and introduce it into callus tissue of the maize inbred line X249 using Agrobacterium-mediated transfection. After obtaining T2 homozygous positive plants, observe and analyze the changes in the leaf angles of the first, second, and third leaves on the ear.

[0009] The present invention utilizes CRISPR / Cas9 technology to ZmMIR319A Through site-directed gene editing, three mutants with different editing types of this gene were obtained. All three mutants showed a phenotype with reduced leaf angle. ZmMIR319A Overexpression materials showed a phenotype of increased leaf angle. ZmMIR319A Positively regulating the leaf angle of corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] 图1 、 ZmMIR319A Knockout mutant vector design.

[0011] 图2 、 ZmMIR319A Analysis of gene sequence variation in knockout events. Base variant sites are indicated in blue font. ZmMIR319A-KO#1、ZmMIR319A-KO#2 and ZmMIR319A-KO#3 The missing bases are indicated by short blue lines.

[0012] 图3 ,corn ZmMIR319A Comparison of leaf angle phenotypes of seedlings and first leaves between knockout mutants and overexpressing plants at the seedling stage. a. ZmMIR319A Knockout mutant whole plant; b. ZmMIR319A The angle of the first leaf of the knockout mutant; c. ZmMIR319A Statistical analysis of the angle of the first leaf of the knockout mutant. d. ZmMIR319A Overexpression plants; e. ZmMIR319A Overexpression of the first leaf angle; f. ZmMIR319A Statistical analysis of the angle of the first leaf of overexpressing plants. Asterisks * in the histograms indicate significant differences (p < 0.05) by t-test.

[0013] 图4 ,corn ZmMIR319A Phenotype of mature plants of knockout mutants and comparison of the angles of the first, second, and third leaves on the ear. a. ZmMIR319A Knockout mutant whole plant; b. ZmMIR319A The angles of the first, second, and third leaves on the ear of the knockout mutant; c. ZmMIR319A Statistical analysis of the angles between the first, second, and third leaves on the ear of the knockout mutant. Asterisks * in the bar graphs indicate significant differences (p < 0.05) by t-test.

[0014] 图5 ,corn ZmMIR319A Phenotype of overexpressing plants at maturity and comparison of the angles of the first, second, and third leaves on the ear. a. ZmMIR319A Whole plant of overexpressing plant; b. ZmMIR319A The angle between the first, second, and third leaves on the ear of the overexpressing plant; c. ZmMIR319A Statistical analysis of the angle of the first, second and third leaves on the ear of the overexpression plants. The asterisk (*) in the column chart indicates that there is a significant difference (p<0.05) in the t-test. DETAILED DESCRIPTION

[0015] Example One ZmMIR319A Mutant material To clarify ZmMIR319A the role of the mutant in the leaf angle of corn, the present application uses gene cloning and vector construction technology to create ZmMIR319A mutants through gene editing and investigate the function of the gene in corn.

[0016] The present application selects corn inbred line X249 as the recipient material for gene editing, and selects ZmMIR319A the sequence shown by MT1 of 10 bases before the mature sequence (5'-CTGTTTGTGG-3') and the first 13 bases of the mature sequence (5'-TTGGACTGAAGGG-3') as the target region for CRISPR / Cas9 gene editing.

[0017] MT1 (SEQ ID NO. 3): CTGTTTGTGGTTGGACTGAAGGG 1、ZmMIR319A Construction of knockout vector The gene editing vector of the present application is pBUE411-ZmMIR319A-Cas9 , the basic vector of the vector is pBUE411-Cas9 , the intermediate vector is pCBCmT1T2 , and gRNA is provided. The present application obtains MT-sgRNA by designing target points on primers and then through PCR, and further connects to the basic vector through enzyme digestion, and the specific construction process is as follows.

[0018] (1) Design of target gRNA. The gene conservative sequence of ZmMIR319A is input into the http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR website for target design. The sgRNA skeleton sequence of the present application is obtained by directly amplifying the intermediate vector.

[0019] (2) MT-sgRNA is obtained by designing target points on primers and PCR amplification. Primer ZmMIR319A-MT1-F (SEQ ID NO. 4) and primer ZmMIR319A-MT1-R (SEQ ID NO. 5) amplify the intermediate vector pCBCmT1T2 for obtaining a fragment containing the first and second targets. The PCR system and conditions are as follows: template DNA (intermediate vector pCBCmT1T2 ≥30 ng / μL) 1.2 μL; Primer F / R: each 1.2 μL; sterilized ddH2O: 11.4 μL; 2X MCLAB enzyme (product number: I5HMb00): 15 μL. The temperature program of PCR is as follows: ① 98 ℃ 2 min; ② 98 ℃ 10 s; ③ 58 ℃ 30 s; ④ 72 ℃ 30 s; ⑤ cycle 33 times from ②-④; ⑥ 72 ℃ 5 min; ⑦ 25 ℃ 10 min. The PCR product is recovered after agarose gel electrophoresis.

[0020] The primer base sequence required for vector construction is shown in SEQ ID NO. 4 and SEQ ID NO. 5.

[0021] SEQ ID NO. 4: 5'-ATATATGGTCTCTGGCGACTGTTTGTGGTTGGACTGAAGGGGTTTTAGAGCTAGAAATAGCAA-3'; SEQ ID NO. 5: 5'-ATTATTGGTCTCTAAACCTGTTTGTGGTTGGACTGAATGCTTCTTGGTGCCGC-3'; (3) Constructed to the backbone vector by enzyme digestion and ligation. The pBUE411-Cas9 vector and the recovered sgRNA fragment with the target were digested with BsaI BsaI, and T4 ligase was added to ligate the vector and the sgRNA fragment. The enzyme digestion and ligation system is as follows: sgRNA fragment: 2 μL pBUE411-Cas9 vector (≥60 ng / μL): 2 μL 10 x NEB Buffer: 1.5 μL BsaI endonuclease (product number: #R3733S): 1 μL T4 ligase (product number: #M0202M): 1 μL ddH2O: 6 μL.

[0022] The design diagram of pCas9-ZmMIR319A knockout mutant vector is shown in 图1 .

[0023] 2. Agrobacterium-mediated genetic transformation of maize

[0024] The transformation receptor is maize inbred line X249, which carries one ZmMIR319A copy.

[0025] The above-constructed pCas9-ZmMIR319A The vector was heat-shocked into Agrobacterium tumefaciens EHA105, identified by PCR, and stored at -80°C with glycerol. Freshly excised immature embryos of the inbred line X249, approximately 1.5 mm in size, were used as recipient material. The excised maize embryos were placed in 2 mL plastic centrifuge tubes containing 1.8 mL of suspension for no more than 1 hour, with approximately 100 embryos placed in each tube. The suspension was aspirated and the embryos were washed twice with fresh suspension, leaving a small amount of suspension at the bottom of the tube just above the embryos. The tubes were then heat-shocked at 43°C for 2 minutes, followed by an ice bath for 1 minute. Any remaining wash solution was aspirated with a pipette, and 1.0 mL of Agrobacterium infection solution was added. The tubes were gently shaken for 30 seconds and then incubated in the dark for 8 minutes. The embryos and infection solution in the centrifuge tubes were then poured onto the co-culture medium, shaken thoroughly, and the excess infection solution was aspirated with a pipette. All embryos were co-cultured with their scutellum facing upwards at 23°C in the dark for 3 days. After co-cultivation, transfer the embryos to recovery medium using sterile forceps and incubate at 28°C for 14 days. Carefully remove any sprouts that may have grown from the embryos. After recovery, transfer the embryos to selection medium containing 1.5 mg / L Bialaphos for three rounds of selection, each lasting two weeks. Then, transfer the embryos to selection medium containing 2 mg / L Bialaphos for two rounds of selection, each lasting two weeks. Resistant calli are transferred to expansion medium and incubated in the dark at 28°C for two weeks. Subsequently, the expanded resistant calli are transferred to induction medium and incubated in the dark at 28°C for two weeks. Finally, transfer the expanded resistant calli to differentiation medium and incubate at 25°C under 5000 lux for two weeks. After the culture is completed, separate the differentiated seedling clusters into individual seedlings and place them in rooting medium. Continue to culture at 25°C and 5000 lux until rooting; transfer the seedlings into small nutrient pots for growth. After they survive, transplant them into the greenhouse and harvest the offspring seeds after 3-4 months.

[0026] 3. Detection of knockout mutation results in T0 generation plants To determine the knockout mutation results of T0 generation plants, the following steps were taken: The present invention uses the CTAB method to extract DNA from corn leaves. The specific method is as follows: cut a seedling leaf of about 2 cm in length and place it in a 2 mL centrifuge tube filled with steel balls; immerse the centrifuge tube containing the leaf in liquid nitrogen for 5 minutes and use a grinder to break the leaf sample; add 700 μL of CTAB extraction buffer (containing 1% β-mercaptoethanol), shake vigorously to mix, preheat in a constant temperature water bath at 65 ℃ for 20-30 min (take out and invert once during this period); after the centrifuge tube is cooled to room temperature, add 700 μL of chloroform: isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 s and let it stand for a while at room temperature; centrifuge at 12000 rpm for 5 min at 4 ℃, take 500 μL of supernatant and put it into a new 1.5 mL centrifuge tube; add an equal volume of isopropanol to the centrifuge tube containing the supernatant and shake gently to mix, let it stand at room temperature for about 10 min; then place the centrifuge tube containing the sample in a 4 ℃ centrifuge, centrifuge at 12000 rpm for 10 min, gently aspirate the supernatant, discard the supernatant, and retain the precipitate; add 800 μL of 75% ethanol, wash the precipitate twice, centrifuge at 10000 rpm for 5 min, and discard the supernatant; let the sample dry naturally at room temperature for 2-4 After 1 h, obtain a DNA precipitate. Dissolve the DNA in sterile water and gently vortex to fully dissolve the DNA. Store the DNA sample at -20°C. Measure the DNA concentration using a Nanodrop assay and dilute to 10 ng / L for use as a PCR template.

[0027] Then according to ZmMIR319A PCR primers were designed based on gene sequences.

[0028] Detection target: MT1; product size: 636 bp; primer sequences are shown in SEQ ID NO.6 and SEQ ID NO.7: SEQ ID NO.6: ZmMIR319A-1 -TF: 5'- CGTTTGCGTTCACCTCTG-3'; SEQ ID NO.7: ZmMIR319A-1 -TR: 5'- GGTCCCCGAGCTCTATCG-3'.

[0029] Amplify using the following PCR parameters: Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL DNA, 5.5 μL sterile ddH2O, 7.5 μL 2x Taq mix (Product No.: 10103ES); Reaction procedure: Conventional PCR: 58°C annealing, extension 30s, 32 cycles.

[0030] The PCR product is then recovered and connected to the T vector for sequencing. By sequencing the DNA sequences of the target region of multiple independent positive transformation events in the T0 generation, it is determined whether gene editing has occurred in the target region.

[0031] Using X249 as the transgenic plant receptor, three mutation types were obtained. The sequences before and after editing are as follows: 图2 As shown, corresponding to 3 ZmMIR319A Homozygous allelic mutants: ZmMIR319A-KO#1、ZmMIR319A-KO#2 and ZmMIR319A-KO#3 . Compared with wild type ZmMIR319A The mature sequence alignment showed that ZmMIR319A-KO#1 exist ZmMIR319A There is a 9-bp deletion in the mature sequence region of the gene; ZmMIR319A-KO#2 exist ZmMIR319A There is a 3 bp deletion in the mature sequence region; ZmMIR319A-KO#3 exist ZmMIR319A There is a 1 bp deletion in the mature sequence region of the gene. 图2 ).

[0032] 4. Genotyping of F1 plants

[0033] Since the T0 generation corn plants grown in the greenhouse often have uncoordinated development of female ears and male ears, in order to reproduce the T0 generation plants and make the obtained gene editing type inherited, the present invention uses wild-type pollen of the corn inbred line X249 as the above-mentioned ZmMIR319A-KO#1、ZmMIR319A-KO#2 and ZmMIR319A-KO#3 The T0 generation plants are pollinated to obtain F1 generation seeds, and the plants that grow are F1 generation plants.

[0034] The F1 generation plants include two segregation types, one is Cas9 - positive plants (transgenic plants), the other is Cas9 -Negative plants (non-transgenic plants). In order to avoid the continuous editing of the X249 wild-type allele introduced by cross pollination by sgRNA and Cas9, thereby causing the complexity of mutation types, it is necessary to select plants without the X249 wild-type allele from the F1 generation through genotyping. Cas9 Gene, but contains T0 generation mutation type plants, such plants can be self-fertilized to obtain non-transgenic F2 generation. The genotyping steps of F1 generation plants are as follows: After extracting leaf DNA using the CTAB method, Cas9 PCR amplification was performed using specific primers for the gene. The base sequences are shown in Cas9-F (SEQ ID NO.8) and Cas9-R (SEQ ID NO.9): SEQ ID NO.8: 5'-CCCGGACAATAGCGATGT-3'; SEQ ID NO.9: 5'-GAGTGGGCCGACGTAGTA-3'.

[0035] The PCR reaction system is the same as above; the reaction procedure is: conventional PCR: 58℃ annealing, extension 30s, 32 cycles. After the PCR products were subjected to agarose gel electrophoresis, the Cas9 - positive plants and Cas9 -Negative plants.

[0036] Further targeting Cas9 - Negative plants, using the above-mentioned primers for detecting the target ZmMIR319A-1 -TF and ZmMIR319A-1 -TR, perform PCR amplification; after the PCR product is purified, connect it to the T vector and sequence it; the genetic status of the T0 generation mutation type is determined based on the sequencing results.

[0037] 5 Genotyping of F2 plants The above does not contain Cas9 After self-pollination of F1 plants that do not contain the T0 generation mutation type, homozygous, non-transgenic gene-edited seeds can be obtained through genotyping. These seeds are mutants with a homozygous genetic background.

[0038] The F2 progeny obtained from self-crossing of F1 plants include three segregating types: AA, Aa, and aa. We selected homozygous, non-transgenic, gene-edited plants from the F2 generation through genotyping for further leaf angle measurement. Furthermore, self-crossing of these plants can yield homozygous, non-transgenic, gene-edited seeds.

[0039] The genotyping steps for F2 plants were as follows.

[0040] After extracting leaf DNA from F2 plants according to the CTAB method, the above primers were used to ZmMIR319A-T-F and ZmMIR319A-T-R Perform a round of PCR amplification, and then use specific primers to amplify the product ZmMIR319A-T2-F and ZmMIR319A- T2-R A second round of PCR amplification was performed, and the PCR products were subjected to non-denaturing PAGE electrophoresis (gel concentration: 12%; voltage: 150 V; time: 2.5 h) for genotyping. Homozygous gene-edited plants were self-pollinated to obtain homozygous non-transgenic gene-edited seeds. The base sequence is as follows ZmMIR319A-T2-F (SEQ ID NO. 10) and ZmMIR319A-T2-R SEQ ID NO.11): SEQ ID NO.10: 5'-AATCAAGCTCTACGCTGTT-3'; SEQ ID NO. 11: 5'-AAGCGTTTGAGCAAACAA-3'.

[0041] Reaction system: 15 μL MIX conventional PCR system, 0.5 μL forward primer, 0.5 μL reverse primer, 1 μL first-round PCR product, 5.5 μL sterile ddH2O, 7.5 μL 2X M5 HiPer PAGE Taq PCR mix (Polymer Biotech Co., Ltd., Cat. No. 10103ES); Reaction procedure: conventional PCR: 58°C annealing, extension for 30 s, 32 cycles.

[0042] PCR products were subjected to non-denaturing polyacrylamide gel electrophoresis and then stained with silver nitrate to visualize bands. Genotyping was performed based on band size. Plants homozygous for gene editing were then subjected to leaf angle measurement.

[0043] Example 2 Corn ZmMIR319A Overexpression vector construction and transgenic plant phenotypic screening 1. ZmMIR319A Overexpression vector construction (1) Obtaining and amplifying the target gene. The precursor sequence of maize miR319A, pri-miR319A, was obtained from the public database miRBase. Specific primers ZmMIR319A-OE-F (SEQ ID NO. 12) and ZmMIR319A-OE-R (SEQ ID NO. 13) were designed based on the miR319A precursor sequence. PCR amplification was performed using a high-fidelity DNA polymerase to obtain ZmMIR319A Precursor fragment. PCR system and conditions were as follows: template DNA (X249 genomic DNA), 1.2 μL; Primer F / R, 1.2 μL each; sterile ddH2O, 11.4 μL; 2X MCLAB enzyme (Product No. I5HMb00), 15 μL. PCR temperature program was as follows: ① 98°C for 2 min; ② 98°C for 10 s; ③ 58°C for 30 s; ④ 72°C for 30 s; ⑤ 33 cycles from ② to ④; ⑥ 72°C for 5 min; ⑦ 25°C for 10 min. PCR products were recovered after agarose gel electrophoresis.

[0044] The base sequences of the primers required for vector construction are shown in SEQ ID NO.12 and SEQ ID NO.13.

[0045] ZmMIR319A-OE-F (SEQ ID NO. 12) and TGTTACTTCTGCAGCCCGGGGGTTCAGTTTTCTCTGGAA ZmMIR319A-OE-R (SEQ ID NO.13): CAAGCGTTTGAGCAAACAAAAG (2) Construct the vector into the backbone by enzyme digestion and ligation, and select the plant expression vector pBI121-Ubi containing the maize ubiquitin promoter to drive Z mMIR319A Efficient expression. Double-digest the vector with restriction endonucleases XmaI and SmaI to recover the linearized vector fragment. Prepare for insertion of the miR319A precursor. Add recombination ligase to ligate the vector and target fragment. The 5 μL enzyme digestion and ligation system is as follows: pri-miR319A fragment: 2 μL, pBI121-Ubi vector (≥60 ng / μL): 2 μL, DNA recombination ligase (Product No. 7E682G2): 1 μL.

[0046] The ligation product was transformed into competent Escherichia coli (DH5α), and positive clones were screened on a medium containing antibiotic kanamycin. The plasmid was extracted and confirmed by sequencing. mMIR319A Correct insertion of the precursor.

[0047] 2. T0 generation ZmMIR319A Overexpression plant result detection In order to determine whether the T0 generation plants are positive seedlings, we use the Basta resistance gene to screen positive seedlings. The specific method is as follows: Positive events can be screened by applying a 1 / 1000th concentration of Basta evenly to the leaves of T0 plants. Obvious phenotypic differences typically begin to appear within 3-7 days after application. Plants successfully expressing the bar / pat gene will have leaves that remain green and healthy, or experience only minor, transient chlorosis / burn (especially at higher concentrations or under strong light), which quickly recovers.

[0048] T0-generation positive plants (heterozygous) were self-pollinated to obtain T1-generation seeds (due to segregation, T1-generation seeds included transgenic homozygous, heterozygous, and wild-type seeds). Twenty plants were then sown and planted, and each was self-pollinated to harvest T2-generation seeds. Fifty plants were sown from these 20 seeds and screened using the method described above for Basta resistance gene-positive seedlings. T2-generation seeds that tested positive for all 50 plants were considered homozygous transgenic seeds; otherwise, they were heterozygous transgenic seeds or wild-type seeds. The selected T2-generation homozygous transgenic seeds were sown and their leaf angles measured.

[0049] Example 3 Corn ZmMIR319A Phenotypic observation of knockout mutants and overexpression plants 1. Planting of corn materials

[0050] Select the wild type X249 with full development and uniform grain size, ZmMIR319A Mutants ( ZmMIR319A-KO# 1、ZmMIR319A-KO#2、ZmMIR319A-KO#3 ) seeds and overexpression ( ZmMIR319A-OE#1、ZmMIR319A-OE#2、 ZmMIR319A-OE#3 ) seeds were sown in 20 cm x 20 cm pots and cultured in a climatic chamber (16 hours light / 8 hours dark, temperature 25°C, humidity 50%, light intensity 1000µE) to compare leaf angle differences among different accessions at the seedling stage. Simultaneously, in late May, the same seeds were sown directly at the University of Science and Technology Beijing's Pinggu Experimental Base to compare leaf angle differences among different accessions at maturity.

[0051] 2. Observation of plant leaf angle phenotype At the four-leaf stage and during the pollen shedding phase, wild-type, mutant, and overexpressing plants with consistent growth patterns were photographed and their leaf angles measured using a LAMDA leaf inclination meter. For four-leaf-old seedlings, the leaf angle of the first leaf was measured. For pollen shedding plants, the leaf angles of the first, second, and third leaves on the ear were measured. At least ten individual plants were measured for each material.

[0052] The leaf angle survey and comparison at the seedling stage showed that compared with the wild type, ZmMIR319A mutant ZmMIR319A-KO#1、 ZmMIR319A-KO#2、ZmMIR319A-KO#3 The leaf angle of the first leaf is significantly reduced ( 图3 ac), and ZmMIR319A Overexpression plants ZmMIR319A-OE#1、ZmMIR319A-OE#2、ZmMIR319A-OE#3 The leaf angle of the first leaf increased significantly ( 图3 df). Statistical analysis was performed using the Student's t-test to compare significant differences compared to the wild-type control. An asterisk (*) above the bar graph indicates a significant difference compared to the wild-type control (P < 0.05).

[0053] The leaf angle survey at maturity showed that compared with the wild type, ZmMIR319A mutant ZmMIR319A-KO#1、 ZmMIR319A-KO#2、ZmMIR319A-KO#3 The leaf angles of the first leaf (L1), second leaf (L2), and third leaf (L3) on the panicle of the wild type were significantly smaller than those of the corresponding leaves ( 图4 ac). ZmMIR319A Overexpression plants ZmMIR319A-OE#1、 ZmMIR319A-OE#2、ZmMIR319A-OE#3 The leaf angles of the first leaf (L1), second leaf (L2), and third leaf (L3) on the panicle of the wild type were significantly larger than those of the corresponding leaves ( 图5 ac). Statistical analysis was performed using the Student's t-test to compare significant differences between the cells and the wild-type control. An asterisk (*) above the bar graph indicates a significant difference (P < 0.05) between the cells and the wild-type control.

[0054] The present invention obtains ZmMIR39AThe knockout mutant has a smaller leaf angle (including the angles of the first, second, and third leaves on the ear), demonstrating significant advantages under field conditions with increased corn planting density. This provides an important avenue for increasing planting density and boosting both per-unit-area and total corn yield in my country. Furthermore, the mutant is an excellent material for studying the molecular regulation of leaf angle in maize, providing important theoretical foundations, genetic resources, and germplasm for molecular genetic improvement and breeding of ideal maize plant types.

[0055] References:

[0056] Li Denghai. The role of maize plant type in high-yield breeding. Shandong Agricultural Sciences, 1992, 3: 4-8.

[0057] Tang Bin, Li Hongzhi, Cao Zhongyang, Chen Songlin, Wang Qiong, Zou Kangping, Chen Zhihui. Effects of different planting densities on yield and main agronomic traits of 13 maize varieties. Hunan Agricultural Sciences, 2013, 01:17-21.

[0058] Cao JF, Zhao B, Huang CC, Chen ZW, Zhao T, Liu HR, Hu GJ, ShangguanXX, Shan CM, Wang LJ, Zhang TZ, Wendel JF, Guan XY, Chen XY. The miR319-Targeted GhTCP4 Promotes the Transition from Cell Elongation to WallThickening in Cotton Fiber. Molecular Plant. 2020, 6;13(7):1063-1077. Hay A, Barkoulas M, Tsiantis M. PINning down the connections:transcription factors and hormones in leaf morphogenesis. Current Opinion inPlant Biology, 2004, 7(5): 575-581. Lagos-Quintana M, Rauhut R, Lendeckel W. Identification of novelgenes coding for small expressed RNAs. Science, 2001, 294(5543):853-858. Lau NC, Lim LP, Weinstein EG. An abundant class of tiny RNAs withprobable regulatory roles in Caenorhabditis elegans. Science, 2001,294(5543):858-862. Lee RC, Ambros V. An extensive class of small RNAs in Caenorhabditiselegans. Science, 2001, 294(5543):862-864. Luo YC, Zhou H, Li Y, Chen JY, Yang JH, Chen YQ, Qu LH. Riceembryogenic calli express a unique set of microRNAs, suggesting regulatoryroles of microRNAs in plant post-embryogenic development. FEBS Letter, 2006,580(21): 5111-5116. Maddonni GA, Otegui ME, CiriloAG. Plant populationdensity, row spacing and hybrid effects on maize canopy architecture andlight attenuation. Field Crops Research, 2012, 71: 183-193. Mansfield BD, Mumm RH. Survey of plant density tolerance in U.S.maize germplasm. Crop Science, 2014, 54:157-173. Palatnik JF, Allen E, Wu XL, Schommer C, Schwab R,Carrington JC,Weigel D. Control of leaf morphogenesis by microRNAs. Nature, 2003, 425(6955): 257-263. Palatnik JF, Wollmann H, Schommer C, Schwab R, Boisbouvier J,Rodriguez R, Warthmann N, Allen E, Dezulian T, Huson D, Carrington JC, WeigelD. Sequence and expression differences underlie functional specializetion ofArabidopsis microRNAs miR159 and miR319. Development Cell, 2007, 13(1):115-125. Park W, Li J, Song R, Messing J, Chen XCARPEL FACTORY, a Dicerhomolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsisthaliana. Current Biology, 2002,12:1484-1495. Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP. MicroRNAsin plants. Genes & Development, 2002, 16:1616-1626 Schommer C, Palatnik JF, Aggarwal P, Chételat A, Cubas P, Farmer EE,Nath U, Weigel D. Control of jasmonate biosynthesis and senescence by miR319targets. PLoS Biology, 2008, 6(9): e230. Wang B, Lin Z, Li X, Zhao Y, Zhao B, Wu G, Ma X, Wang H, Xie Y, Li Q,Song G, Kong D,Zheng Z, Wei H, Shen R, Wu H, Chen X, Meng Z, Wang T, Li Y, LiX, Chen Y, Lai J, Hufford MB, Ross-Ibarra J, He H, Wang H. Genome-wideselection and genetic improvement during modern maize breeding. NatureGenetics, 2020,52(6):565-571. Yang C, Li D, Mao D, Liu X, Ji C, Li X, Zhao X. Overexpression ofmicroRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerancein rice (Oryza sativa L.). Plant Cell Environment, 2013, 36:2207-2218. Zhang B, Pan X, Cobb GP, Anderson TA. Plant microRNA: A smallregulatory molecule with big impact. Development Biology, 2006, 289:3-16. Zhou M, Li D, Li Z, Hu Q, Yang C, Zhu L, Luo H. Constitutiveexpression of a miR319 gene alters plant development and enhances salt anddrought tolerance in transgenic creeping bent grass. Plant Physiology, 2013,161, 1375-1391。

Claims

1. Application of ZmMIR319A gene in regulating corn leaf angle, characterized in that: The nucleotide sequence of the ZmMIR319A gene is shown in SEQ ID NO.1, and the mature miRNA319 sequence encoded by it is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that Knocking out ZmMIR319A in maize resulted in a smaller leaf angle, while overexpressing ZmMIR319A caused an increase in the leaf angle.

3. A method for creating a corn leaflet angle mutant, characterized in that: CRISPR / Cas9 gene editing technology, RNA interference technology or other technologies are used to achieve knockout or knockdown of the ZmMIR319A gene described in claim 1, thereby obtaining a corn material with a reduced leaf angle.

4. A method for creating a large leaf angle mutant of corn, characterized in that: The expression of the corn ZmMIR319A gene according to claim 1 is improved by genetic modification, hybridization, backcrossing, selfing or asexual reproduction to obtain corn materials with increased leaf angles.

5. The method for creating a corn leaflet angle mutant according to claim 3, characterized in that: The CRISPR / Cas9 vector target designed for the maize ZmMIR319A gene using the CRISPR / Cas9 gene editing technology is MT1, and its DNA sequence is shown in SEQ ID NO.

3.

6. ZmMIR319A mutant genes ZmMIR319A-KO#1, ZmMIR319A-KO#2, and ZmMIR319A-KO#3 obtained based on the method of claim 5; characterized in that: Compared with the mature miR319 sequence described in claim 1, the mature sequence encoded by ZmMIR319A-KO#1 lacks 9 bp bases at positions 1-9; the mature sequence encoded by ZmMIR319A-KO#2 lacks 3 bp bases at positions 6-8; and the mature sequence encoded by ZmMIR319A-KO#3 lacks the "C" base at position 6.

Images