Digital PCR nucleic acid detection kit

Abstract

The invention discloses a digital PCR nucleic acid detection kit, and relates to the technical field of in vitro diagnosis detection, the kit comprises primers, probes, a reaction liquid and a quality control liquid, the kit is used for simultaneously detecting hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus, the reaction liquid comprises Master Mix and sterile enzyme-free water, and the quality control liquid is used for simultaneously detecting the hepatitis A virus, the hepatitis B virus, the hepatitis C virus, the hepatitis D virus and the hepatitis E virus. The quality control liquid comprises a negative quality control product and a positive quality control product. Through cooperation of sample collection, sample treatment, digital PCR reaction system preparation, digital PCR amplification and result analysis, nucleic acid detection based on the PCR technology shortens the window period by 50-70% through direct detection of virus genetic materials, becomes a key means for early diagnosis, and adopts the technical principle of digital PCR to realize rapid detection of the virus genetic materials. Compared with a traditional fluorescent quantitative PCR and immunological detection method and a qPCR method, the detection sensitivity is improved by 10-100 times, and absolute quantification can be achieved.

Description

Technical Field

[0001] The present invention relates to the field of in vitro diagnostic detection technology, and specifically to a digital PCR nucleic acid detection kit. Background Art

[0002] Although hepatitis A (HAV) and hepatitis E (HEV) viruses share the fecal-oral route of transmission, their clinical manifestations and epidemiological characteristics differ significantly. HAV infection often presents as an acute, self-limited illness with recovery within two months, but 10%-15% of patients experience symptoms that persist for more than six months. HEV genotypes 3 / 4 have unique zoonotic transmission characteristics, primarily through animals such as pigs, posing additional challenges to prevention and control.

[0003] Hepatitis B (HBV) and hepatitis C (HCV) viruses pose a major threat to global public health. Regarding disease progression, the chronicity rate of HBV infection in adults is 5-10% (as high as 90% in infants and young children), and 15-40% of untreated patients will develop cirrhosis. The chronicity rate of HCV is even higher, at 55-85%, with 15-30% of patients progressing to cirrhosis within 20-30 years. The main challenges facing current prevention and control include low diagnosis rates (only 10% of HBV and 21% of HCV infected individuals are aware of their condition) and inadequate treatment coverage (only 2% of HBV and 62% of HCV patients receive standardized treatment).

[0004] Hepatitis D virus (HDV), a defective RNA virus, must rely on the surface antigen of HBV (HBsAg) to replicate and spread. HDV / HBV co-infection significantly accelerates disease progression, increases the risk of cirrhosis by 2-3 times, increases the risk of liver decompensation by 70%, and increases the risk of liver cancer by more than 3 times that of HBV infection alone. Because HDV significantly worsens the prognosis of HBV infection and existing treatment options are limited, its prevention and control face severe challenges.

[0005] The detection of hepatitis A to E viruses (HAV-HEV) has important clinical and public health value. Although these five types of hepatitis viruses can all cause liver inflammation, there are significant differences in their transmission routes, disease progression and prognosis. Accurate pathogen detection is crucial for clinical diagnosis and treatment and epidemic prevention and control.

[0006] However, for the detection of hepatitis A to E viruses (HAV-HEV), although traditional serological antibody detection methods are widely used, there is a window period problem for antibody detection (HAV 2-4 weeks, HBV 4-10 weeks, HCV 6-12 weeks, HDV depends on HBV status, HEV 2-6 weeks). During this period, antibodies are not produced or are below the detection limit, resulting in the risk of missed diagnosis and the inability to distinguish between current infection and past infection. When fluorescent quantitative PCR (qPCR) technology is used, qPCR detection relies on a standard curve. By comparing the Ct values ​​of samples of unknown concentration with a series of standards, the relative amount of template DNA in the unknown reaction is determined, and absolute quantification cannot be performed. Although qPCR detection has high sensitivity, it still cannot detect samples with low microbial content. Summary of the Invention

[0007] The present invention provides a digital PCR nucleic acid detection kit, which solves the problems raised by the above background technology.

[0008] To achieve the above objectives, the present invention is implemented through the following technical solutions: a digital PCR nucleic acid detection kit, the detection kit comprising primers, probes, reaction solution and quality control solution, the detection kit being used for the simultaneous quantitative detection of five viruses: hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, and hepatitis E virus;

[0009] Forward primer sequence designed for hepatitis A virus nucleic acid sequence:

[0010] GTAGGCTACGGGTGAAACCT,

[0011] Reverse primer sequence:

[0012] CTGGATGAGAGCCAGTCCTC,

[0013] Probe sequence:

[0014] ATTO-CCGCCGCTGTTACCCTATCCAAGGC;

[0015] Forward primer sequence designed for hepatitis B virus nucleic acid sequence:

[0016] TCCTCCAATTTGTCCTGGCT,

[0017] Reverse primer sequence:

[0018] GTAGAGGACAAACGGGCAAC,

[0019] Probe sequence:

[0020] HEX-ACGCCGCAGACACATCCAGCG;

[0021] Forward primer sequence designed for hepatitis C virus nucleic acid sequence:

[0022] TATGAGTGTCGTGCAGCCT,

[0023] Reverse primer sequence:

[0024] TGAGCGGGTTGATCCAAGAA,

[0025] The probe sequence:

[0026] CY5-TGCCAGGACGACCGGGTCCT;

[0027] Forward primer sequence designed for hepatitis D virus nucleic acid sequence:

[0028] ACCGTCCCCTCGGTAATGGC,

[0029] Reverse primer sequence:

[0030] GTCCTTCTTTCCTCTTCGGGT,

[0031] The probe sequence:

[0032] CY5.5-TGGCTCTCCCTTAGCCATCCG;

[0033] Forward primer sequence designed for hepatitis E virus nucleic acid sequence:

[0034] TACTGCCGCTGAGTATGACC,

[0035] Reverse primer sequence:

[0036] TCAAGCGTGACCTTAGACCA,

[0037] The probe sequence:

[0038] ROX-AGCCCAGGCTGTCGCTCGCT;

[0039] Design the forward primer sequence of the internal standard for human genes:

[0040] AGATTTGGACCTGCGAGCG,

[0041] Reverse primer sequence:

[0042] GAGCGGCTGTCTCCACAAGT,

[0043] The probe sequence:

[0044] FAM-TTCTGACCTGAAGGCTCTGCGCG.

[0045] Preferably, the reaction solution includes Master Mix and sterile enzyme-free water.

[0046] Preferably, the quality control liquid includes a negative quality control product and a positive quality control product, the negative quality control product is sterile enzyme-free water, and the positive quality control product is a hepatitis A virus nucleic acid solution, a hepatitis B virus nucleic acid solution, a hepatitis C virus nucleic acid solution, a hepatitis D virus nucleic acid solution, or a hepatitis E virus nucleic acid solution of rated concentration.

[0047] A method for using a digital PCR nucleic acid detection kit includes the following steps: sample collection, sample processing, digital PCR reaction system preparation, digital PCR amplification, and result analysis.

[0048] Preferably, the sample collection specifically refers to: using a sterile syringe to draw 2 mL of venous blood from the subject, injecting it into a sterile collection tube, placing it at room temperature for no more than 4 hours, waiting for the sample to precipitate serum on its own, or directly placing it at room temperature and setting it to 1600 rpm for 5 minutes to separate the serum, and transferring it to a 1.5 mL sterile centrifuge tube for use.

[0049] Preferably, the sample processing specifically refers to: selecting a nucleic acid extraction and purification kit suitable for the serum sample type to extract and purify nucleic acids from the collected serum sample, the purified product being the template DNA for PCR amplification, the serum extraction sample volume being 200 μL, and the nucleic acid product being 100 μL.

[0050] Preferably, the preparation of the digital PCR reaction system specifically refers to: the total volume of the digital PCR system reaction system is 25 μL, which includes 10 uL of 2.0dPCR Mix, 0.5 μL of 12 forward and reverse primers each, 0.25 μL of 6 probes each, 5 μL of template DNA and 2.5 μL of sterile water.

[0051] Preferably, the digital PCR amplification specifically refers to: the first stage is reverse transcription at 55°C for 15 minutes and pre-denaturation at 95°C for 30 seconds, and the second stage is reverse transcription at 95°C for 10 seconds and pre-denaturation at 60°C for 30 seconds, for a total of 45 cycles.

[0052] Preferably, the digital result analysis specifically refers to: digital PCR detection concentration / 2=target virus concentration in the original sample.

[0053] The present invention has the following beneficial effects:

[0054] 1. This digital PCR nucleic acid detection kit, through the design of 12 forward and reverse primers and 6 probes, can achieve simultaneous quantitative detection of 5 hepatitis viruses. It can perform high-sensitivity and high-specificity detection of the levels of 5 hepatitis viruses in high-risk groups and potential patients, which is of great significance for population screening, clinical diagnosis, and treatment effect evaluation.

[0055] 2. This digital PCR nucleic acid detection kit, through the coordination of sample collection, sample processing, digital PCR reaction system preparation, digital PCR amplification and result analysis, is based on PCR technology. By directly detecting viral genetic material, the nucleic acid detection window period is shortened by 50-70%, becoming a key means of early diagnosis. It also adopts the technical principles of digital PCR and has higher sensitivity and accuracy than traditional fluorescent quantitative PCR, immunological detection methods and qPCR methods, and can achieve absolute quantitative detection. DETAILED DESCRIPTION

[0056] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work shall fall within the scope of protection of the present invention.

[0057] The present invention provides a technical solution: a digital PCR nucleic acid detection kit, the detection kit body includes primers and probes, reaction solution, and quality control solution. The detection kit body is used to detect hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, and hepatitis E virus. The reaction solution includes Master Mix and sterile enzyme-free water. The quality control solution includes negative quality control product and positive quality control product.

[0058] The negative control product is sterile enzyme-free water.

[0059] The positive quality control products are hepatitis A virus nucleic acid solution, hepatitis B virus nucleic acid solution, hepatitis C virus nucleic acid solution, hepatitis D virus nucleic acid solution, and hepatitis E virus nucleic acid solution.

[0060] The primers and probes are as follows:

[0061] 1) Designed for Hepatitis A Virus Nucleic Acid Sequences:

[0062] Forward primer sequence: GTAGGCTACGGGTGAAACCT,

[0063] Reverse primer sequence: CTGGATGAGAGCCAGTCCTC,

[0064] Probe sequence: ATTO-CCGCCGCTGTTACCCTATCCAAGGC;

[0065] 2) Designed for hepatitis B virus nucleic acid sequences:

[0066] Forward primer sequence: TCCTCCAATTTGTCCTGGCT,

[0067] Reverse primer sequence: GTAGAGGACAAACGGGCAAC,

[0068] Probe sequence: HEX-ACGCCGCAGACACATCCAGCG;

[0069] 3) Designed for hepatitis C virus nucleic acid sequences:

[0070] Forward primer sequence: TATGAGTGTCGTGCAGCCT,

[0071] Reverse primer sequence: TGAGCGGGTTGATCCAAGAA,

[0072] Probe sequence: CY5-TGCCAGGACGACCGGGTCCT;

[0073] 4) Designed for hepatitis D virus nucleic acid sequences:

[0074] Forward primer sequence: ACCGTCCCCTCGGTAATGGC,

[0075] Reverse primer sequence: GTCCTTCTTTCCTCTTCGGGT,

[0076] Probe sequence: CY5.5-TGGCTCTCCCTTAGCCATCCG;

[0077] 5) Designed for hepatitis E virus nucleic acid sequences:

[0078] Forward primer sequence: TACTGCCGCTGAGTATGACC,

[0079] Reverse primer sequence: TCAAGCGTGACCTTAGACCA,

[0080] Probe sequence: ROX-AGCCCAGGCTGTCGCTCGCT;

[0081] 6) Internal standards designed for human genes:

[0082] Forward primer sequence: AGATTTGGACCTGCGAGCG,

[0083] Reverse primer sequence: GAGCGGCTGTCTCCACAAGT,

[0084] Probe sequence: FAM-TTCTGACCTGAAGGCTCTGCGCG.

[0085] A method for using a digital PCR nucleic acid detection kit, comprising sample collection, sample processing, digital PCR reaction system preparation, digital PCR amplification and result analysis.

[0086] 1. Sample collection: serum sample collection, 2mL of venous blood of the testee is extracted by a sterile syringe, injected into a sterile collection tube, placed in a room temperature environment and not more than 4 hours, and the serum is separated from the sample itself, or directly placed in a room temperature and set to 1600rpm centrifugation for 5 minutes to separate the serum, and transferred to a 1.5mL sterilized centrifuge tube for standby.

[0087] 2. Sample processing: the collected serum sample is subjected to nucleic acid extraction and purification by selecting a nucleic acid extraction and purification kit suitable for serum sample type, and the purified product is the template DNA for PCR amplification, the serum extraction sample amount is 200uL, and the nucleic acid product is 100uL.

[0088] 3. Digital PCR reaction system preparation: the total volume of the digital PCR system reaction system is 25uL, including 10uL of 2.0dPCR Mix, 0.5uL of 12 kinds of forward and reverse primers, 0.25uL of 6 kinds of probes, 5uL of template DNA and 2.5uL of sterile water.

[0089] 4. Digital PCR amplification: the first stage is 55℃ reverse transcription for 15min, and 95℃ pre-denaturation for 30s, the second stage is 95℃ reverse transcription for 10s, and 60℃ pre-denaturation for 30s, a total of 45 cycles.

[0090] 5. Digital result analysis: the digital PCR detection concentration / 2 is the target virus concentration in the original sample.

[0091] The kit and the detection method based on digital PCR provided by the application can simultaneously detect hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus, and can detect the content of the five hepatitis viruses in the high-risk population and potential patients with high sensitivity and high specificity, which has important significance for clinical diagnosis and treatment effect evaluation.

[0092] Example one: sensitivity verification

[0093] (1) Sample DNA dilution

[0094] The template nucleic acids of hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus are all diluted to 1.0*10 6Copies / mL, and then mixed in a ratio of 1:1:1:1:1. The mixed samples were diluted 10, 100, 1000, 2000, and 5000 times in sequence. The samples in this step were used for kit sensitivity verification.

[0095] (2) System preparation

[0096] The total reaction volume of the digital PCR system is 25 μL, including 10 μL of 2.0dPCR Mix, 0.5 μL each of 12 forward and reverse primers, 0.25 μL each of 6 probes, 5 μL of template DNA, and 2.5 μL of sterile water, diluted to 25 μL. Specifically, the primer and probe sequences are shown in Table 1 below:

[0097] Table 1

[0098]

[0099] (3) Digital PCR amplification procedure

[0100] Reverse transcription was performed at 55°C for 15 min, followed by pre-denaturation at 95°C for 30 s, reverse transcription at 95°C for 10 s, and pre-denaturation at 60°C for 30 s, for a total of 45 cycles.

[0101] (4) The results are shown in Table 2:

[0102] Table 2

[0103]

[0104] The results in Table 2 show that digital PCR can simultaneously detect and quantify nucleic acid fragments of hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, and hepatitis E virus. Quantification is possible when the sample concentration is 40 copies / mL, indicating that the kit has high sensitivity.

[0105] Example 2: Specificity Verification

[0106] Digital PCR was performed on negative quality control products, positive quality control products, and nucleic acid samples extracted from viruses other than those specified in the five test kits, using the novel coronavirus, respiratory syncytial virus, Epstein-Barr virus, influenza A virus, and influenza B virus as examples. The results are shown in Table 3:

[0107] Table 3

[0108]

[0109] The results in Table 3 show that the kit can only quantitatively detect hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus, and cannot detect novel coronavirus, respiratory syncytial virus, EB virus, influenza A virus and influenza B virus, indicating that the kit has good specificity and no cross-reaction with novel coronavirus, respiratory syncytial virus, EB virus, influenza A virus and influenza B virus.

[0110] Example Three: Repetitive Verification

[0111] Five hepatitis virus samples were tested 10 times at the same time, and the coefficient of variation CV was calculated.

[0112] The results are shown in Table 4:

[0113] Table 4

[0114]

[0115] The results in Table 4 show that the detection results of the kit have a Cv less than 3%.

[0116] Although embodiments of the present application have been shown and described, it is to be understood that various modifications, substitutions, replacements and changes can be made to these embodiments without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

Claims

1. A digital PCR nucleic acid detection kit, characterized by: The detection kit includes primers, probes, reaction solution and quality control solution, and is used for simultaneous quantitative detection of five viruses: hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus and hepatitis E virus; Designed for hepatitis A virus nucleic acid sequence: Forward primer sequence: GTAGGCTACGGGTGAAACCT, Reverse primer sequence: CTGGATGAGAGCCAGTCCTC, Probe sequence: ATTO-CCGCCGCTGTTACCCTATCCAAGGC; Designed for hepatitis B virus nucleic acid sequence: Forward primer sequence: TCCTCCAATTTGTCCTGGCT, Reverse primer sequence: GTAGAGGACAAACGGGCAAC, Probe sequence: HEX-ACGCCGCAGACACATCCAGCG; Designed for hepatitis C virus nucleic acid sequences: Forward primer sequence: TATGAGTGTCGTGCAGCCT, Reverse primer sequence: TGAGCGGGTTGATCCAAGAA, The probe sequence: CY5-TGCCAGGACGACCGGGTCCT; Designed for hepatitis D virus nucleic acid sequence: Forward primer sequence: ACCGTCCCCTCGGTAATGGC, Reverse primer sequence: GTCCTTCTTTCCTCTTCGGGT, The probe sequence: CY5.5-TGGCTCTCCCTTAGCCATCCG; Designed for hepatitis E virus nucleic acid sequence: Forward primer sequence: TACTGCCGCTGAGTATGACC, Reverse primer sequence: TCAAGCGTGACCTTAGACCA, The probe sequence: ROX-AGCCCAGGCTGTCGCTCGCT; Internal standards designed for human genes: Forward primer sequence: AGATTTGGACCTGCGAGCG, Reverse primer sequence: GAGCGGCTGTCTCCACAAGT, The probe sequence: FAM-TTCTGACCTGAAGGCTCTGCGCG.

2. A digital PCR nucleic acid detection kit according to claim 1, characterized in that: The reaction solution includes Master Mix and sterile enzyme-free water.

3. A digital PCR nucleic acid detection kit according to claim 1, characterized in that: The quality control liquid includes a negative quality control product and a positive quality control product. The negative quality control product is sterile enzyme-free water, and the positive quality control product is a hepatitis A virus nucleic acid solution, a hepatitis B virus nucleic acid solution, a hepatitis C virus nucleic acid solution, a hepatitis D virus nucleic acid solution, and a hepatitis E virus nucleic acid solution of rated concentration.

4. A method for using a digital PCR nucleic acid detection kit, characterized in that: The use of the digital PCR nucleic acid detection kit as described in claim 2 includes the following steps: sample collection, sample processing, digital PCR reaction system preparation, digital PCR amplification and result analysis.

5. The method for using a digital PCR nucleic acid detection kit according to claim 4, characterized in that: The sample collection specifically refers to: using a sterile syringe to draw 2 mL of the subject's venous blood, injecting it into a sterile collection tube, placing it at room temperature for no more than 4 hours, waiting for the sample to precipitate serum on its own, or directly placing it at room temperature and setting it to 1600 rpm for 5 minutes to separate the serum, and transferring it to a 1.5 mL sterile centrifuge tube for use.

6. The method for using a digital PCR nucleic acid detection kit according to claim 4, characterized in that: The sample processing specifically refers to: selecting a nucleic acid extraction and purification kit suitable for the serum sample type to extract and purify nucleic acids from the collected serum sample. The purified product is the template DNA for PCR amplification. The serum extraction sample volume is 200 μL and the nucleic acid product is 100 μL.

7. The method for using a digital PCR nucleic acid detection kit according to claim 4, characterized in that: The digital PCR reaction system preparation specifically refers to: the total volume of the digital PCR system reaction system is 25 μL, which includes 10 uL of 2.0dPCR Mix, 0.5 μL of 12 forward and reverse primers, 0.25 μL of 6 probes, 5 μL of template DNA and 2.5 μL of sterile water.

8. The method for using a digital PCR nucleic acid detection kit according to claim 4, characterized in that: The digital PCR amplification specifically refers to: the first stage is reverse transcription at 55°C for 15 minutes and pre-denaturation at 95°C for 30 seconds, and the second stage is reverse transcription at 95°C for 10 seconds and pre-denaturation at 60°C for 30 seconds, for a total of 45 cycles.

9. The method for using a digital PCR nucleic acid detection kit according to claim 4, characterized in that: The digital result analysis specifically refers to: Digital PCR detection concentration / 2=target virus concentration in the original sample.

Images