Specific primer for identifying vibrio parahaemolyticus KUT1 type strain and fluorescent PCR (polymerase chain reaction) detection method
By designing specific primers and probes combined with fluorescent PCR methods, the problem of rapid identification of Vibrio parahaemolyticus KUT1 strains was solved, efficient and specific detection was achieved, and epidemiological investigations and traceability were supported.
Patent Information
- Application Number
- CN202510929469.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-07
- Publication Date
- 2025-10-17
AI Technical Summary
Existing technologies make it difficult to quickly and effectively identify and differentiate Vibrio parahaemolyticus KUT1 strains, especially the lack of efficient molecular identification technology in epidemiological surveys and traceability.
Specific primers KUT1-F and KUT1-R, as well as the probe KUT1-P used in conjunction with them, were designed and combined with the fluorescent PCR method to achieve efficient and specific detection of KUT1 type strains.
It achieves rapid identification of KUT1 type strains, expands the serotyping system, provides an accurate tool for epidemiological investigations, meets the sensitivity and specificity requirements of detection, reduces contamination risks, and saves detection time.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular diagnosis, in particular to a specific primer and a fluorescent PCR detection method for identifying Vibrio parahaemolyticus KUT1 strain. Background Art
[0002] Vibrio parahaemolyticus ( Vibrio parahaemolyticus V. parahaemolyticus (V. parahaemolyticus) is a Gram-negative, halophilic bacterium widely found in marine and estuarine environments. It is a major foodborne pathogen, primarily causing gastroenteritis in humans. Serotyping, as an important typing method, is crucial in epidemiological investigations of V. parahaemolyticus. Identification of the strain's O antigen (lipopolysaccharide) and K antigen (capsular polysaccharide) allows for differentiation of different serotypes, thereby tracing the source and transmission of the disease and identifying high-risk strains. To date, 13 O antigens and 71 K antigens have been identified. Certain serotypes, such as O3:K6 and its variants, have caused large-scale outbreaks worldwide.
[0003] K typing is an important part of the serological typing of Vibrio parahaemolyticus. However, some strains cannot be K typed due to the lack of specific K antigen or loss of K antigen expression, and are called K type untypeable (KUT) strains. The prevalence of KUT strains in different regions varies significantly. In the Black Sea region of Turkey, O4:KUT, O2:KUT and O3:KUT have all been found, and there are trh -The dominant clones of positive strains. In Bangladesh, O1:KUT and O3:KUT are among the predominant serotypes. In India, OUT:KUT and O1:KUT are common serotypes among strains isolated from oysters. In Thailand, studies of clinical samples and oyster isolates found that O3:K6 was the most common serotype, followed by OUT:KUT and O4:K9. These findings highlight the importance of continued monitoring of KUT strains to maintain abreast of epidemic trends and potential risks.
[0004] The pathogenicity of Vibrio parahaemolyticus is primarily related to the toxins it produces, such as thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH). Studies have shown that some KUT strains carry genes encoding TDH and TRH, increasing their pathogenicity. Therefore, KUT strains remain important in clinical infection and epidemiological investigations.
[0005] Strains identified as KUT by serum agglutination are currently distinguished and analyzed for their genetic relationship by molecular typing methods such as pulsed-field gel electrophoresis (PFGE), multilocus variable number of tandem repeat analysis (MLVA), etc. Whole genome sequence and multilocus sequence typing (MLST) data are also often used to construct phylogenetic trees, revealing the evolutionary status of KUT strains in the entire Vibrio parahaemolyticus population and analyzing their genetic relationship with other strains. In the process of diarrhea pathogen monitoring, we found a group of KUT strains from diarrhea samples. Through whole genome sequence analysis, a maximum likelihood tree was constructed based on SNPs in the non-repetitive and non-recombinant regions of the whole genome, and it was found that these strains formed several branches that were independent of each other and had a relatively long genetic distance. The two main branches were named KUT1 and KUT2. However, given the lack of effective K antiserum, rapid identification of KUT strains remains difficult, and the development of an efficient molecular identification technique is particularly critical. SUMMARY
[0006] The purpose of the present application is to provide specific primers and fluorescent PCR detection methods for identifying Vibrio parahaemolyticus KUT1 type strains.
[0007] To achieve the purpose of the present application, in a first aspect, the present application provides specific primers for identifying Vibrio parahaemolyticus KUT1 type strains, comprising: primers KUT1-F and KUT1-R for identifying Vibrio parahaemolyticus KUT1 type strains; The primer sequences are as follows (5'-3'): KUT1-F: ATGATTCGGTCAACGTTTTGAAG; KUT1-R: TCTTTTGTAATCCTTGACTCATTAACC.
[0008] In a second aspect, the present application provides a probe for use with the primers, wherein the probe for use with the primers KUT1-F and KUT1-R is KUT1-P. The probe sequence is as follows (5'-3'): F-CCAATCGAGACCATAACTCCGGCAA-Q.
[0009] Wherein F is a fluorescent group and Q is a quenching group; Preferably, F is FAM and Q is BHQ1.
[0010] In a third aspect, the present application provides a detection reagent or kit containing the primers and / or the probe.
[0011] In a fourth aspect, the present application provides a fluorescent PCR detection method for Vibrio parahaemolyticus KUT1 type strain (for non-disease diagnosis purposes), which utilizes the primers and probes, or utilizes a detection reagent or kit containing the primers and probes to perform fluorescent PCR detection on a sample to be tested.
[0012] Preferably, the PCR reaction system is: 2x PCR Premix 10 μL, primer mixture 0.4 μL, probe 0.4 μL, pure water 7.2 μL, and DNA template 2 μL.
[0013] In the primer mixture, the concentration of primers KUT1-F and KUT1-R is 10 mM. The concentration of the probe is 10 mM.
[0014] The PCR reaction conditions are: 90-95 ℃ for 30-120 s; 90-95 ℃ for 5-30 s, 56-60 ℃ for 10-60 s, 20-40 cycles; and the fluorescence signal is collected at the end of each cycle.
[0015] Preferably, the PCR reaction conditions are: 95 ℃ for 1 min; 95 ℃ for 10 s, 60 ℃ for 30 s, 40 cycles; and the fluorescence signal is collected at 60 ℃.
[0016] Further, according to the amplification results, if Cq≤35, it is determined to be positive, that is, the sample to be tested contains Vibrio parahaemolyticus KUT1 type strain; and if Cq>35, it is determined to be negative, that is, the sample to be tested does not contain Vibrio parahaemolyticus KUT1 type strain.
[0017] Through the above technical solutions, the present application has at least the following advantages and beneficial effects: The present application can quickly identify the main Vibrio parahaemolyticus KUT type prevalent among diarrhea patients in China, expand the serotyping system of Vibrio parahaemolyticus, and provide more accurate tools for epidemiological investigation and tracing. The technology used in the present application has reached the level of fluorescent PCR technology in terms of amplification efficiency, sensitivity and specificity, and can fully meet the actual use detection requirements.
[0018] The present application focuses on KUT type which has important public health significance, and provides technical support for diarrhea disease monitoring and tracing. The KUT1 type strains used in the present method are all isolated from diarrhea patients in China and widely distributed in China. The present application is applied to diarrhea pathogen detection and tracing investigation, and can provide key basis for early diagnosis, early warning and outbreak response, and is helpful to control the spread of the corresponding infection and protect the health and safety of the public.
[0019] The present invention uses a fluorescent PCR method (TaqMan probe method) to achieve efficient and specific detection of KUT1 type strains, and can determine whether the strain is the main KUT type prevalent in my country within 1 hour. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is a phylogenetic tree of various serotypes of Vibrio parahaemolyticus constructed based on core genome SNPs in the present invention.
[0021] Figure 2 The amplification curve and standard curve of the KUT1 type positive reference strain ICDC-VP1716 genomic nucleic acid in the preferred embodiment of the present invention are shown in FIG. 1 , wherein the slope is -3.3876, and the amplification efficiency is E=10 -1 / slope -1:97.33%.
[0022] Figure 3 The amplification curve and standard curve of the KUT2 positive reference strain ICDC-VP1272 genomic nucleic acid in the preferred embodiment of the present invention are shown in FIG. 1 , wherein the slope is -3.3028, and the amplification efficiency is E=10 -1 / slope -1:100.80%. DETAILED DESCRIPTION
[0023] Currently, molecular typing and phylogenetic tree construction ( Figure 1 ), can, to a certain extent, identify and analyze the genetic relationships of KUT strains, thereby achieving higher-resolution detection. However, these methods are generally cumbersome and require high professional skills and experimental conditions.
[0024] Figure 1 This is a phylogenetic tree of multiple serotypes of Vibrio parahaemolyticus constructed based on core genome SNPs. Different serogroups of Vibrio parahaemolyticus form tightly clustered clusters. The O antigen of O4:KUT1 and O4:KUT2 strains is O4, but the K antigen does not agglutinate with any current K diagnostic serum. Although O4:KUT1 and O4:KUT2 are strains that cannot be identified by K antigen, Figure 1 From a different perspective, they belong to completely different genetic branches. Therefore, it is necessary to distinguish these two branches to serve the purpose of tracing the source and controlling the disease.
[0025] Compared with fluorescent PCR, conventional PCR has lower sensitivity, and its amplified products need to be detected by electrophoresis. This process is cumbersome and can easily cause the amplified products to contaminate the detection environment.
[0026] Fluorescence PCR is one of the most commonly used nucleic acid detection methods, offering numerous advantages: high sensitivity, capable of detecting extremely low concentrations of nucleic acids; excellent specificity, allowing for precise identification of target sequences; ease of operation, saving time; a closed system that minimizes product diffusion and reduces the risk of contamination; and intuitive results, presented as curves or numerical values, for rapid interpretation. These advantages have led to its widespread application in various fields. The present invention applies fluorescence PCR to the detection of the major KUT-type-specific gene of Vibrio parahaemolyticus, enabling rapid identification of relevant KUT strains.
[0027] The present invention adopts the following technical solutions: The present invention provides a fluorescent PCR method for detecting KUT-type Vibrio parahaemolyticus. Through whole genome sequence analysis, we found that the KUT-type Vibrio parahaemolyticus prevalent in diarrhea patients in many provinces of my country is mainly KUT1 and KUT2. By conducting in-depth analysis of the K antigen gene cluster sequence of the strain, we screened out specific genes that are conserved in KUT-type strains and have significant differences from other K-type strains. wzy (The target sequence for detecting KUT1 strains is located at NCBI No. MT898055.1 ( Vibrio parahaemolyticus strain VP410 capsule biosythesis gene cluster, complete sequence) from 16451 to 17770 bp; the target sequence for detecting KUT2 strains is located at NCBI accession number MT898406.1 ( Vibrio parahaemolyticus strain VP412 capsule biosythesis gene cluster, complete sequence) from 14957 to 16459 bp. Based on this, primers (KUT1-F / R, KUT2-F / R) and probes (KUT1-P, KUT2-P) capable of identifying KUT types were designed, thereby achieving efficient and specific detection of KUT1 and KUT2 strains by fluorescent PCR.
[0028] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0029] Example 1 Development of specific primers for identifying Vibrio parahaemolyticus KUT1 and KUT2 strains (1) Primer and probe design We based on KUT1 and KUT2 strains wzyThe gene sequence was designed with four groups of primers and probes (Table 1 and Table 2), respectively. The first and second groups of probes were labeled with a Minor Groove Binder (MGB) at the 3' end, and the third and fourth groups of probes were labeled with a quenching group BHQ1 at the 3' end. The amplification effect of the four groups of primers and probes was preliminarily verified by using a series of dilutions of nucleic acids of a positive strain as a template. The results showed that the amplification efficiency of the two groups containing MGB-labeled probes was 75% to 90%, and even if the annealing temperature was reduced to 56°C, the amplification efficiency could not reach more than 90%. The amplification efficiency of the two groups containing BHQ1-labeled probes was 90% to 110%, but the fluorescence signal intensity at the plateau was different. According to the standards of high fluorescence signal intensity, typical "S" shape of amplification curve, and amplification efficiency of 90% to 110%, the third group of primers and probes for KUT1 (Table 3) and the fourth group of primers and probes for KUT2 (Table 4) were finally selected for strain detection.
[0030] Table 1 Sequences of the four groups of primers and probes for KUT1 are as follows:
[0031] Table 2 Sequences of the four groups of primers and probes for KUT2 are as follows:
[0032] Table 3 Selected primers and probes for KUT1
[0033] The KUT1-F / R amplification product was 102 bp in length.
[0034] Table 4 Selected primers and probes for KUT2
[0035] The KUT2-F / R amplification product was 134 bp in length.
[0036] (2) Reaction system (Table 5) Table 5 Reaction system
[0037] (3) Amplification conditions 95 ℃ 1 min; 95 ℃ 10 s, 60 ℃ 30 s, cycle 40 times, and detect fluorescence at the annealing stage (60 ℃).
[0038] (4) Result interpretation Cq≤35 was determined as a positive test result.
[0039] Example 2 Investigation of amplification efficiency Genomic nucleic acids were extracted from fresh culture of positive reference strains ICDC-VP1716 (KUT1 type, National Pathogen Microorganism Resource Library No. NPRC(S)01.0025) and ICDC-VP1272 (KUT2 type, National Pathogen Microorganism Resource Library No. NPRC(S)01.0019) on ordinary nutrient agar, and 10-fold serial dilutions were made with deionized water. 10 -3 dilutions were subjected to digital PCR analysis, 3 repeated holes were set for each reaction, and the average value of 3 holes was taken to calculate the copy number concentration of the target gene fragment. The results showed that the target gene fragment concentration of ICDC-VP1272 in 10 -3 dilutions was 7.71 x 10 4 copies / µL, and the target gene fragment concentration of ICDC-VP1716 was 2.35 x 10 4 copies / µL.
[0040] 10 -1 ~10 -6 fold dilutions were used as templates, 3 holes were repeated for each dilution, and fluorescence PCR detection was performed respectively. The standard curve was established with the logarithmic value of the copy number of the target gene fragment in each reaction as the abscissa and the threshold cycle (Ct value) of fluorescence PCR as the ordinate, and the amplification efficiency of the detection system was calculated according to the slope of the straight line. The results showed that the amplification efficiencies of KUT1 and KUT2 detection systems were 97.33% and 100.80% respectively, which met the general requirements. The KUT1 and KUT2 amplification curves and standard curves are shown in Figure 2 and Figure 3 respectively.
[0041] Example 3 Detection limit investigation The 10 -6 fold dilutions of the genomic nucleic acids of the positive reference strains were subjected to 2-fold serial dilutions. 6 dilution solutions of 1:1~1:32 were used as templates for fluorescence PCR detection, 8 holes were repeated for each dilution, and the lowest concentration of 8 detections all positive was the lowest detection limit (LOD) of the reaction. As shown in Tables 6 and 7, the LOD of this method for KUT1 type strain was 11.78 copies / reaction, and the LOD for KUT2 type strain was 9.63 copies / reaction.
[0042] Table 6 The lowest detection limit (LOD) for the genomic nucleic acid detection of positive reference strain ICDC-VP1716
[0043] Ct: threshold cycle of fluorescence PCR reaction.
[0044] Table 7 The lowest detection limit (LOD) for the genomic nucleic acid detection of positive reference strain ICDC-VP1272
[0045] Ct: cycle threshold of the fluorescence PCR reaction.
[0046] Example 4 Specificity investigation To verify the specificity of the method, a total of 151 strains were selected for the experiment. These strains include: 10 strains of Vibrio parahaemolyticus identified as KUT1 type based on genomic sequence, 9 strains of Vibrio parahaemolyticus identified as KUT2 type, 99 strains of Vibrio parahaemolyticus of other known serotypes, and 12 strains of other pathogenic Vibrio (6 strains of Vibrio cholerae, 2 strains of Vibrio fluvialis and Vibrio vulnificus, 1 strain of Vibrio mimicus and Vibrio alginolyticus). In addition, 6 strains of Salmonella (2 strains of Salmonella typhi, Salmonella typhimurium and Salmonella enteritidis, respectively), 5 strains of diarrheal E. coli (1 strain of Enterohemorrhagic E. coli, Enterotoxigenic E. coli, Enteroinvasive E. coli, Enteropathogenic E. coli and Enteropathogenic E. coli, respectively), 2 strains of Shigella, Plesiomonas shigelloides, Clostridium perfringens, respectively, and 1 strain of Citrobacter freundii, Listeria monocytogenes, Staphylococcus aureus, Edwardsiella tarda, respectively. The results showed that only Vibrio parahaemolyticus identified as KUT1 type or KUT2 type based on genomic sequence showed positive in the corresponding detection, and other strains showed negative. This method showed 100% specificity.
[0047] Although the present application has been described in detail with general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application claimed.
Claims
1. A specific primer for identifying Vibrio parahaemolyticus KUT1 strain, characterized in that: include: Primers KUT1-F and KUT1-R for identifying V. parahaemolyticus KUT1 strains; The primer sequences are as follows (5'-3'): KUT1-F:ATGATTCGGTCAACGTTTTGAAG; KUT1-R:TCTTTTGTAATCCTTGACTCATTAACC.
2. A probe for use with the primer according to claim 1, characterized in that: The probe used in conjunction with the primers KUT1-F and KUT1-R is KUT1-P; The probe sequences were as follows (5′-3′): F-CCAATCGAGACCATAACTCCGGCAA-Q; Among them, F is the fluorescent group and Q is the quenching group.
3. The probe according to claim 2, characterized in that F is FAM and Q is BHQ1.
4. A detection reagent or kit comprising the primer according to claim 1 and / or the probe according to claim 2 or 3.
5. A fluorescent PCR detection method for Vibrio parahaemolyticus KUT1 strain, characterized in that: Performing fluorescent PCR detection on a sample to be tested using the primers according to claim 1 and the probes according to claim 2 or 3, or using a detection reagent or kit containing the primers and probes; The method is not for disease diagnosis purposes.
6. The method according to claim 5, characterized in that The PCR reaction system was as follows: 2× PCR Premix 10 μL, primer mixture 0.4 μL, probe 0.4 μL, purified water 7.2 μL, and DNA template 2 μL; In the primer mixture, the concentrations of primers KUT1-F and KUT1-R were both 10 mM; The concentration of the probe was 10 mM.
7. The method according to claim 6, characterized in that The PCR reaction conditions were as follows: 90–95°C for 30–120 s; 90–95°C for 5–30 s, 56–60°C for 10–60 s, for 20–40 cycles; and fluorescence signals were collected at the end of each cycle.
8. The method according to any one of claims 4 to 7, characterized in that: The amplification results were judged as follows: if Cq≤35, it was judged as positive, that is, the sample to be tested contained Vibrio parahaemolyticus KUT1 strain; if Cq>35, it was judged as negative, that is, the sample to be tested did not contain Vibrio parahaemolyticus KUT1 strain.