Target and primer for bovine rotavirus RT-RAA-CRISPR / Cas12a detection method, and crRNA composition

Abstract

The invention provides a target, a primer and a crRNA composition for a bovine rotavirus RT-RAA-CRISPR / Cas12a detection method, and belongs to the technical field of nucleic acid visual detection. A primer and a cRNA composition are designed on the basis of a conserved sequence in BRV VP6, an RT-RAA technology is combined with a CRISPR / Cas12a system, precise variable temperature equipment is not needed, effective amplification of a BRV target gene can be obtained only under the constant temperature condition, and the problems that an existing BRV detection method needs to be improved in sensitivity, the requirements for the operation environment and precise equipment are high, and the detection cost is low are solved. And rapid detection of the BRV cannot be realized in an epidemic disease site or a basic laboratory.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of nucleic acid visualization detection, and particularly relates to a target and primers, a crRNA composition for a bovine rotavirus RT-RAA-CRISPR / Cas12a detection method. BACKGROUND

[0002] Bovine rotavirus (BRV) belongs to the rotavirus genus of the Reoviridae family, and is one of the key pathogens causing diarrhea in calves, which poses a great threat to the global livestock industry. In 1968, American scientist Mebus and his team first used electron microscopy to observe rotavirus particles from a newborn calf with diarrhea sample, and named the virus strain as NCDV strain (Nebraska Calf Diarrhea Virus), which marked the beginning of bovine rotavirus research. Since then, bovine rotavirus has been detected in calf diarrhea samples in many European and American countries such as the United Kingdom and Australia. According to the statistical data in 2022, the average infection rate of BRV in the mainland of China is as high as 46%, fully indicating that BRV is widely prevalent in the global range.

[0003] BRV has strong infectivity, mainly spreads through the fecal-oral route, and has strong resistance in the environment, which has certain tolerance to common disinfectants, making the prevention and control work face great challenges. The virus is particularly prevalent in newborn calves within 7 days of age, and the morbidity and mortality of infected calves are relatively high. The main clinical symptoms are watery diarrhea, dehydration, sunken eye sockets, and weakness of the limbs, and severe cases can have bloody stool and even shock death. Adult cattle infected with BRV are often asymptomatic carriers, although they do not get sick themselves, but they can continue to shed the virus, further exacerbating the spread of the virus. In addition, BRV not only infects cattle, but also can cross-species infect pigs, sheep, deer, dogs, birds and other animals, although the symptoms in these animals are relatively mild, but its cross-species transmission characteristics and cross-infection between humans and animals have attracted widespread attention in the field of public health. At the same time, BRV often co-infects with other pathogens such as bovine enterovirus and bovine coronavirus, which undoubtedly greatly increases the difficulty of clinical diagnosis and treatment, and causes significant economic losses to the livestock industry.

[0004] At present, there is no specific antiviral drug for bovine rotavirus in clinical practice, and the treatment mainly relies on supportive therapy to correct the dehydration and electrolyte imbalance of the sick animals. Although there are commercial vaccines on the market for preventing bovine rotavirus infection, these vaccines generally have the problem of insufficient cross-protection, and it is difficult to provide comprehensive and effective protection against multiple BRV strains. Therefore, there is an urgent and important research need in the early diagnosis of bovine rotavirus disease, precise pathogen detection, and efficient vaccine development, etc.

[0005] In the detection technology of BRV, the current main categories include pathogenic method, serological method, molecular biology method, etc. Among them, the virus isolation and culture method is recommended by the World Organization for Animal Health (WOAH) as the gold standard for detecting BRV infection. The advantage of this method is that it can obtain live viruses, which can be further applied to vaccine development and virulence research, and has high specificity. However, the virus isolation and culture method has many limitations, the detection process takes a long time, usually several days to several weeks; the cost is high, professional cell culture equipment and reagents are needed; the detection success rate is greatly affected by the quality of the sample, if the sample collection, preservation or transportation is not proper, it is easy to cause detection failure; in addition, there is a certain risk in the operation process, because it needs to handle live viruses, which may cause infection risk to the operator. Enzyme-linked immunosorbent assay (ELISA) and colloidal gold test strip detection method have the advantages of fast detection speed and low cost, which are suitable for basic units and large-scale screening work. However, these two methods also have obvious defects, the false negative rate is high, and it is easy to miss detection, and may cross react with other viruses, resulting in inaccurate detection results. Molecular biology methods, such as real-time fluorescent quantitative PCR (qPCR), RT-PCR, etc., have high sensitivity, high specificity, and good quantification. However, such methods have strong dependence on large-scale instruments and professional technicians, and require expensive PCR instruments and professional technicians skilled in operation, which has high detection cost and is difficult to conduct large-scale instant detection on site or at the basic level, and is not suitable for early rapid diagnosis of bovine rotavirus disease. Therefore, it is of great significance to develop a detection method with portability, sensitivity, rapidness, and efficiency for the detection of BRV pathogens, which is also a technical problem to be solved at present, and the present application is based on this background and developed. SUMMARY

[0006] The present application provides a kit and detection system for visual detection of bovine rotavirus based on RT-RAA-CRISPR / Cas12a system, which solves the technical problems of the existing BRV detection methods that the sensitivity needs to be improved, the demand for operating environment and precision equipment is high, and BRV rapid detection cannot be realized in the field or basic laboratory.

[0007] In one aspect, a primer and crRNA composition for detecting bovine rotavirus based on RT-RAA-CRISPR / Cas12a are provided, which are designed based on the conserved sequence of BRV A VP6 gene, and the conserved sequence of BRV A VP6 gene is shown as SEQ ID NO. 1.

[0008] Further, the nucleotide sequence of the primer FⅠ is shown as SEQ ID NO. 2, the nucleotide sequence of the primer RⅠ is shown as SEQ ID NO. 3, and the nucleotide sequence of the crRNA is shown as SEQ ID NO. 8.

[0009] In another aspect, the application provides a use of the primer probe combination in the preparation of a kit for detecting bovine rotavirus.

[0010] In another aspect, the application provides a kit for detecting bovine rotavirus based on RT-RAA-CRISPR / Cas12a, which comprises the primer and crRNA combination.

[0011] Further, the kit further comprises reagents for RPA amplification, Cas12a Buffer and Cas12a nuclease.

[0012] In another aspect, the application provides a use of the kit in the detection of bovine rotavirus.

[0013] In another aspect, the application provides a method for detecting bovine rotavirus based on RT-RAA-CRISPR / Cas12a, which comprises using the kit described above.

[0014] Further, the method comprises the following steps: S1: preparing an RT-RAA reaction system, wherein the system is 50 μL, and the system comprises 10 μM of 2 μL of forward primer FⅠ and reverse primer RⅠ, 25 μL of A Buffer, 2.5 μL of B Buffer, 5 μL of target to be detected, and 13.5 μL of RNase-Free ddH2O; S2: preparing a CRISPR / Cas12a reaction system, wherein the system is 25 μL, and the system comprises 5 μL of crRNA, 5 μL of Cas12a Buffer (10X), 5 μL of Cas12a nuclease, 2.5 μL of 10 μM ssDNA fluorescent reporter, and 7.5 μL of RNase-Free ddH2O; S3: inverting a 200 μL centrifuge tube containing the CRISPR / Cas12a reaction system into a 1.5 mL centrifuge tube containing the RT-RAA reaction; S4: centrifuging, and placing the CRISPR / Cas12a reaction system into the RT-RAA reaction tube, and continuing to incubate in a 37℃ constant temperature water bath for 20 min, and using a blue light instrument to visually detect the above reaction.

[0015] Further, the concentration of the Cas12a nuclease in S4 is 74.4 nM. Further, the concentration of the crRNA concentration in S4 is 200 nM.

[0016] Advantages (1) The detection method established by the present application can detect BRV with high specificity. The applicant analyzed and compared 20 BRV gene sequences in the early stage, screened and determined the conserved region of the VP6 gene as the target, and finally determined the nucleotide sequence located at the 1-450th position of the BRV VP6 base sequence (Genbank No: MN565848.1) as the final detection target, to ensure the specificity of the primer and probe combination. A universal primer and specific crRNA combination suitable for RT-RAA visual detection are designed for the target sequence of BRV VP6. The specific test verifies that the primer and probe combination provided by the present application does not have cross-reaction with other viruses (BPIV, BEFV, BEV, BCoV) that have similar clinical symptoms of bovine rotavirus infection. It can be seen that the detection kit provided by the present application has high specificity.

[0017] (2) The detection method established by the present application has high sensitivity, and the minimum detection limit is 8.9 copies / μL BRV-VP6 recombinant plasmid. The detection result is stable and reliable. Compared with the virus isolation culture method recommended by WOAH, the method established by the present application is not affected by the sensitivity of the virus to the culture conditions, the quality of the sample and the transportation conditions, etc. Under the condition that the detection time is only 40 min, low-abundance bovine rotavirus nucleic acid can be detected.

[0018] (3) The present application combines RT-RAA technology with CRISPR / Cas12a system, which does not require precise temperature changing equipment, but only needs to be under constant temperature conditions to obtain effective amplification of BRV target gene; through the crRNA in the detection system which specifically recognizes BRV, the detection of BRV is realized; the whole process is carried out in a fully enclosed centrifugal tube, which not only realizes the visualization of the results, but also avoids false positive results caused by aerosol, realizes the rapid visual identification and detection of epidemic diseases on the spot. Moreover, the detection method provided by the present application does not require professional instruments and equipment and experimental personnel, and the detection time is only 40 min, which can realize the rapid visual detection of BRV on the spot of epidemic diseases or in the primary laboratory. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is the screening result of 3 groups of crRNA sequences in CRISPR / Cas12; Figure 2 is the concentration optimization result of Cas12a nuclease in CRISPR / Cas12; Figure 3 is the concentration optimization result of crRNA in CRISPR / Cas12; Figure 4 The results of the sensitivity evaluation of the RT-RAA-CRISPR / Cas12a visual detection method for bovine rotavirus; Figure 5 The results of the specificity evaluation of the RT-RAA-CRISPR / Cas12a visual detection method for bovine rotavirus. DETAILED DESCRIPTION

[0020] In order to make the purpose, technical scheme and advantages of the present application more clear, the present application will be further described in detail below in combination with specific embodiments and the drawings of the specification. The embodiments described in the present application are not all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application. The experimental methods used in the following embodiments are conventional methods unless otherwise specified. The materials, reagents and instruments used are conventional materials, reagents and instruments in the art unless otherwise specified, and can be obtained by commercial channels by those skilled in the art.

[0021] The bovine rotavirus (BRV) recombinant plasmid dry powder used in the following embodiments, the double-stranded nucleic acid used for synthesizing crRNA and the RT-RAA primer were synthesized by Shanghai Shengong Biotechnology Co., Ltd.; the rapid plasmid extraction kit was purchased from Tiangen Biochemical Technology Co., Ltd.; the RT-RAA nucleic acid amplification reagent was purchased from Hangzhou Zhongce Biological Technology Co., Ltd.; and the viral RNA / DNA extraction kit was purchased from Baobioengineering (Dalian) Co., Ltd.

[0022] Example 1. A primer combination for visual detection of bovine rotavirus based on an RT-RAA-CRISPR / Cas12a system.

[0023] The present application uses software SnapGene to screen multiple higher-conservation gene sequence regions from 20 BRV VP6 strain gene sequences isolated in different countries, different regions and different times including existing mutant strains published on GeneBank database, and the reference strain detailed information is shown in Table 1. According to the sequence alignment results, the BRV A VP6 protein gene is selected as the detection target gene of the present application, the screened conserved region is analyzed and aligned with BPIV, BEFV, BEV and BCoV, and finally the 1-450th nucleotide sequence located in the BRV A VP6 (Genbank No: MN565848.1, 1-450bp) base sequence is determined as the final detection target (the nucleotide sequence of the target is shown as SEQ ID NO. 1).

[0024] Table 1. Specific information of BRV reference strains

[0025] SEQ ID NO.1: TTTCCCTTATTCAGCTTCATTCACGTTGAACAGATCGCAACCGGCTCATGATAACTTGATGGGTACGATGTGGCTCAATGCGGGATCAGAAATTCAGGTCGCTGGATTCGACTACTCATGTGCAATAAACGCGCCAGCTAATACGCAACAATTTGAGCATATTGTACAGCTTCGAAGGGTGTTGACTACAGCTACAATAACTCTTTTACCAGATGCAGAAAGATTTAGTTTTCCAAGAGTGATTAATTCAGCTGACGGAGCGACTACATGGTACTTCAATCCAGTGATTCTTAGACCAAATAACGTTGAAGTAGAGTTTCTACTAAACGGGCAGATAATAAATACTTACCAAGCAAGATTTGGAACGATCATAGCTAGAAATTTTGATACAATTAGATTGTCATTTCAGTTGATGAGACCACCAAATATGACACCAGCGGTAGCGGCGTT; According to the RT-RAA primer design principle, a variety of primer combinations (including: FⅠand RⅠcombination, FⅠand RⅡcombination, FⅡand RⅠcombination, FⅡand RⅡcombination, the sequences are shown in Table 2) were designed and synthesized in the previous work process, under different target concentrations (8.9×10 4 copies / μL, 8.9×10 3 copies / μL, 8.9×10 2 copies / μL, 8.9×10 1 copies / μL), respectively, each combination was subjected to RT-RAA reaction. The results were shown by agarose gel electrophoresis, the sensitivity and the presence or absence of mixed bands of different combinations were compared, and a pair of primers with high sensitivity and good amplification efficiency and the corresponding probe were screened out, the nucleotide sequence of the forward primer FⅠof the RT-RAA primer pair was shown as SEQ ID NO.2, the nucleotide sequence of the reverse primer RⅠwas shown as SEQ ID NO.3, and the single-stranded DNA probe (ssDNA) was shown as Table 2.

[0026] Table 2 BRV RT-RAA primer and probe

[0027] Example 2: A method for visual detection of bovine rotavirus by RT-RAA-CRISPR / Cas12a.

[0028] The method for visual detection of bovine rotavirus by RT-RAA-CRISPR / Cas12a is divided into two parts, including RT-RAA reaction and CRISPR / Cas12a reaction.

[0029] 1. Establishment of RT-RAA method.

[0030] (1) Construction of positive plasmid: The target sequence of BRV A VP6 gene (the nucleotide sequence of the target is shown as SEQ ID NO. 1) is cloned into pUC57 to obtain a plasmid. The plasmid is transformed into DH5a competent cells, and after 42°C water bath heat shock for 1 min, it is quickly transferred to ice bath for 3 min (note that the process should not shake the centrifuge tube to avoid damaging the competent cells), then 500 μL of sterile SOC is added, mixed gently, and placed horizontally on a 37°C 200 rpm shaker for 1 h. The competent cells after adding the plasmid are uniformly smeared on Amp + resistant LB medium, and after incubation in a 37°C incubator overnight, single colonies are picked and transferred to liquid medium for expansion culture. After overnight culture at 37°C, the BRV VP6 recombinant plasmid is extracted using a plasmid extraction kit.

[0031] (2) RT-RAA reaction: The extracted BRV VP6 recombinant plasmid is used as a template for RT-RAA-CRISPR / Cas12a visual detection, and an RT-RAA detection method is established using the RT-RAA nucleic acid amplification kit of Hangzhou Zongce Company and the primers (F I and R I) and probe ssDNA provided in Example 1. The RT-RAA reaction system is 50 μL, including: 10 μM of forward primer F I and reverse primer R I, each 2 μL, A Buffer 25 μL, B Buffer 2.5 μL, target to be detected 5 μL, RNase-Free ddH2O 13.5 μL. Mix the above reaction system, then take 45 μL into a reaction tube containing RPA powder (RPA powder in the RT-RAA nucleic acid amplification kit of Hangzhou Zongce Company), blow to dissolve completely, mix thoroughly, then centrifuge, and sequentially take 20 μL into a 1.5 ml centrifuge tube, and perform RT-RAA reaction in a 37°C constant temperature water bath for 20 min.

[0032] 2. Establishment of CRISPR / Cas12a method.

[0033] (1) Synthesis of crRNA: Based on the target sequence of BRV VP6 gene (the nucleotide sequence of the target is shown as SEQ ID NO. 1), according to the PAM site requirement of Cas12a system and the design principle of crRNA, three double-stranded DNAs containing T7 promoter sequence (SEQ ID NO. 6: GAAATTAATACGACTCACTATAGGG), Cas12a crRNA backbone sequence (SEQ ID NO. 7: TAATTTCTACTAAGTGTAGAT) and target sequence were designed and synthesized for specific recognition of BRV. The specific sequence information of crRNA is shown in Table 3. After PCR amplification of the above three double-stranded DNAs, crDNA was obtained. crDNA was incubated with T7 RNA polymerase at 37°C overnight by using HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, Beijing) to transcribe crRNA; the obtained crRNA was purified by using Monarch® RNA Cleanup Kit (NEB, Beijing), and its concentration was determined by Implen N60 ultraviolet-visible spectrophotometer.

[0034] Table 3 BRV crRNA nucleotide sequence

[0035] (2) CRISPR / Cas12a reaction: The reaction system was 25 μL, crRNA (2 μM) 5 μL, Cas12a Buffer (10X) 5 μL, Cas12a nuclease (74.4 nM) 5 μL, ssDNA fluorescent reporter (10 μM) 2.5 μL and RNase-Free ddH2O 7.5 μL were mixed by blowing, centrifuged after mixing thoroughly, added to the PCR tube, the cap was cut off and placed in the RT-RAA reaction centrifuge tube upside down, incubated at 37°C constant temperature water bath for 20 min, centrifuged, and the CRISPR / Cas12a reaction system was placed in the RT-RAA reaction tube, and incubated at 37°C constant temperature water bath for 20 min. Then, the visual detection results of the above reaction were judged by using blue light instrument. If green fluorescence is observed under the blue light instrument, it indicates that the sample contains bovine rotavirus; if no fluorescence is observed under the blue light instrument, it indicates that the sample does not contain bovine rotavirus. The BRV VP6 recombinant plasmid is used as a positive control.

[0036] Example 3. Reaction condition optimization experiment.

[0037] 1. Optimization of RT-RAA reaction temperature.

[0038] To further improve the sensitivity of the BRV RT-RAA-CRISPR / Cas12a detection method, the conditions of the RT-RAA amplification reaction were optimized; the positive plasmid with a concentration of 8.9 x 10 10 copies / μL was diluted 10 times in series to 8.9 x 10 3 copies / μL, 8.9 x 10 2 copies / μL, 8.9 x 10 1 copies / μL, 8.9 x 10 0 copies / μL, and 8.9 x 10 -1 copies / μL were used as templates for the BRV RT-RAA-CRISPR / Cas12a visual detection method. The reaction system was amplified at 37°C, 39°C, and 42°C for 20 minutes, respectively, according to the RT-RAA reaction steps described in Example 2 above, to screen for the optimal amplification temperature. After RT-RAA amplification, CRISPR / Cas12a reaction was performed, and the visual detection results of the above reaction were judged using a blue light instrument. The results showed that when the concentration of the positive plasmid template was ≥8.9 copies / μL, green fluorescence was observed under the blue light instrument, indicating that the detection result was positive for BRV. The fluorescence signal detected at 37°C was significantly better than that at 39°C and 42°C, indicating that 37°C was the optimal reaction temperature.

[0039] 2. Screening of optimal crRNA.

[0040] The optimal crRNA was screened in a 20 μL CRISPR / Cas12a reaction system containing the following components: crRNA (2 μM) 2 μL, Cas12a Buffer (10X) 2 μL, Cas12a nuclease (74.4 nM) 2 μL, ssDNA fluorescent reporter (10 μM) 1 μL, BRV recombinant plasmid 2 μL, and RNase-Free ddH2O 11 μL. Three crRNAs in Table 3 were added to the system, and three replicates were set for each crRNA. To ensure that the method only specifically recognizes BRV, BRV VP6 recombinant plasmid was used as a positive control, and ddH2O was used as a negative control. The reaction system was incubated at 37°C for 50 minutes in a fluorescence quantitative PCR instrument, and the fluorescence signal was collected every 2 minutes. By comparing the fluorescence reaction time and fluorescence signal intensity, the optimal crRNA in the CRISPR / Cas12a system was screened.

[0041] The results are shown in Table 4. Figure 1As shown in the figure, only crRNA1 with the nucleotide sequence shown as SEQ ID NO. 8 can produce a strong fluorescence signal in the CRISPR / Cas12a reaction system, therefore, crRNA1 is selected for detecting the bovine rotavirus CRISPR / Cas12a reaction system.

[0042] 3. Optimization of the concentration of Cas12a nuclease in the CRISPR / Cas12a reaction.

[0043] To determine the optimal concentration of Cas12a nuclease, the concentrations of the nuclease were set to 18.6 nM, 37.2 nM, 74.4 nM, 148.8 nM and 297.5 nM, respectively, and a negative control group was set up with RNase-Free ddH2O instead of the target, a total of six groups were verified. The results are shown in Figure 2 As shown in the figure, with the increase of the concentration of Cas12a nuclease, the Cas12a transcleavage activity gradually increased, but the negative background value also increased. Therefore, the Cas12a nuclease with a concentration of 74.4 nM was selected for the CRISPR / Cas12a reaction system.

[0044] 4. Optimization of crRNA concentration To determine the optimal crRNA concentration, the crRNA concentrations were set to 50 nM, 100 nM, 150 nM, 200 nM and 250 nM, respectively, and a negative control group was set up with RNase-Free ddH2O instead of the target, 3 replicate wells were set up for each condition, the reaction system was incubated at 37°C for 50 minutes, and the fluorescence signal was collected every 2 minutes; by comparing the fluorescence reaction time and fluorescence signal intensity, the optimal crRNA concentration was screened.

[0045] The results are shown in Figure 3 As shown in the figure, with the increase of the concentration of crRNA, the fluorescence signal is better, and the negative background value is within the acceptable range, considering the effect and cost, the crRNA with a concentration of 200 nM is selected for the CRISPR / Cas12a reaction system.

[0046] Example 4. Sensitivity evaluation of bovine rotavirus RT-RAA-CRISPR / Cas12a visual detection method.

[0047] BRV VP6 gene positive plasmid (SEQ ID NO. 1) synthesized by Shanghai Shengong Bioengineering Co., Ltd. was used as a detection template to evaluate the sensitivity of the method. The BRV plasmid dry powder was dissolved in DEPC water, and the BRV positive plasmid solution was obtained through plasmid transformation experiment. The concentration was 307.80 ng / μL measured by ultraviolet spectrophotometer. The copy number of BRV positive plasmid was calculated by the following formula: RNA concentration (copies / μL) = [RNA concentration (ng / μL) / in vitro transcription RNA length] x 9.134 x 1011. The concentration of the artificially synthesized BRV plasmid was adjusted to 8.9 x 1010copies / μL. 10 copies / μL. The BRV VP6 positive plasmid was diluted by ten times in series (8.9 x 1010 3 -8.9 x 1010 -1 copies / μL), and different concentrations of BRV positive plasmid were used as target for RT-RAA reaction at 37 ℃ for 20 minutes. Then, CRISPR / Cas12a reaction was carried out at 37 ℃ for 20 minutes, and the visual detection results of the above reaction were judged by using blue light instrument.

[0048] As shown in the results, Figure 4 when BRV recombinant plasmid was present, green fluorescence appeared, and the sensitivity could reach 8.9 copies / μL. It can be seen that the kit for detecting bovine rotavirus provided by the present application has high sensitivity for detecting bovine rotavirus.

[0049] Example 5. Specificity evaluation of bovine rotavirus RT-RAA-CRISPR / Cas12a visual detection method.

[0050] The nucleic acids of bovine enterovirus (BEV), bovine parainfluenza virus (BPIV), bovine epidemic fever virus (BEFV) and bovine coronavirus (BCoV) were used as detection templates to evaluate the specificity of the bovine rotavirus RT-RAA-CRISPR / Cas12a visual detection method established in (1). The above pathogen nucleic acids were placed in the kit reaction system, and a negative control group was set at the same time, with RNase-Free ddH2O instead of target; RT-RAA reaction was carried out at 37 ℃ for 20 minutes, followed by transient centrifugation, and CRISPR / Cas12a reaction was carried out at 37 ℃ for 20 minutes; after the reaction, the visual detection results of the above reaction were judged by using blue light instrument.

[0051] As shown in the results, Figure 5As shown, the BRV group generates green fluorescence, and the BPIV, BEFV, BEV, BCoV experimental groups and the negative control do not generate fluorescence signals, that is, except for the positive control, only the detection result of the BRV group is positive, and the other pathogens are negative. It can be seen that the bovine rotavirus RT-RAA-CRISPR / Cas12a detection method established in the present application does not exist cross reaction with BEV, BPIV, BEFV, BCoV and other pathogens that can cause similar diarrhea symptoms in cattle, and the method has high specificity.

[0052] Example 6. Assembly of bovine rotavirus RT-RAA-CRISPR / Cas12a visual detection kit.

[0053] The forward primer, reverse primer and single-stranded DNA probe in Example 1, the bovine rotavirus VP6 gene positive plasmid in Example 2, the RT-RAA nucleic acid amplification reagent, the CRISPR / Cas12a reaction reagent, the blue light instrument and the eight connection tube are assembled into a 96T RT-RAA-CRISPR / Cas12a visual detection kit. Among them, the RT-RAA nucleic acid amplification reagent contains A Buffer, B Buffer, RNase Free ddH2O and RPA powder; the CRISPR / Cas12a reaction reagent includes crRNA, Cas12a Buffer and Cas12a nuclease.

Claims

1. A target, primer, and crRNA composition for a bovine rotavirus RT-RAA-CRISPR / Cas12a detection method, characterized in that: The primer and crRNA composition are designed with the conserved sequence of the BRV A VP6 gene as the target, and the conserved sequence of the BRV A VP6 gene is shown in SEQ ID NO.

1.

2. The primer composition according to claim 1, wherein The primer-probe composition includes primer FI, primer RI and crRNA; the nucleotide sequence of the primer FI is shown in SEQ ID NO.2, the nucleotide sequence of the primer RI is shown in SEQ ID NO.3, and the nucleotide sequence of the crRNA is shown in SEQ ID NO.

8.

3. Use of the primer and crRNA composition according to any one of claims 1 to 2 in the preparation of a kit for detecting bovine rotavirus.

4. A kit for detecting bovine rotavirus based on RT-RAA-CRISPR / Cas12a, characterized in that: The kit comprises the primer and crRNA composition according to any one of claims 1 to 2.

5. The kit according to claim 4, characterized in that The kit also includes reagents for RAA amplification, Cas12a Buffer and Cas12a nuclease.

6. Use of the kit according to any one of claims 4 to 5 in detecting bovine rotavirus.

7. A method for detecting bovine rotavirus based on RT-RAA-CRISPR / Cas12a, characterized in that: The method is to perform detection using the kit according to any one of claims 4 to 5.

8. The method according to claim 7, characterized in that: The method steps are as follows: S1: Prepare 50 μL of RT-RAA reaction system, which includes 2 μL each of 10 μM forward primer FⅠ and reverse primer RI, 25 μL of A Buffer, 2.5 μL of B Buffer, 5 μL of target to be detected, and 13.5 μL of RNase-Free ddH2O; S2: Prepare a CRISPR / Cas12a reaction system in 25 μL, comprising 5 μL of crRNA, 5 μL of Cas12a Buffer (10X), 5 μL of Cas12a nuclease, 2.5 μL of 10 μM ssDNA fluorescent reporter gene, and 7.5 μL of RNase-Free ddH2O; S3: Invert the 200 μL centrifuge tube containing the CRISPR / Cas12a reaction system into the 1.5 mL centrifuge tube containing the RT-RAA reaction; S4: Centrifuge and transfer the CRISPR / Cas12a reaction system to the RT-RAA reaction tube. Continue incubating in a 37°C constant temperature water bath for 20 minutes. Use a blue light analyzer to visualize the above reactants.

9. The method according to claim 8, characterized in that The concentration of Cas12a nuclease described in S2 is 74.4 nM; the concentration of crRNA concentration described in S2 is 200 nM.

Images